ID: 949925881

View in Genome Browser
Species Human (GRCh38)
Location 3:9041270-9041292
Sequence GTTCCACCTCCACAAACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949925873_949925881 25 Left 949925873 3:9041222-9041244 CCAATCCAGGTTGCCTAACTTCA 0: 1
1: 0
2: 0
3: 9
4: 131
Right 949925881 3:9041270-9041292 GTTCCACCTCCACAAACACAAGG 0: 1
1: 0
2: 1
3: 20
4: 167
949925874_949925881 20 Left 949925874 3:9041227-9041249 CCAGGTTGCCTAACTTCAAGTCT 0: 1
1: 0
2: 1
3: 23
4: 187
Right 949925881 3:9041270-9041292 GTTCCACCTCCACAAACACAAGG 0: 1
1: 0
2: 1
3: 20
4: 167
949925875_949925881 12 Left 949925875 3:9041235-9041257 CCTAACTTCAAGTCTAAGTTTAC 0: 1
1: 0
2: 0
3: 9
4: 188
Right 949925881 3:9041270-9041292 GTTCCACCTCCACAAACACAAGG 0: 1
1: 0
2: 1
3: 20
4: 167
949925879_949925881 -10 Left 949925879 3:9041257-9041279 CCCAGGGAAGCTGGTTCCACCTC 0: 1
1: 1
2: 2
3: 17
4: 199
Right 949925881 3:9041270-9041292 GTTCCACCTCCACAAACACAAGG 0: 1
1: 0
2: 1
3: 20
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949925881 Original CRISPR GTTCCACCTCCACAAACACA AGG Intronic
900754973 1:4427602-4427624 CCTCCACCTACACAAAAACAAGG + Intergenic
900861628 1:5237330-5237352 GTTCTACCTTCTCAAAGACAGGG + Intergenic
904259927 1:29282682-29282704 GCTCCTCCTCCACAATCACCTGG - Exonic
910433510 1:87181804-87181826 GTGCCACCTCCACATCCTCATGG + Intergenic
912342276 1:108928444-108928466 GTGCCACCTCCACACATACCTGG - Intronic
917658409 1:177151895-177151917 GTTCCTTCTGTACAAACACATGG - Intronic
921754602 1:218840228-218840250 CTTCCACCTGCCCACACACACGG + Intergenic
922668941 1:227494595-227494617 GCTCCACATCCACAAGCACAGGG + Intergenic
922670657 1:227506707-227506729 GCTCCACATCCACAAGCACAGGG - Intergenic
922949263 1:229544556-229544578 GTTTCTCCTGCACAAACTCATGG - Intronic
924914116 1:248548432-248548454 GTTCCACCTGCACTGACTCAAGG + Intergenic
1063437200 10:6043979-6044001 GTTCCACATCCACAGACAGAAGG - Intronic
1063799456 10:9556440-9556462 TTTCCACCTCTACAAAAACACGG + Intergenic
1064435517 10:15307697-15307719 GTTCTACCACCACAAAACCATGG + Intronic
1071525241 10:86354536-86354558 GATCCACCACCACAACCCCAAGG + Intronic
1072806113 10:98424915-98424937 GTCCCAGCTCCTCAAACACCAGG + Intronic
1072946760 10:99817255-99817277 GCTGCACCTCCAGAAACGCAGGG - Intronic
1073785333 10:106882859-106882881 GTTCCACCTCAACAATCATCAGG - Intronic
1075584584 10:123648393-123648415 ATTCCACCTCCACAACCCAATGG - Intergenic
1075621515 10:123931344-123931366 TGTCCTCCTCCACAAACTCATGG - Intronic
1075980934 10:126738586-126738608 ATGCTACCTCCACAAAGACAAGG + Intergenic
1077819092 11:5718369-5718391 CTTCCACCTCCCAAAAGACAAGG - Intronic
1081473562 11:43401232-43401254 TTTCCACCTACAAAAACAAAGGG - Intronic
1081648714 11:44808480-44808502 GTTCCCACTCTAGAAACACAGGG - Intronic
1082861412 11:57860276-57860298 ATTCCACATCCACTAACACTGGG + Intergenic
1084456608 11:69271407-69271429 GTGCCACCTCCCCGATCACATGG + Intergenic
1084911545 11:72393633-72393655 TTTCCATCTCCACACACATAGGG + Intronic
1087457766 11:98408875-98408897 CTTCCATCTCCACAAATGCAAGG - Intergenic
1088293759 11:108269626-108269648 GCTCTACCTCCACATACACTGGG - Intronic
1092199603 12:6572117-6572139 ATTCCACCTCCAAAAAAAAAAGG + Intronic
1093148432 12:15593755-15593777 ATTCTACCTCCACAAACAATAGG + Intronic
1095049699 12:37544843-37544865 TTGCCACCTCCACAGGCACAAGG - Intergenic
1095459695 12:42430094-42430116 GTTCCAACTCTCTAAACACATGG - Intronic
1095522379 12:43082836-43082858 GTTCCACTTTCTCAAACAGATGG - Intergenic
1096552777 12:52384368-52384390 ATTCCATCTCCACATAGACATGG + Intronic
1097532458 12:60821592-60821614 AATCCACCTCCACAAACCAAAGG + Intergenic
1098416099 12:70237124-70237146 GTTCCAACTCCCTAATCACATGG - Intergenic
1102132947 12:110547367-110547389 TTTCCTCATCCACAAAAACAGGG + Intronic
1102799304 12:115717641-115717663 GTCCCACCTCCAGAATGACATGG + Intergenic
1102921769 12:116796871-116796893 GTTCCAACTACCCACACACAGGG + Intronic
1103164847 12:118761861-118761883 GTCCCACCTCCTCATACTCAGGG + Intergenic
1106724360 13:32469332-32469354 GTTCCATCTCCACACTCACAGGG - Intronic
1107482472 13:40796030-40796052 GTTCCACATCCAGAAAGGCAGGG - Intronic
1107561479 13:41560934-41560956 GTTCCCTCTCCCCAAACCCAGGG - Intergenic
1107572252 13:41675272-41675294 GTTACTCCTCCACAAACATCTGG - Exonic
1107697356 13:43013288-43013310 GTGCCAACTCCCTAAACACATGG - Intergenic
1109371517 13:61426548-61426570 TATCCCCCTCCAAAAACACATGG - Exonic
1116370282 14:44121777-44121799 GTTCCACCTCAACAGACAGGAGG - Intergenic
1118374488 14:65164964-65164986 GTCCCACCTCCTCCAACCCAGGG + Intergenic
1119712256 14:76830756-76830778 GTTTCACCGCCACTATCACAAGG - Intronic
1121404447 14:93710844-93710866 ATTCAAACTCCACAAAAACACGG - Intergenic
1122211472 14:100176855-100176877 ACTCCACCTCCACAACCCCAGGG + Intergenic
1128550794 15:68596794-68596816 GATCCAGATCCACAAACCCACGG + Intronic
1133269173 16:4602261-4602283 GTCCCACCTCCCCACACAGAAGG - Intergenic
1133525937 16:6605735-6605757 ATGCAACCTCCACGAACACACGG - Intronic
1134053687 16:11155939-11155961 GTGCCACCTCCTAGAACACACGG + Intronic
1135167875 16:20156634-20156656 GATCCACCTCCACTTCCACATGG + Intergenic
1135844982 16:25910737-25910759 ATTCCACCTACAAAAACAGATGG + Intronic
1135860771 16:26053980-26054002 TTTCTACCACCACAAAGACAAGG + Intronic
1136346714 16:29680514-29680536 CTTCCACCAGCACAAACCCAGGG + Intronic
1137947664 16:52750494-52750516 GTTCTACCTCAACAGTCACAGGG + Intergenic
1138150607 16:54653235-54653257 GTACCACCTCCACACAGGCATGG + Intergenic
1138207167 16:55133572-55133594 TTTCCACCTCTGCAAACAAATGG + Intergenic
1138516472 16:57538015-57538037 TTTCCACCTCCAAAAACTCTGGG - Intergenic
1138542322 16:57695911-57695933 TTTCCAACTCCACACCCACATGG - Intronic
1142388160 16:89780162-89780184 CTGCCACCTCCACACACACAAGG + Intronic
1144627230 17:16850322-16850344 GTTCCAACTGCACCAGCACACGG + Intergenic
1144879209 17:18422390-18422412 GTTCCAACTGCACCAGCACACGG - Intergenic
1145067952 17:19775951-19775973 TTTACACCTCAGCAAACACATGG + Exonic
1145153026 17:20521997-20522019 GTTCCAACTGCACCAGCACACGG + Intergenic
1146921461 17:36715418-36715440 TTGCCACCTCCACACACAGAAGG - Intergenic
1147400190 17:40176357-40176379 TTTCCAAATCCACAAACAGATGG + Intergenic
1150735272 17:67731582-67731604 GTTCCACATCCAAGAACCCATGG + Intronic
1153240355 18:3025707-3025729 GTTCAACGTGCACACACACAGGG + Intergenic
1156576470 18:38322705-38322727 GATCCACCTCCAATATCACATGG + Intergenic
1158236015 18:55314917-55314939 TTTTCACCTCCACAAACCTAAGG - Intronic
1160914068 19:1488371-1488393 GAGCAACCCCCACAAACACAGGG - Intronic
1167007607 19:46786234-46786256 GTAGCATCTCGACAAACACATGG - Intronic
1167973005 19:53200547-53200569 GTGCCACGACCACACACACAGGG - Intergenic
1202678542 1_KI270711v1_random:29629-29651 GTTCCTTCACCACAAAAACAAGG + Intergenic
925456699 2:4022203-4022225 GCTCCAACTCCACAGACTCAGGG - Intergenic
926653199 2:15369295-15369317 TTTCCACCTCAATAAACTCAAGG + Intronic
927406251 2:22772053-22772075 GTTGAACCTCCACTAAAACATGG - Intergenic
927607044 2:24494721-24494743 CATCCACCTCCTGAAACACATGG - Intronic
932824475 2:74926953-74926975 GTTCCAGCCCCAGAATCACAGGG - Intergenic
935884309 2:107598818-107598840 GTTTCATCTCCACAACCAGAGGG + Intergenic
937105801 2:119311586-119311608 GGTCCCCCTCCAGCAACACAAGG + Intronic
937269712 2:120641200-120641222 GGACCACCTCCACCAAAACAAGG - Intergenic
938277401 2:130038317-130038339 GCTCCACCACCACAAGCACAGGG + Intergenic
938328373 2:130429120-130429142 GCTCCACCACCACAAGCACAGGG + Intergenic
938361575 2:130692374-130692396 GCTCCACCACCACAAGCACAGGG - Intergenic
938437983 2:131299063-131299085 GCTCCACCACCACAAGCACAGGG - Intronic
939360246 2:141162279-141162301 GTTCCACCTCCACAAAATCTGGG - Intronic
940910909 2:159209302-159209324 TTTTCACCTCTACAAAGACAAGG - Intronic
941263805 2:163333537-163333559 GTTCCCCTCCCTCAAACACAAGG - Intergenic
946148938 2:217751216-217751238 GATTCACCTACAGAAACACAAGG + Intronic
947009849 2:225553382-225553404 GTCCCAACTCCAGAATCACAGGG + Intronic
948214928 2:236221579-236221601 CTTCCACCTCCCCAGCCACATGG + Intronic
1170638880 20:18134196-18134218 GTTCCACCTTCACTCACACAAGG - Intergenic
1172445039 20:34988645-34988667 GTTCCACAATCACAAAAACAAGG - Intronic
1172511961 20:35506999-35507021 CTGCCACCTCCAAACACACAGGG + Intronic
1173494042 20:43506221-43506243 GGTGAACCTACACAAACACATGG - Intergenic
1175372539 20:58501667-58501689 GTTCCACCTCCACACGCACAGGG + Intronic
1175844640 20:62051998-62052020 ATGTCACCTCCACAACCACAAGG + Intronic
1175905979 20:62379664-62379686 GTGCCACCTCCACACACACCCGG - Intergenic
1177171390 21:17659753-17659775 GTTCCTCCACCTCAAGCACAGGG - Intergenic
1177437999 21:21081422-21081444 GTTCCACCTCAACACACACCAGG - Intronic
1180172507 21:46067108-46067130 GACCCACCTCCACAGAGACAGGG - Intergenic
1180658597 22:17446024-17446046 GTTCACCCTCCACATCCACAGGG - Intronic
1182756626 22:32685185-32685207 ATTCCTGCTCTACAAACACAAGG + Intronic
1182932785 22:34191015-34191037 GTCCCACCTCACCAACCACAGGG - Intergenic
1183808759 22:40236529-40236551 GTTCCAACTCCACAAAATCAAGG - Intronic
1184668125 22:45999185-45999207 GTTCCCCCTCCTCAGGCACATGG + Intergenic
1185091749 22:48779456-48779478 GTTTCTCCTTCTCAAACACAGGG - Intronic
1185375806 22:50482155-50482177 GTTGCTCCTCCCCACACACATGG + Intronic
949174563 3:1044210-1044232 CTTCCACCTCCACCCACACCTGG + Intergenic
949925881 3:9041270-9041292 GTTCCACCTCCACAAACACAAGG + Intronic
951345399 3:21542596-21542618 CTTCCACCTCCTCAAGCACTGGG + Intronic
952823286 3:37503460-37503482 CATCTAGCTCCACAAACACAAGG + Intronic
953743200 3:45554469-45554491 TCTCCACCTCCACAGCCACATGG - Intergenic
954136720 3:48585223-48585245 GTTCCACCCCCAATAACACTTGG - Intronic
956616300 3:71176247-71176269 GTTCCATGTTCCCAAACACAAGG + Intronic
956699392 3:71945377-71945399 GTTCCACTTCCACATCCCCAGGG - Intergenic
957201555 3:77142664-77142686 GTTCCATCACCACTCACACATGG + Intronic
957859943 3:85933603-85933625 ATTTCACCTCCATAATCACATGG - Intronic
957980247 3:87500184-87500206 CTTCCACCTCCACCCACACCAGG + Intergenic
959044580 3:101458753-101458775 GTTCCAAATGCACAAAAACAAGG + Intronic
959265745 3:104135904-104135926 GTTCCACGTCACCAAACTCAAGG - Intergenic
960852949 3:122074882-122074904 CTTCCTCCTCACCAAACACAAGG + Intronic
961563373 3:127746626-127746648 GTTCTACCCCCACAAAGACAGGG - Intronic
963417416 3:145015800-145015822 GTTCAACATACACAAACACAAGG + Intergenic
966522249 3:180886385-180886407 GTTCTACCCACACAAAAACATGG + Intronic
969628877 4:8323769-8323791 GATGCACCTCCAGAAACACAGGG + Intergenic
969808328 4:9627898-9627920 TGTGCACCTCCACAGACACATGG - Intergenic
970230146 4:13901401-13901423 GTTCCAGCTCCACCAAACCACGG - Intergenic
971056397 4:22917763-22917785 TTTCCCCCTCCACACATACATGG - Intergenic
978682726 4:111401850-111401872 GTTTCACATCCACACAAACACGG + Intergenic
979083779 4:116379154-116379176 CATCCACCTCCAGAAGCACATGG - Intergenic
979919091 4:126476686-126476708 CCTCCCCCTCCACAAACATATGG + Intergenic
987506399 5:18779099-18779121 ATACCACCCCCACACACACATGG - Intergenic
997803722 5:136892240-136892262 GCTCCCCCTGCACAAACGCAAGG + Intergenic
999653993 5:153795027-153795049 GTTCCACCTCCTCCAACTGAGGG + Intronic
999766053 5:154741649-154741671 GTGCCAGCCCCAGAAACACACGG - Intronic
1002269972 5:178064866-178064888 CTGCCACCTCCAACAACACAGGG - Intergenic
1003732443 6:8840662-8840684 GTTACTCCTCCACCAACCCAGGG - Intergenic
1004896019 6:20148408-20148430 GTTCCATCTCAAAAAACAAAGGG + Intronic
1006196617 6:32246811-32246833 GGTCCAGCTCCAGAACCACAAGG - Intergenic
1007815791 6:44524776-44524798 TATCCACCTGCACACACACAGGG - Intergenic
1010569537 6:77461766-77461788 GTTCTCCCCCCAAAAACACAGGG + Intergenic
1011719487 6:90140486-90140508 TTTCCACCTCAAAAGACACAGGG + Intronic
1011894879 6:92213214-92213236 CTTCTACCTCCACACATACATGG - Intergenic
1012976842 6:105789118-105789140 TTGCTACCTCCACAAGCACAGGG - Intergenic
1015976730 6:138798291-138798313 GTTCCAGCTGCATAATCACATGG + Intronic
1016106468 6:140170495-140170517 GTTCCTCCTCCCAAAACACATGG + Intergenic
1017630886 6:156395491-156395513 GTGCCTCCTCCATACACACAGGG + Intergenic
1022826196 7:34016801-34016823 CTTCCACCCCCACAAAAAAAAGG - Intronic
1025295220 7:57771213-57771235 GTGCCACCTCCACGAGCACAAGG - Intergenic
1027240206 7:76322410-76322432 GTACCACCACCACACACACCTGG - Intergenic
1032128854 7:129212965-129212987 CTTCCAGCCCCACAAACACCTGG - Exonic
1033905737 7:146200168-146200190 GGACCACTTCCACATACACAAGG + Intronic
1034820405 7:154211661-154211683 TCTCCACCTCCATACACACAAGG + Intronic
1038440172 8:27565898-27565920 GTTCCAGGTCCACAAGCACTGGG - Intergenic
1038681181 8:29669999-29670021 GTTCCACCTAGACAATTACAGGG - Intergenic
1042729555 8:71917052-71917074 GTTCCAGCTGCCCATACACAGGG + Intronic
1044839855 8:96328226-96328248 GTTCCACCTCCCCAAACGAGAGG - Intronic
1050801063 9:9615270-9615292 CTTCCACCTCCACCAGCACCTGG + Intronic
1050858826 9:10397443-10397465 GTTCCCTCTCCAAAAACAAAAGG - Intronic
1051069292 9:13144177-13144199 TTTCTACCTCCACAAAAACTGGG - Intronic
1052285564 9:26781101-26781123 GTTCCACCTCAGCACACCCAGGG - Intergenic
1052383926 9:27802940-27802962 GTTCCAGCCCAACAAACACCTGG + Intergenic
1053278026 9:36797970-36797992 GTGCCTCCTCCACAGGCACAGGG - Intergenic
1053573104 9:39330081-39330103 GTTCCACCTCCACAGAGGCCGGG + Intergenic
1054124040 9:61288930-61288952 GTTCCACCTCCACAGAGGCCGGG - Intergenic
1054172535 9:61855168-61855190 GTGCCACCGCCACAGACATAAGG - Exonic
1054665005 9:67725633-67725655 GTGCCACCGCCACAGACATAAGG + Intergenic
1056939123 9:90940180-90940202 GTTCAATCTCCACATAGACAAGG + Intergenic
1057314924 9:93961798-93961820 GTGCCACCTCCACAGGCACTGGG + Intergenic
1062014641 9:134284994-134285016 GACCCACCGGCACAAACACACGG - Intergenic
1062590717 9:137273302-137273324 GGTCCATCTCCACAACCCCAAGG - Exonic
1203776775 EBV:77637-77659 GTTCCACATCCACAAAACCGGGG - Intergenic
1191116112 X:56854634-56854656 GTACCAACTATACAAACACAGGG - Intergenic
1192960404 X:76124472-76124494 GTTCCAATTCAACAAACATATGG + Intergenic
1193598849 X:83483285-83483307 CTCATACCTCCACAAACACATGG - Intergenic
1194118269 X:89930062-89930084 GTTCCACATTCAAACACACAGGG - Intergenic
1195889974 X:109682689-109682711 CTCCCCCCTCCAAAAACACAAGG + Intronic
1198889126 X:141373378-141373400 GTTCTACCTCCACACACATTGGG + Intergenic
1199027675 X:142959265-142959287 GTCCCAGCTCCTCAAACACTAGG - Intergenic
1200471148 Y:3587627-3587649 GTTCCACATTCAAACACACAGGG - Intergenic
1201930992 Y:19347413-19347435 GAACCACCTACACAAACTCATGG - Intergenic