ID: 949925883

View in Genome Browser
Species Human (GRCh38)
Location 3:9041275-9041297
Sequence ACCTCCACAAACACAAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 226}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949925880_949925883 -6 Left 949925880 3:9041258-9041280 CCAGGGAAGCTGGTTCCACCTCC 0: 1
1: 1
2: 2
3: 29
4: 232
Right 949925883 3:9041275-9041297 ACCTCCACAAACACAAGGTGAGG 0: 1
1: 0
2: 0
3: 19
4: 226
949925875_949925883 17 Left 949925875 3:9041235-9041257 CCTAACTTCAAGTCTAAGTTTAC 0: 1
1: 0
2: 0
3: 9
4: 188
Right 949925883 3:9041275-9041297 ACCTCCACAAACACAAGGTGAGG 0: 1
1: 0
2: 0
3: 19
4: 226
949925879_949925883 -5 Left 949925879 3:9041257-9041279 CCCAGGGAAGCTGGTTCCACCTC 0: 1
1: 1
2: 2
3: 17
4: 199
Right 949925883 3:9041275-9041297 ACCTCCACAAACACAAGGTGAGG 0: 1
1: 0
2: 0
3: 19
4: 226
949925873_949925883 30 Left 949925873 3:9041222-9041244 CCAATCCAGGTTGCCTAACTTCA 0: 1
1: 0
2: 0
3: 9
4: 131
Right 949925883 3:9041275-9041297 ACCTCCACAAACACAAGGTGAGG 0: 1
1: 0
2: 0
3: 19
4: 226
949925874_949925883 25 Left 949925874 3:9041227-9041249 CCAGGTTGCCTAACTTCAAGTCT 0: 1
1: 0
2: 1
3: 23
4: 187
Right 949925883 3:9041275-9041297 ACCTCCACAAACACAAGGTGAGG 0: 1
1: 0
2: 0
3: 19
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949925883 Original CRISPR ACCTCCACAAACACAAGGTG AGG Intronic
900994639 1:6113890-6113912 GCCTCCAGAAACAAAAGGGGAGG + Intronic
901651518 1:10745883-10745905 TCCTATTCAAACACAAGGTGTGG + Intronic
902132582 1:14276027-14276049 AGATGCACAAACACAAGATGGGG + Intergenic
902251633 1:15157246-15157268 AACACCACAGACAGAAGGTGAGG - Intronic
902332599 1:15737978-15738000 ACCAGCACAATCACCAGGTGAGG + Exonic
905181935 1:36172611-36172633 AGCTCGAGAAAAACAAGGTGCGG + Exonic
905903197 1:41595905-41595927 ACTCACACAATCACAAGGTGAGG - Intronic
908391851 1:63690468-63690490 ACTCACACAATCACAAGGTGAGG + Intergenic
908508962 1:64835711-64835733 ACCAGCACAAGCACAAGGAGTGG - Intronic
909231729 1:73100035-73100057 ATCACCACAAGCACAATGTGGGG - Intergenic
909644861 1:77905647-77905669 ACCTCCTCGACCAGAAGGTGAGG - Intronic
912353318 1:109035265-109035287 AACCCCACACACACAAGGTCTGG + Intronic
913558757 1:119997046-119997068 GCCTCCATTGACACAAGGTGAGG + Exonic
915328416 1:155093251-155093273 ACATACACAAACACAAGGAGAGG + Intergenic
915880235 1:159663049-159663071 ACTCACACAATCACAAGGTGAGG + Intergenic
917619957 1:176785660-176785682 ACCACCAGCAACACAAGGAGGGG - Intronic
917794330 1:178521840-178521862 ACCTCCACACACTCAAGTTTTGG - Intronic
918770309 1:188549207-188549229 TCCTGCACAAACAAAAGATGAGG - Intergenic
920211297 1:204330751-204330773 TCCTCCACAACCTCATGGTGGGG - Intronic
920348378 1:205321479-205321501 ACCACCACAAGCACAACCTGCGG - Exonic
922668945 1:227494600-227494622 ACATCCACAAGCACAGGGCGGGG + Intergenic
922670653 1:227506702-227506724 ACATCCACAAGCACAGGGCGGGG - Intergenic
922676580 1:227556519-227556541 TCCTCCACAAACATAACATGCGG - Intergenic
923023315 1:230184137-230184159 ACTTCCTCAAACACAAGTTGAGG - Intronic
1063063899 10:2589310-2589332 ACCTCCACAAACACTGTCTGTGG - Intergenic
1063457776 10:6196405-6196427 ACTCCCACGATCACAAGGTGAGG + Intronic
1063537159 10:6894514-6894536 ACAACAACAAAAACAAGGTGTGG - Intergenic
1064519804 10:16189076-16189098 ACTCACACAATCACAAGGTGAGG - Intergenic
1065762877 10:28999446-28999468 ACCCACACAATCACGAGGTGAGG + Intergenic
1067133110 10:43584175-43584197 TCCTCCACAAACATAACATGAGG + Intergenic
1067189418 10:44057123-44057145 AGCTGCACAAACACATGGGGCGG + Intergenic
1067561954 10:47310426-47310448 ACTTCCACAAGCACCAGCTGTGG + Exonic
1068055710 10:52010873-52010895 AGCACCACAATCACAAGGTTTGG - Intronic
1068406403 10:56595277-56595299 ACTCACACAATCACAAGGTGAGG + Intergenic
1070312971 10:75287182-75287204 ACCACCATAAGCACAAGGAGAGG - Intergenic
1070416548 10:76195516-76195538 ACCTCCATAAATACAAGGCCAGG - Intronic
1070751138 10:78964594-78964616 ACCCCCAGAAACCCAAGGTAGGG - Intergenic
1073981718 10:109161638-109161660 ACTCGCACAATCACAAGGTGAGG - Intergenic
1075640402 10:124060421-124060443 ACCTCCACACACCCCTGGTGGGG - Intronic
1075640412 10:124060451-124060473 ACCTCCACACACCCCTGGTGGGG - Intronic
1075935102 10:126333561-126333583 ACTTCCCCAAAGTCAAGGTGTGG - Intronic
1076218213 10:128712607-128712629 ATCTCCACAACCACAGGATGGGG - Intergenic
1076890927 10:133282964-133282986 TCCTCCACGAACACAAGGGCAGG + Intronic
1079210176 11:18454331-18454353 ACTCACACAATCACAAGGTGAGG + Intergenic
1079210559 11:18456856-18456878 ACCTCCACAACCATACGCTGTGG - Intronic
1082016623 11:47493538-47493560 GCGTGCACACACACAAGGTGTGG + Intronic
1088102654 11:106172088-106172110 ACCCACACAATCTCAAGGTGAGG - Intergenic
1088368513 11:109063747-109063769 CCATGCACAAACACATGGTGGGG - Intergenic
1090066380 11:123507270-123507292 CCCACCACAAACCAAAGGTGTGG - Intergenic
1090231130 11:125104702-125104724 AAGTCCACAAACATCAGGTGAGG + Intronic
1092046499 12:5434719-5434741 GCCTGCACAAACACATGGAGTGG + Intronic
1093663514 12:21785145-21785167 ACTCACACAATCACAAGGTGAGG + Intergenic
1094604362 12:31937880-31937902 ACTCACACAATCACAAGGTGAGG - Intergenic
1095049314 12:37542629-37542651 ACCTCCACGAGCATAAGGGGAGG - Intergenic
1095049695 12:37544838-37544860 ACCTCCACAGGCACAAGGGGAGG - Intergenic
1096096084 12:48936645-48936667 GCCCCCAAAAAAACAAGGTGAGG + Exonic
1096885118 12:54710128-54710150 ACGTGCACAATCACGAGGTGAGG + Intergenic
1097598925 12:61668378-61668400 ACTCACACAATCACAAGGTGAGG + Intergenic
1098768239 12:74517324-74517346 ACTAACACAATCACAAGGTGAGG + Intergenic
1099452055 12:82819900-82819922 ACTCACACAATCACAAGGTGAGG + Intronic
1100569127 12:95830047-95830069 ACTCACACAATCACAAGGTGAGG + Intergenic
1101443123 12:104718376-104718398 AGCTGCACAACCACCAGGTGAGG + Intronic
1102737463 12:115175444-115175466 ACTCACACAATCACAAGGTGAGG + Intergenic
1102988309 12:117296614-117296636 ACTCACACGAACACAAGGTGAGG - Intronic
1103436584 12:120931570-120931592 ATCTCTGGAAACACAAGGTGGGG - Intergenic
1104548117 12:129730972-129730994 ACTCCCACAATCACAAAGTGAGG - Intronic
1106782107 13:33069752-33069774 ACCAAAACAAACACAATGTGGGG + Intergenic
1111087803 13:83399412-83399434 ACTCACACAATCACAAGGTGAGG - Intergenic
1111159174 13:84371169-84371191 ACCTCCTCTCACACAAAGTGAGG + Intergenic
1113267233 13:108633259-108633281 ACTCACACAATCACAAGGTGAGG + Intronic
1113436870 13:110299295-110299317 ACCTCCAAAAACAGAAGCTCTGG + Intronic
1113528853 13:111005002-111005024 ACCTACATAAACAGAAGCTGAGG - Intergenic
1113991909 14:16034582-16034604 ACCACCACAATCACCAGTTGGGG - Intergenic
1114549722 14:23525817-23525839 ACCTCCACGATCTCAAGGTGGGG - Exonic
1115110849 14:29820074-29820096 GCCTCCACAATGAGAAGGTGAGG + Intronic
1116748942 14:48857201-48857223 AATTCCACAAAAACAAGGTAAGG + Intergenic
1116869979 14:50061366-50061388 ACCTCCACAAACTCAGGATTTGG + Intergenic
1118780375 14:69003827-69003849 ACCTTGACACACACGAGGTGTGG - Intergenic
1119137648 14:72235238-72235260 ACCTCACCAAACTGAAGGTGGGG - Intronic
1119393663 14:74309542-74309564 ACCTCAAAAAACACACAGTGAGG + Intronic
1120977673 14:90263831-90263853 TCCTGCTCAACCACAAGGTGAGG + Exonic
1122281816 14:100628037-100628059 GCCTCCACACACACACGGGGTGG + Intergenic
1202879041 14_KI270722v1_random:40140-40162 ACTTCCAATAACACAAGTTGGGG + Intergenic
1124194154 15:27606015-27606037 ACTCTCACAATCACAAGGTGAGG + Intergenic
1125667313 15:41441559-41441581 ATCTCCTCTAACACAAGTTGTGG - Intronic
1125825380 15:42672075-42672097 AGCTAAACAAACAAAAGGTGGGG - Intronic
1127029235 15:54843518-54843540 ACCACCACAAAAAAAAGGGGAGG + Intergenic
1128756192 15:70185559-70185581 CCCTCCACAACCACAGGCTGTGG + Intergenic
1130066427 15:80608635-80608657 ACTCACACAATCACAAGGTGAGG - Intergenic
1130327366 15:82891547-82891569 CACTCCACAAACAGAAGGTGTGG - Intronic
1131531431 15:93196206-93196228 CTCTGCACAAACAGAAGGTGAGG - Intergenic
1132724141 16:1331622-1331644 CCCTCCACAAACATTTGGTGAGG - Intergenic
1136676084 16:31907507-31907529 ACCTATAAAAACACAAAGTGTGG - Intronic
1139808834 16:69594808-69594830 ACTCACACAATCACAAGGTGAGG + Intronic
1140750349 16:78017919-78017941 CCTTCCCCAAAGACAAGGTGGGG + Intergenic
1140764573 16:78145270-78145292 ACTCCCACAATCACAAGCTGAGG + Intronic
1142331291 16:89455468-89455490 ACCTCAAAACACACCAGGTGGGG + Intronic
1144096912 17:11908073-11908095 CCCTCCACATACACGGGGTGGGG + Intronic
1149443430 17:56694561-56694583 AGCTCCACAAACAAAAGGTATGG - Intergenic
1151126261 17:71847972-71847994 ACCTCTATAAGCACAAGTTGGGG + Intergenic
1152028616 17:77827530-77827552 TCCTCCACAGACACAAGGGTTGG + Intergenic
1153721100 18:7904357-7904379 AATTCCACCAACACAAGGAGTGG + Intronic
1154071462 18:11156011-11156033 ACTCACACAATCACAAGGTGAGG + Intergenic
1156826760 18:41439263-41439285 ACTCACACAATCACAAGGTGAGG + Intergenic
1159080795 18:63733332-63733354 ACCTAGACAAACAAAAGCTGAGG + Intergenic
1160337640 18:78056975-78056997 TCCTCCCCAGACACCAGGTGAGG + Intergenic
1160398437 18:78589612-78589634 ATGTCCACAAACACGAGGTGAGG - Intergenic
1160549006 18:79681135-79681157 TCCTCAACAAACACAGGGTCAGG - Intronic
1162423242 19:10578226-10578248 GCCTCCACAATCCTAAGGTGGGG - Intronic
1162957326 19:14106754-14106776 TCCTCGACAAACAGAAGGTGAGG - Exonic
1163328044 19:16617972-16617994 CCCCCCAGAAACACAAGGTGGGG + Intronic
1167093109 19:47358195-47358217 AACTCCACAAACACAGGGCTCGG + Intronic
1202654662 1_KI270708v1_random:9148-9170 ACTTCCAATAACACAAGTTGGGG + Intergenic
925837667 2:7961638-7961660 ATCTCCATAAACAGAAGTTGAGG + Intergenic
927574708 2:24191299-24191321 ACCACCACACACACAGGATGGGG + Exonic
928162917 2:28945512-28945534 AAATCCACAAACATAAGGTGGGG - Intronic
929100233 2:38304331-38304353 ACTTCCTCAAACAAAAGCTGAGG + Intronic
929136266 2:38626708-38626730 ACTCACACAATCACAAGGTGAGG + Intergenic
929926357 2:46215280-46215302 ACTTCCCCAAACAAAAGCTGAGG - Intergenic
930568344 2:53051936-53051958 CCCTCCAAAAACACATGTTGTGG + Intergenic
935008935 2:99112859-99112881 TCCCCCACAAACAAAGGGTGGGG - Intronic
935928300 2:108094020-108094042 ACCTACTGAGACACAAGGTGGGG - Intergenic
938509060 2:131921067-131921089 ACCCACACAATCACAAGGTGAGG + Intergenic
941630346 2:167877430-167877452 ACCTCACCAAGCATAAGGTGAGG + Intergenic
943443523 2:187953479-187953501 TCCACCACAATCACAAGGTCAGG + Intergenic
943831109 2:192463307-192463329 ACTTACACACTCACAAGGTGAGG - Intergenic
946148940 2:217751221-217751243 ACCTACAGAAACACAAGGAAGGG + Intronic
946713997 2:222534135-222534157 TCCTCCACAAACACAATATTAGG - Intronic
947557076 2:231102648-231102670 TCCTCCACCAACCCAATGTGAGG - Intronic
947739920 2:232480348-232480370 CCCACCCCAAACACAAGGAGTGG + Intronic
948033651 2:234840290-234840312 ACTTACACGATCACAAGGTGAGG - Intergenic
948709191 2:239814941-239814963 ATCTCCACACACACAAGCTGAGG + Intergenic
1168908749 20:1428070-1428092 ACCACCACACACAGAAGGTTGGG + Intergenic
1171769951 20:29314686-29314708 ACCACCACAATCACCAGTTGGGG + Intergenic
1171906573 20:30904419-30904441 ACCACCACAATCACCAGTTGTGG - Intergenic
1172081916 20:32348618-32348640 ATCTTCACAAACACACTGTGAGG - Intergenic
1172801760 20:37581070-37581092 TCCTCCACAAAGTCAAGATGGGG + Intergenic
1173884673 20:46446730-46446752 GCCTCCACTGACACAAGGGGTGG + Intergenic
1174574835 20:51529812-51529834 ACCTCCATAAATAGAAGGTAGGG + Intronic
1174666210 20:52260381-52260403 ACTCACACAATCACAAGGTGAGG - Intergenic
1175270102 20:57727879-57727901 AGCTCCATAAACTAAAGGTGGGG + Intergenic
1175949884 20:62577737-62577759 TCCTCCACACACAGCAGGTGGGG - Intergenic
1176640347 21:9297596-9297618 ACTTCCAATAACACAAGTTGGGG + Intergenic
1176784426 21:13237472-13237494 ACCCACACAATCACAAGGTGAGG - Intergenic
1177982476 21:27931334-27931356 ACCCACACAATCACAAGGTGAGG - Intergenic
1178057750 21:28818399-28818421 ACTTACACAATCATAAGGTGAGG - Intergenic
1179713416 21:43275724-43275746 CCCACCACAGACACCAGGTGAGG + Intergenic
1179713426 21:43275754-43275776 CCCACCACAGACACCAGGTGAGG + Intergenic
1179713451 21:43275846-43275868 CCCACCACAGACACCAGGTGAGG + Intergenic
1179713470 21:43275906-43275928 CCCACCACAGACACCAGGTGAGG + Intergenic
1179713480 21:43275936-43275958 CCCACCACAGACACCAGGTGAGG + Intergenic
1180007083 21:45027828-45027850 CCCTCCACAAAGATGAGGTGAGG - Intergenic
1180315363 22:11272944-11272966 ACCACCACAATCACCAGTTGGGG + Intergenic
1180339985 22:11610538-11610560 ACCACCACAATCACCAGTTGGGG - Intergenic
1180349372 22:11786981-11787003 ACTTCCAATAACACAAGTTGGGG + Intergenic
1180388839 22:12205248-12205270 ACTTCCAATAACACAAGTTGGGG - Intergenic
1180590464 22:16932850-16932872 ACGTCCATAAAGAAAAGGTGTGG + Intergenic
1181730608 22:24843593-24843615 ACCTCCTCAACCTCAAAGTGGGG + Intronic
1182327975 22:29528718-29528740 ACCACCACCATCACAAGGAGGGG - Intronic
1182756629 22:32685190-32685212 TGCTCTACAAACACAAGGTAGGG + Intronic
949151827 3:778319-778341 ACACCCACAAACAAAAGCTGAGG + Intergenic
949925883 3:9041275-9041297 ACCTCCACAAACACAAGGTGAGG + Intronic
951471835 3:23064614-23064636 ACTCACACAATCACAAGGTGAGG - Intergenic
952278324 3:31899374-31899396 TCCTCCAAAAATACAAGATGGGG + Intronic
952284289 3:31953359-31953381 ACCCCCACACACACAAAGAGTGG + Intronic
957026066 3:75183235-75183257 ACCTCCAGACACACAAGCTTAGG + Intergenic
959270089 3:104196117-104196139 ACACACACACACACAAGGTGCGG + Intergenic
961614293 3:128166695-128166717 ACCTCCACTCTCCCAAGGTGCGG + Intronic
965126044 3:164630870-164630892 ACTCACACAATCACAAGGTGAGG + Intergenic
967232217 3:187350641-187350663 ACACCCACATACACAGGGTGGGG - Intergenic
1202746549 3_GL000221v1_random:107426-107448 ACTTCCAATAACACAAGTTGGGG - Intergenic
968668756 4:1836514-1836536 ACCACCACGAACACAAGGAACGG + Exonic
969171393 4:5366722-5366744 AGCTCAACAAAGACAAGGTCAGG - Intronic
970246267 4:14067322-14067344 AGCTCCCCAAACCCAAGGGGGGG - Intergenic
970846741 4:20548551-20548573 ACTTTCACACTCACAAGGTGAGG - Exonic
972382678 4:38534043-38534065 ACTCACACAATCACAAGGTGAGG - Intergenic
974653130 4:64781184-64781206 ACCGGCACAAACAGAAGATGGGG + Intergenic
974949584 4:68571732-68571754 TCCTCCACAAACATAATATGAGG + Intronic
975081512 4:70285931-70285953 AACTCCACAAACCCAAGGACTGG + Intergenic
977846858 4:101777113-101777135 ACTCACACAATCACAAGGTGAGG - Intronic
979354674 4:119689191-119689213 ACCTGCAGAAACTCCAGGTGTGG + Intergenic
980678677 4:136126121-136126143 ACTCACACAATCACAAGGTGAGG + Intergenic
983259495 4:165440458-165440480 CCCCCCACACACACAAGCTGTGG + Intronic
983528556 4:168785638-168785660 ATCTTCCCAAACCCAAGGTGGGG - Intronic
984994379 4:185414521-185414543 ACCTCCACATACAGAGGGTCAGG + Intronic
986629534 5:9756488-9756510 ACCTCTACAAACTCAAGAGGAGG + Intergenic
987126095 5:14814222-14814244 TCCTCCACATAAACAACGTGAGG + Intronic
988368777 5:30339493-30339515 ACTGACACAATCACAAGGTGAGG - Intergenic
988792904 5:34624874-34624896 AGCTACAGGAACACAAGGTGTGG + Intergenic
989754302 5:44934413-44934435 TCCTAGACAAACACAAAGTGAGG - Intergenic
996647266 5:125831272-125831294 ACCTCCAAAAACACATGCTATGG + Intergenic
998385428 5:141754547-141754569 ACCACCACCACCACAGGGTGGGG + Intergenic
999101655 5:149030323-149030345 GCCTGCACAACCATAAGGTGCGG + Intronic
1000139640 5:158389668-158389690 ACTCACACAATCACAAGGTGAGG + Intergenic
1000604612 5:163314705-163314727 TCCTCCACAAACATAACGTGAGG + Intergenic
1003305895 6:4928243-4928265 ACATACACACACAAAAGGTGTGG - Intronic
1005931956 6:30490842-30490864 ACCTCCAAAAACTCTTGGTGTGG - Intronic
1009631043 6:66201573-66201595 ACTCACACAATCACAAGGTGAGG + Intergenic
1010710441 6:79168556-79168578 CACTTCACAAACACAAGTTGAGG + Intergenic
1011758349 6:90529057-90529079 ATGTCCTCAAACACAAGGTCTGG - Intronic
1014486699 6:122008090-122008112 ACTTCCACACACACAGAGTGAGG + Intergenic
1017970745 6:159310615-159310637 ACTCACACAATCACAAGGTGGGG - Intergenic
1019380233 7:717859-717881 ACCTACACACACTCAAGGGGAGG - Intronic
1019909260 7:4089280-4089302 GCCTCCACACCCACAACGTGTGG - Intronic
1023403623 7:39809268-39809290 ACTTTCACAAATACAAGGTACGG + Intergenic
1023704586 7:42928158-42928180 ACCCCCACAAATACCAAGTGAGG - Intronic
1025295216 7:57771208-57771230 ACCTCCACGAGCACAAGGGGAGG - Intergenic
1025295606 7:57773427-57773449 ACCTCCACGGGCACAAGGGGAGG - Intergenic
1026119380 7:67523559-67523581 ACCTCCACAAGCATAAAATGTGG + Intergenic
1030458514 7:109802578-109802600 ATCCACACAATCACAAGGTGAGG + Intergenic
1032580517 7:133099155-133099177 GGCTACAAAAACACAAGGTGAGG + Intergenic
1033365192 7:140667738-140667760 TCCTCCACAAACATAACATGAGG - Intronic
1033483668 7:141766644-141766666 ACCTCCACAACCAGCAAGTGAGG + Intronic
1039509970 8:38083614-38083636 ACCTCCACATACATAACATGAGG + Intergenic
1041483801 8:58351883-58351905 ACCTCCCAAAACAGAAGGTATGG + Intergenic
1042325176 8:67520867-67520889 ACCTCCCCAAATACTAGGTCAGG - Intronic
1042834993 8:73071598-73071620 AGCTCCACAAAAACCAGGAGGGG + Intronic
1042864296 8:73344053-73344075 ACCTCTACAAAGAGAAGATGAGG + Intergenic
1044969255 8:97604201-97604223 ACATCAACAATCACAATGTGTGG + Intergenic
1045800169 8:106092958-106092980 ACACGCACAATCACAAGGTGAGG - Intergenic
1046861762 8:119100853-119100875 TGCTCCCCAAACAGAAGGTGGGG - Intronic
1047178628 8:122566382-122566404 ACCAGCACAAACCCAAGGGGAGG + Intergenic
1052844513 9:33323269-33323291 ACCACAACAAAAACAAGCTGTGG + Intronic
1054172531 9:61855163-61855185 ACCGCCACAGACATAAGGGGTGG - Exonic
1054665009 9:67725638-67725660 ACCGCCACAGACATAAGGGGTGG + Intergenic
1056249781 9:84735677-84735699 ACGTACACACACACAGGGTGGGG + Intronic
1056926363 9:90838092-90838114 ACCTCCACATACTCCAGATGAGG - Intronic
1059867747 9:118535587-118535609 AGCTCCACAAACAAAAGGCAAGG - Intergenic
1060921140 9:127421356-127421378 ACTTCCACAAGCACATGCTGCGG - Intergenic
1060980306 9:127788097-127788119 ACATCCACAGAAACAAGGTGGGG + Exonic
1061355455 9:130101323-130101345 ACCTCCACTAGCAGAAGCTGGGG - Intronic
1061794474 9:133077540-133077562 CCCTCCACAAACATAACATGAGG + Intronic
1203363654 Un_KI270442v1:238855-238877 ACCACCACAATCACCAGTTGGGG + Intergenic
1203715184 Un_KI270742v1:137519-137541 ACTTCCAATAACACAAGTTGGGG - Intergenic
1186129920 X:6455559-6455581 ACTCACACAATCACAAGGTGAGG + Intergenic
1186151280 X:6677101-6677123 ACCTACATGATCACAAGGTGAGG - Intergenic
1186303558 X:8228003-8228025 ACCTCCACAAAAAAGAGATGGGG - Intergenic
1188114229 X:26223761-26223783 ACCTCCACAAAGAAGAGGTGAGG - Intergenic
1188458195 X:30391350-30391372 ATCTCCATAAACTCAACGTGAGG - Intergenic
1188703571 X:33297578-33297600 ACATCCACAAACACAGGTTGTGG - Intronic
1190993138 X:55573589-55573611 TCCTACACAAACAAAAGCTGAGG + Intergenic
1191682897 X:63859419-63859441 ACCCCCACCAAGCCAAGGTGGGG + Intergenic
1194219462 X:91173564-91173586 TCCTAGACAAACACAAGCTGAGG - Intergenic
1200345911 X:155448555-155448577 ACTCACACAATCACAAGGTGAGG + Intergenic
1200555974 Y:4637320-4637342 TCCTAGACAAACACAAGCTGAGG - Intergenic
1201539436 Y:15090276-15090298 ACCTCCACATACATAACATGAGG + Intergenic