ID: 949925877

View in Genome Browser
Species Human (GRCh38)
Location 3:9041241-9041263
Sequence TTCAAGTCTAAGTTTACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 141}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949925871_949925877 20 Left 949925871 3:9041198-9041220 CCTGCTAAGTGTAGAGTCTGGAT 0: 1
1: 0
2: 0
3: 11
4: 141
Right 949925877 3:9041241-9041263 TTCAAGTCTAAGTTTACCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 141
949925867_949925877 28 Left 949925867 3:9041190-9041212 CCCAAGTCCCTGCTAAGTGTAGA 0: 1
1: 0
2: 1
3: 4
4: 126
Right 949925877 3:9041241-9041263 TTCAAGTCTAAGTTTACCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 141
949925870_949925877 21 Left 949925870 3:9041197-9041219 CCCTGCTAAGTGTAGAGTCTGGA 0: 1
1: 0
2: 0
3: 12
4: 153
Right 949925877 3:9041241-9041263 TTCAAGTCTAAGTTTACCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 141
949925873_949925877 -4 Left 949925873 3:9041222-9041244 CCAATCCAGGTTGCCTAACTTCA 0: 1
1: 0
2: 0
3: 9
4: 131
Right 949925877 3:9041241-9041263 TTCAAGTCTAAGTTTACCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 141
949925874_949925877 -9 Left 949925874 3:9041227-9041249 CCAGGTTGCCTAACTTCAAGTCT 0: 1
1: 0
2: 1
3: 23
4: 187
Right 949925877 3:9041241-9041263 TTCAAGTCTAAGTTTACCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 141
949925868_949925877 27 Left 949925868 3:9041191-9041213 CCAAGTCCCTGCTAAGTGTAGAG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 949925877 3:9041241-9041263 TTCAAGTCTAAGTTTACCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949925877 Original CRISPR TTCAAGTCTAAGTTTACCCA GGG Intronic
902740292 1:18433214-18433236 CTCAAGACTCAGTTTCCCCAGGG - Intergenic
902773619 1:18660573-18660595 TTCAAGTCTAACTTCCCCCTAGG + Intronic
904840051 1:33366921-33366943 TTCTGGTCTAACTTTACGCAGGG - Intronic
906784345 1:48601181-48601203 TTCAAGTGTTAGTTTCACCATGG + Intronic
909738713 1:79000761-79000783 TTATAGTCTAAATTAACCCAGGG - Intronic
910375961 1:86570899-86570921 TTCATGTTTAACTTTCCCCAAGG + Intronic
911703969 1:100989044-100989066 TTCAACTCTAAGTATTTCCATGG - Intergenic
916423284 1:164656898-164656920 TTCAAGTGTGAGTTTATACATGG + Intronic
918117812 1:181511635-181511657 TTCAAGGCTAAGATTCCCCAGGG + Intronic
919329959 1:196158885-196158907 TCAAAGTATAAGTTTATCCATGG + Intergenic
920071241 1:203304849-203304871 TTCAAGTCTAAGTTTTCTGGTGG - Intergenic
920194091 1:204214477-204214499 TTCACGTCTAACTTCCCCCATGG - Intergenic
922345183 1:224690631-224690653 TTCATGTCCCAGTTTCCCCAAGG + Intronic
922890273 1:229056781-229056803 CTCAAGTCTAAGATGAGCCAGGG + Intergenic
923759811 1:236831602-236831624 TTCAATTCTAACTTTGTCCATGG + Intronic
924024026 1:239814110-239814132 TTTAAGTCTAAATTTAAACAAGG + Intronic
1064934276 10:20662613-20662635 TTCATGCCTGAGTTTGCCCAGGG + Intergenic
1066691528 10:38033417-38033439 TTCACGTATAAGTTTTCACATGG + Intronic
1067001173 10:42615249-42615271 TTCATGTATAAGTTTTCACATGG - Intronic
1069505993 10:68998579-68998601 CTCAAGTCTAAGGATCCCCAAGG - Intronic
1076832162 10:133001131-133001153 TTCCAGTCTAAGTTTATCTGGGG - Intergenic
1081266321 11:41027320-41027342 GTCAACTCTAAGTTTTCCCAAGG - Intronic
1081327792 11:41767258-41767280 TTTAAGAATAAATTTACCCAAGG - Intergenic
1086845966 11:91749860-91749882 TTCAAATCCAAGTTTGCCTAAGG - Intergenic
1089958367 11:122593714-122593736 TTCAAGTTCAAGTTCACCCCCGG - Intergenic
1091578310 12:1760748-1760770 TTCAGATCTCAGTTGACCCATGG - Intronic
1093284818 12:17245816-17245838 TACAAGTCTGAGTTTGCCCATGG + Intergenic
1093320426 12:17707166-17707188 TCCAAGCCTCAGTTTTCCCATGG + Intergenic
1093798426 12:23341700-23341722 TTTAAGACTAAGTTTACACATGG - Intergenic
1096910568 12:54979806-54979828 TTCTAGTCTCTGTTTTCCCAGGG + Intronic
1097487442 12:60222899-60222921 TGCAACTCTAAGCTTTCCCAAGG + Intergenic
1099650581 12:85422700-85422722 ATCAAGTCTAAATTTAATCAAGG + Intergenic
1099714091 12:86268012-86268034 TTCAAATCTAACTTCACCCCAGG - Intronic
1100014382 12:89991173-89991195 TTCAAGTTTAAGTTAACTCTTGG - Intergenic
1102337817 12:112097224-112097246 TTTAAGTCTGAGTTTACCAGTGG + Intronic
1102603191 12:114048697-114048719 TTTAAGTTCATGTTTACCCATGG + Intergenic
1102828643 12:115973612-115973634 TTATAGTCTAACTTTCCCCAAGG + Intronic
1105770571 13:23607940-23607962 TTCAATTCTATTTTTTCCCAAGG + Intronic
1106664105 13:31833648-31833670 TTCAAGTCTAGGGGTCCCCAAGG - Intergenic
1110013539 13:70369625-70369647 TTTAAGTCTCAGCTTCCCCATGG - Intergenic
1110490368 13:76096668-76096690 CTCAGGTGTAAGTTTAACCAAGG + Intergenic
1111059916 13:83003638-83003660 TCCAAGTCTAAGTTCTTCCATGG + Intergenic
1115796812 14:36946410-36946432 ATCAAATATAAGTTTACTCATGG - Intronic
1116522281 14:45864567-45864589 GTTAGGTCTAAGTTTTCCCATGG + Intergenic
1116917024 14:50535237-50535259 TTCAGCTCTAACTTTAGCCAAGG + Intronic
1120717089 14:87851739-87851761 TTCAAGCCTAAGTCTTGCCAGGG + Intronic
1126172538 15:45706348-45706370 TTCAATCCTAAGTGTAACCAGGG - Intergenic
1129181847 15:73882655-73882677 TTCATGGGCAAGTTTACCCAGGG - Intronic
1129912619 15:79240889-79240911 TTAAAGTCCAGGTTGACCCATGG - Intergenic
1132286847 15:100669593-100669615 TTCAGGGCTCACTTTACCCAGGG - Intergenic
1133070987 16:3246701-3246723 TTCAAGTCTAATTCTAACCACGG + Intronic
1134616424 16:15654688-15654710 TTCAAGTCCAAGGCTTCCCAGGG - Intronic
1139048177 16:63088749-63088771 CTCAAGGCTTAGTTTACCCCTGG - Intergenic
1139256454 16:65547516-65547538 ATCAAGTCTAAGTTTGTGCAGGG - Intergenic
1140692947 16:77501810-77501832 GTCTTGTCCAAGTTTACCCAGGG - Intergenic
1140818396 16:78641211-78641233 TTCAGGTCTAAGTTTCCCCCAGG + Intronic
1141246457 16:82312280-82312302 TTCAAAACTAAGTCTAACCATGG - Intergenic
1144008245 17:11120940-11120962 TTCAATGCTTAGTTTACACAAGG - Intergenic
1145848352 17:28065068-28065090 TTCAAGTATAAGTTTCTCCCGGG - Intronic
1146705465 17:34997885-34997907 TTCCAGTCGCAGTTGACCCAAGG - Intronic
1148405436 17:47409663-47409685 TTCAAATCTAAAATTACCAAAGG + Exonic
1149108014 17:52992603-52992625 CTCAAGTCTAAGATTAAACAAGG + Intergenic
1151819098 17:76487713-76487735 TTCGAGTCTGAGTTTGCCCGCGG + Exonic
1154347645 18:13556667-13556689 AGCAAGTCTTTGTTTACCCATGG - Intronic
1154960471 18:21303206-21303228 TTGAAGTCTAGGTTTTCACATGG + Intronic
1157122317 18:44922993-44923015 TTCAAGGCTAGGTTAATCCATGG - Intronic
1158116755 18:54004781-54004803 TTCTACTTTAAGTGTACCCATGG + Intergenic
1160254044 18:77232350-77232372 TTTTAGTCAAACTTTACCCATGG - Intergenic
1162277072 19:9664367-9664389 TTAAAGTTTAATTTTCCCCAAGG + Intronic
1165758263 19:38306530-38306552 CTTAAGTCAAAGTTTATCCAAGG + Intronic
925806591 2:7656826-7656848 TTCAAGTCTGACTATATCCAAGG - Intergenic
926314629 2:11700279-11700301 TTTAAGTCTAAGAGTACCCTGGG - Intronic
927975563 2:27335839-27335861 TTCAACTCTAAGAATTCCCAGGG + Intronic
929728150 2:44454974-44454996 TTGAAATCTTAATTTACCCATGG + Intronic
930398566 2:50853345-50853367 TTCATGTCCAAGTTTGCCAATGG + Intronic
931543856 2:63358941-63358963 GTCAAGTCTAAGTATAACCTAGG - Intronic
931756339 2:65377916-65377938 TTCTATTCTAAGTTTACCAAAGG + Intronic
933321535 2:80781276-80781298 TTCAAGACAAAGTTTCACCAGGG - Intergenic
934852224 2:97708513-97708535 TTCAAGCCTAAGTTTCCTCTTGG + Intergenic
936621749 2:114107148-114107170 TTTAAGACTAAATTTAACCAAGG - Intergenic
940611584 2:155999441-155999463 TTTATGTCCATGTTTACCCAAGG - Intergenic
942737054 2:179126455-179126477 TTAAAGTTTAGGTTGACCCAAGG + Intronic
942781823 2:179652903-179652925 TTAAAGTCTTAGTTTAGGCAGGG + Intronic
943649286 2:190439573-190439595 CACAAGTCTAAGCTTACCAAAGG - Intronic
943800469 2:192051250-192051272 TTCTAATATAAGTTTACTCATGG - Intronic
944140651 2:196452433-196452455 TTTAAGTCTAAATTTACCCTTGG - Intronic
944466224 2:200002558-200002580 TTTAAGTCTAAATATTCCCATGG - Intronic
945089753 2:206167908-206167930 TTTAAGTCTCAATTTACACAAGG - Intergenic
945163356 2:206916312-206916334 TTAAATTCTTATTTTACCCAGGG + Intergenic
947782986 2:232786788-232786810 TACATGTGTAAGTGTACCCATGG + Intronic
1169349362 20:4855760-4855782 TTCACGTGTAACTTGACCCATGG + Exonic
949269070 3:2193150-2193172 TTGAAGTCTAAGTTTTCTCAGGG - Intronic
949925877 3:9041241-9041263 TTCAAGTCTAAGTTTACCCAGGG + Intronic
954986355 3:54797136-54797158 TTCCAGTGTAAATTTACCAATGG - Intronic
955337085 3:58095722-58095744 TGCAATTCTAAGTTTACAGATGG + Intronic
955583175 3:60446908-60446930 TTCAGGTATAAATCTACCCAAGG + Intronic
957940339 3:86995666-86995688 TTCAACTCCAAGTTGACCCAAGG - Intergenic
958852270 3:99342698-99342720 TTGAAGTCTAAGTTCAACCAAGG + Intergenic
962414244 3:135168012-135168034 TTCTTCTCTAAGGTTACCCAAGG + Intronic
964551714 3:157891903-157891925 TTTAAGTCTCAGTTTTCTCATGG + Intergenic
968441832 4:628248-628270 TTCATGTCTCAGTTTACAGAAGG + Intronic
971439606 4:26666754-26666776 TTAAAGCCTAAGTTGACTCAAGG - Intronic
971656237 4:29349012-29349034 TTCAAGTATATGTATATCCATGG + Intergenic
972151258 4:36093812-36093834 TTCATGTCTGTGTGTACCCAAGG + Intronic
972267223 4:37473210-37473232 TTAAATTTTAAGTTTTCCCATGG - Intronic
974656376 4:64828477-64828499 TTCAAGTGTAGGTTTGACCAAGG + Intergenic
974712988 4:65626908-65626930 TTCAAGTCTACCTTTTTCCAGGG - Intronic
976036348 4:80826869-80826891 TTCATGTCTAACTTCATCCAAGG - Intronic
977573414 4:98653346-98653368 TTTAAGTGCAAGTTTATCCAGGG - Intronic
983146146 4:164217328-164217350 TTGAAGTCTTATTTTACCCCAGG - Intronic
983596590 4:169474373-169474395 TTCAAGTCTCTTTTTACACAAGG + Intronic
990182883 5:53182349-53182371 TTGAAGTGTAAGGTTGCCCAAGG - Intergenic
990797700 5:59563291-59563313 TTCAAATTTCAGTTAACCCAGGG + Intronic
993389523 5:87301331-87301353 TTCAAGAAAAAGTATACCCAAGG - Intronic
994206489 5:97042148-97042170 TCCAAGTCTAGGTTTGCTCAAGG - Intergenic
995192755 5:109336435-109336457 TTCAAGTATAATTTTAACCAAGG + Exonic
996177103 5:120372185-120372207 TACAAATCTAAGCATACCCAGGG + Intergenic
1000105159 5:158052570-158052592 CTGAAGTCAAAGTTTTCCCAGGG - Intergenic
1000681380 5:164189116-164189138 ATCAAGTGTAACTGTACCCAAGG - Intergenic
1003971928 6:11308125-11308147 CTCAAGTCTACCTTCACCCATGG - Intronic
1005132829 6:22530646-22530668 TTCAGGGCTAAGTTTAGCCATGG - Intergenic
1007230891 6:40347154-40347176 CTGGAGTCTAAGTTTACTCAAGG - Intergenic
1007993563 6:46282700-46282722 TTCAAGTATAAGATTACTTATGG - Intronic
1009568182 6:65341448-65341470 TTCATGTCAAAATTTCCCCAGGG - Intronic
1009643959 6:66373194-66373216 TTCCAGCCTAAGCTGACCCAGGG - Intergenic
1009915101 6:69985113-69985135 TTCAAGTTTTATCTTACCCAAGG - Intronic
1012381471 6:98624495-98624517 TTGAATTTTAAGTTAACCCAAGG - Intergenic
1020497438 7:8873919-8873941 TTCATGTATAAGTTTCTCCATGG + Intergenic
1022952164 7:35349479-35349501 TCAAAGTATAAGTTTACCCAGGG + Intergenic
1028134832 7:87214388-87214410 TTCAGGTTTTAGTTTACCCTAGG + Intronic
1028432010 7:90758661-90758683 TTCAAGATTAAGTTTCCCGAGGG - Intronic
1030742211 7:113123502-113123524 TGCAAGAATAAGTTTACTCAAGG + Intergenic
1031097171 7:117434199-117434221 TTCAAGAGTAAGTGTACCCTCGG - Intergenic
1032967078 7:137110305-137110327 TTCAAGTCTAACTGTTTCCATGG - Intergenic
1035156233 7:156915561-156915583 TTCAAGTCTAAATAAGCCCAGGG - Intergenic
1035625940 8:1070702-1070724 TTGAAGGCTAACTTTCCCCATGG - Intergenic
1038203130 8:25435152-25435174 TTCAAGTCTATGTTTAATAAAGG + Intronic
1038257087 8:25959947-25959969 TTCTGGTCTAGGTTTACCCTTGG - Intronic
1044333757 8:90951931-90951953 TTCATGTCCAAATTTACCAAAGG - Intronic
1045250555 8:100480259-100480281 TTAAAGTGTAAGTTTAGCCTGGG - Intergenic
1045680034 8:104648986-104649008 AGCAAGTGTAAGTTTAACCAAGG - Intronic
1046869565 8:119190269-119190291 TTCCAGTTTAAGTTCAGCCACGG + Intronic
1048248284 8:132833432-132833454 TACAAGTCTACTTTTTCCCATGG + Intronic
1048385441 8:133908381-133908403 TCCAAGTCTCAGAATACCCAGGG + Intergenic
1050296614 9:4211524-4211546 TTCAGGGCTAACTTTAACCAAGG - Intronic
1050614133 9:7383925-7383947 TTCAAATCTAAGTTTTCTCAGGG + Intergenic
1050723640 9:8620789-8620811 TTCAAGTCTATATTAAGCCATGG + Intronic
1050804258 9:9653442-9653464 TTCATTTTTAAGTTTACCAAAGG - Intronic
1058606116 9:106725345-106725367 TTCAAGTCTAAGTTTGAAAATGG - Intergenic
1189766418 X:44377123-44377145 TTTAAGTCCATGTGTACCCAGGG - Intergenic
1194795504 X:98207308-98207330 TTCACGTCTAAGTAAACCAATGG - Intergenic
1195069674 X:101267025-101267047 TCCAAGTCAAAGTTAAGCCATGG - Intergenic
1195733753 X:107992231-107992253 TTCAAGGCTCACTCTACCCAAGG + Intergenic
1198387199 X:136140633-136140655 TTCAAGTCTAAGCTTGGCCTTGG - Intergenic
1199307729 X:146287170-146287192 TTCAAGGCTATATATACCCATGG + Intergenic
1201753686 Y:17463474-17463496 TTCAAGACTATATTTAACCAAGG - Intergenic
1201847867 Y:18442509-18442531 TTCAAGACTATATTTAACCAAGG + Intergenic
1202335637 Y:23807432-23807454 TTCAAGACTAAATTTAACCAAGG - Intergenic
1202535130 Y:25862627-25862649 TTCAAGACTAAATTTAACCAAGG + Intergenic