ID: 949925878

View in Genome Browser
Species Human (GRCh38)
Location 3:9041248-9041270
Sequence CTAAGTTTACCCAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949925874_949925878 -2 Left 949925874 3:9041227-9041249 CCAGGTTGCCTAACTTCAAGTCT 0: 1
1: 0
2: 1
3: 23
4: 187
Right 949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 130
949925871_949925878 27 Left 949925871 3:9041198-9041220 CCTGCTAAGTGTAGAGTCTGGAT 0: 1
1: 0
2: 0
3: 11
4: 141
Right 949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 130
949925870_949925878 28 Left 949925870 3:9041197-9041219 CCCTGCTAAGTGTAGAGTCTGGA 0: 1
1: 0
2: 0
3: 12
4: 153
Right 949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 130
949925875_949925878 -10 Left 949925875 3:9041235-9041257 CCTAACTTCAAGTCTAAGTTTAC 0: 1
1: 0
2: 0
3: 9
4: 188
Right 949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 130
949925873_949925878 3 Left 949925873 3:9041222-9041244 CCAATCCAGGTTGCCTAACTTCA 0: 1
1: 0
2: 0
3: 9
4: 131
Right 949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949925878 Original CRISPR CTAAGTTTACCCAGGGAAGC TGG Intronic
905426694 1:37891257-37891279 GTAAGTTGTCCCAGGGTAGCTGG - Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
917380341 1:174399547-174399569 CTCAGATTACACAGGGAAGAAGG + Intronic
918564690 1:185914934-185914956 CTGAGGATATCCAGGGAAGCAGG + Intronic
919011057 1:191963591-191963613 CTAAATTTAACTAGGGAACCAGG - Intergenic
920614168 1:207472966-207472988 GAAAGTTTACACAGGGGAGCAGG - Exonic
921573117 1:216802232-216802254 CAAGTTTTACCCAGGGAAGAGGG + Intronic
922731168 1:227949383-227949405 CCAGGCTTTCCCAGGGAAGCAGG - Intergenic
923645365 1:235815071-235815093 CTAAGTTTACTAAGGGAAGCAGG - Intronic
923982457 1:239340607-239340629 GTAAGTTTACCCAAGGCAGGAGG - Intergenic
1064798239 10:19038588-19038610 CTTAGTTTAGCCAGGTCAGCAGG + Intergenic
1066017935 10:31267238-31267260 CTAATTTTTCCAAGGGATGCAGG - Intergenic
1069662421 10:70132443-70132465 CTAAGTTTTCCTAAGGAAGATGG - Intronic
1070334176 10:75439859-75439881 CTAAGTCTGCTCTGGGAAGCTGG - Intronic
1073169247 10:101489075-101489097 CTAAGTTTTTTCAGGGAAGAGGG - Intronic
1075073702 10:119336264-119336286 CACAGTTTGCCCAGGGAAGCTGG + Intronic
1076674869 10:132142551-132142573 CTAAGGTGAGCCAGGGAAGTGGG - Intronic
1077218976 11:1407040-1407062 CTAGGGTTTCCCAGGGAAGGGGG + Intronic
1077660718 11:4066172-4066194 CAGAGCTAACCCAGGGAAGCTGG - Intronic
1078065724 11:8078100-8078122 ATCAGTTCACCCAGGGAAGAAGG - Intronic
1078369861 11:10735700-10735722 CTAAGTTTCTCCAAGGAGGCGGG - Intergenic
1079369859 11:19842171-19842193 CTGCATTCACCCAGGGAAGCTGG + Intronic
1082975074 11:59063105-59063127 CTTAGTTTATCCTGGGACGCGGG + Intergenic
1083292658 11:61698577-61698599 GTGAGCTTCCCCAGGGAAGCAGG - Intronic
1083344682 11:61981019-61981041 CTAACTTTACCCCTGGAAGAAGG - Intergenic
1090966247 11:131599882-131599904 CTAACTCTGCCCAGGGAGGCAGG - Intronic
1091206357 11:133823878-133823900 CAAACATTACCCAGGGAATCTGG + Intergenic
1091294438 11:134463737-134463759 CTCAGTGTACCCTGGGAACCTGG - Intergenic
1092241566 12:6839236-6839258 CTGAGCTGACCCAGGGAAGGTGG + Intronic
1096910569 12:54979813-54979835 CTCTGTTTTCCCAGGGAAGCAGG + Intronic
1099281137 12:80647842-80647864 TTATGTTTACCCTGAGAAGCTGG + Intronic
1099558923 12:84148551-84148573 CTAAGGTTGCACAGGGCAGCAGG - Intergenic
1100677524 12:96884256-96884278 CTGAGATTGCCCAGGGAAGAGGG - Intergenic
1102870561 12:116410821-116410843 CTGAATTTCCCCAGAGAAGCTGG + Intergenic
1105714785 13:23052377-23052399 CTGAGTTTGCCAAGGGAAACAGG - Intergenic
1105779089 13:23690733-23690755 CTATGTTTATCCCAGGAAGCTGG + Intergenic
1109886895 13:68555304-68555326 CTAAGTGTACCCAGGGATTTGGG - Intergenic
1110782537 13:79482280-79482302 CAAAGTTTACACAGTTAAGCTGG - Intronic
1111462036 13:88558147-88558169 ATAAGTTTTGCCAGGGAAGCAGG + Intergenic
1113554720 13:111223538-111223560 CTACACTTCCCCAGGGAAGCAGG - Intronic
1115691301 14:35846744-35846766 GTAAGTTTACCTGGGGAAACTGG - Intronic
1115712154 14:36062359-36062381 CTAAGTTTACCCAGTTAACCTGG - Intergenic
1122003630 14:98684650-98684672 CTGAATTTACCCAGGAACGCAGG + Intergenic
1122008745 14:98728316-98728338 CTAAGACTCCCCAGGTAAGCTGG + Intergenic
1129483514 15:75845565-75845587 CTAAGTTTACTCAGGTAAGTTGG + Intronic
1131199398 15:90384264-90384286 CTAAGTTTACACATGGAATCAGG + Intergenic
1132602983 16:782155-782177 CTAGGTTCACCCAGGGCAGCGGG + Intronic
1133120972 16:3607482-3607504 CTCAGTATACCAAGGGCAGCAGG + Intronic
1134879213 16:17729667-17729689 CCAAGGTGGCCCAGGGAAGCAGG + Intergenic
1135131451 16:19857138-19857160 ATAAGTTTACCCATAAAAGCAGG - Exonic
1141364890 16:83433514-83433536 CTAATTTTACCAAAGGCAGCTGG + Intronic
1142000889 16:87663741-87663763 GTAAGTTTACCGAGGGAGGTGGG - Intronic
1148020777 17:44551943-44551965 CTAAGATCACCTAGGGAAGATGG - Intergenic
1149432694 17:56607036-56607058 CTATTTGTACCCAGAGAAGCTGG + Intergenic
1149965619 17:61161011-61161033 CAAAGTTGACACAGGGAAGGGGG - Intronic
1157860050 18:51133164-51133186 CTCAGTTTCCCCATGGGAGCTGG + Intergenic
1157925010 18:51754544-51754566 CAAAGTTAGCCCAGGGAAACTGG + Intergenic
1158062113 18:53357038-53357060 TTAAGTTGATCCAGGCAAGCGGG + Intronic
1160364335 18:78311633-78311655 CTCGGTTTCCCAAGGGAAGCGGG - Intergenic
1164167496 19:22694985-22695007 CTAAAATTAGCCAGGGAAGGTGG - Intergenic
1165138608 19:33686131-33686153 CTCTCTATACCCAGGGAAGCTGG - Intronic
1168360788 19:55738173-55738195 CAAACATTACCCAGGAAAGCAGG - Exonic
926329314 2:11811471-11811493 CTAAGTTTAGTCAGGCAAGAAGG + Intronic
927462917 2:23314440-23314462 CTAAGGTTATCCAGGCAAGATGG - Intergenic
927662997 2:25008667-25008689 CTAAAATTACCCAGGCAAGGTGG - Intergenic
928286257 2:29992493-29992515 CTGAGTTTTGCCAGGTAAGCAGG - Intergenic
928698454 2:33874121-33874143 CTAGGTTTCCCTAGGAAAGCGGG - Intergenic
931083039 2:58797056-58797078 CTCAGTTTACTCACAGAAGCAGG + Intergenic
931570961 2:63668694-63668716 TTCAGTTTACCCTGGAAAGCGGG - Intronic
932502536 2:72196347-72196369 CTAAATTTACCCAGGGTATAAGG - Intronic
934853978 2:97717829-97717851 CTGCCTTTACCCAGGGAGGCTGG + Intronic
937116243 2:119406967-119406989 CTCAGTTTACCCAGTGATGGGGG - Intergenic
945666806 2:212753606-212753628 CTAGGGTTACTCAGGCAAGCAGG + Intergenic
947501863 2:230676742-230676764 CACAGTTTACTCAGGGAGGCTGG + Intergenic
947502486 2:230681594-230681616 CTAGGATTACCCAGTGAAGATGG + Intergenic
1171147488 20:22798132-22798154 CTGGGTTAACCCTGGGAAGCAGG - Intergenic
1175616521 20:60404641-60404663 ATAAGTTGAACCTGGGAAGCGGG + Intergenic
1178363663 21:31970401-31970423 CTTAGGTTACCAAGGGAACCTGG + Intronic
1178473055 21:32911872-32911894 CTGAGGTTTCCCAGGGAAGAAGG - Intergenic
1179975151 21:44861189-44861211 CTCAATTTACAAAGGGAAGCCGG + Exonic
1180767466 22:18353774-18353796 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1180778840 22:18508608-18508630 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1180811562 22:18765929-18765951 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1181197715 22:21200177-21200199 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1181395860 22:22621109-22621131 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1181647518 22:24241459-24241481 CTGAGGTTTCCCAGAGAAGCAGG - Intronic
1181703986 22:24636724-24636746 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1185166418 22:49265263-49265285 CTAACTTTACCAAGGGAATAGGG - Intergenic
1185379956 22:50503741-50503763 CTGGGTTTACCCCGGGAGGCTGG + Intronic
1203229088 22_KI270731v1_random:94658-94680 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
949459605 3:4276101-4276123 ATAAATTTCCCCAGGGAAGATGG - Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950058576 3:10049809-10049831 TTAAATTTAGCCTGGGAAGCTGG + Intronic
956020319 3:64926835-64926857 CTAACTATAGCCAGGGTAGCAGG + Intergenic
960573575 3:119207995-119208017 CTAATTTTAGCCAAGAAAGCAGG - Intergenic
964390146 3:156188164-156188186 ATAAACTTACCAAGGGAAGCTGG - Intronic
965019453 3:163209474-163209496 CTAATTTTATCCAGGGAAAAAGG - Intergenic
970520953 4:16883389-16883411 TTAAGTTTACAGAGGGAAGAAGG + Intronic
971491223 4:27214172-27214194 CTAAGTTTATCCAGGCATGGAGG + Intergenic
975048649 4:69832044-69832066 CTAATTTGACCCAGAGAGGCTGG - Intronic
977703050 4:100042309-100042331 CTCAGTTTTCTCAAGGAAGCAGG + Intergenic
977992678 4:103463329-103463351 CTTAATTTATCCAGGGAAGGGGG + Intergenic
978365073 4:107972946-107972968 CTAAGTCTTCCCAGGGAAGGGGG - Intergenic
984292558 4:177813721-177813743 CGAAGATTACCCTGGGAAGTTGG - Intronic
984837850 4:184039255-184039277 TTAAGCCTACCAAGGGAAGCAGG - Intergenic
985362044 4:189185922-189185944 CTAAGGTTCTCCAGGGAGGCAGG + Intergenic
990310120 5:54529748-54529770 CCAAGGTTACACAGTGAAGCTGG - Intronic
995859867 5:116629730-116629752 TTAAGTTTACCTAGGAAAACAGG + Intergenic
996579582 5:125016231-125016253 TTAAGCTTGCCTAGGGAAGCTGG + Intergenic
1002640789 5:180629695-180629717 CTGGGACTACCCAGGGAAGCAGG - Exonic
1004162113 6:13223557-13223579 CTAAATGTACCCAGGCAAGATGG - Intronic
1011400777 6:86959134-86959156 CTGAGTTTCCCCAAGGAAGAGGG - Intronic
1014282343 6:119455753-119455775 TAAAGATTACCCATGGAAGCAGG - Intergenic
1015127871 6:129774598-129774620 GTGAGTTTACCCAAGGAAGGAGG + Intergenic
1015429514 6:133113970-133113992 CCAACTTTTCCCTGGGAAGCTGG - Intergenic
1015603534 6:134933488-134933510 CTATCTTGGCCCAGGGAAGCAGG + Intronic
1021519652 7:21526670-21526692 CCAAGTTTGCACAGGGCAGCAGG - Intergenic
1023079127 7:36511362-36511384 CCAAGTGTGCCCAGGGAAGAAGG + Intergenic
1023598097 7:41853682-41853704 CTCAGGTGTCCCAGGGAAGCAGG - Intergenic
1023845724 7:44119120-44119142 CTTTGTTTACCCAGGGCACCTGG + Intronic
1027358276 7:77381623-77381645 CTGAGGGAACCCAGGGAAGCAGG - Intronic
1032480662 7:132244153-132244175 CCAAGTTTACCCAGGAAACTGGG - Intronic
1033463350 7:141567685-141567707 ATAATCTTCCCCAGGGAAGCTGG - Intronic
1036000339 8:4595603-4595625 TTAAGTATAACCAGTGAAGCTGG + Intronic
1037855107 8:22366388-22366410 CTAAATTTGCGCAGGGAAGGGGG - Intergenic
1043703311 8:83318264-83318286 CTAAGTATTGCCAGGGAAGAAGG - Intergenic
1048271041 8:133028230-133028252 CTCAGGTAACCCAGGAAAGCAGG - Intronic
1048583988 8:135755785-135755807 CTCAGGTTACCCAGAGAAGCAGG - Intergenic
1049740457 8:144238581-144238603 CTAAGATCACCCAAGAAAGCAGG - Intronic
1057528719 9:95825321-95825343 CTGTGCTTCCCCAGGGAAGCAGG - Intergenic
1058874853 9:109235315-109235337 CTAAGTTTACAAAGGGAAAGGGG - Intronic
1061389204 9:130307809-130307831 CCAGGGTCACCCAGGGAAGCCGG - Intronic
1203791700 EBV:155069-155091 CTAATTTTGCCCAGAGAGGCTGG + Intergenic
1185953045 X:4457694-4457716 CTAAATTTACCCAGTGAGGACGG - Intergenic
1186931941 X:14403057-14403079 CTATGTTTACCTATGGAAGGGGG + Intergenic
1192326021 X:70133246-70133268 CTAAGTGCACGAAGGGAAGCCGG + Intergenic
1196213573 X:113023855-113023877 CTAAGCTCACCCAGGCAGGCAGG + Intergenic
1197728867 X:129793940-129793962 CTAAGTGTCCCTGGGGAAGCAGG - Exonic
1199668132 X:150118436-150118458 GAAAGTTTACCCAGGGACTCTGG + Intergenic
1199753271 X:150841342-150841364 GGAAGTTTACACAGGGAAACTGG + Intronic
1200862347 Y:8006420-8006442 CTAAAATTACCAAAGGAAGCAGG + Intergenic