ID: 949925885

View in Genome Browser
Species Human (GRCh38)
Location 3:9041276-9041298
Sequence CCTCCACAAACACAAGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 257}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949925874_949925885 26 Left 949925874 3:9041227-9041249 CCAGGTTGCCTAACTTCAAGTCT 0: 1
1: 0
2: 1
3: 23
4: 187
Right 949925885 3:9041276-9041298 CCTCCACAAACACAAGGTGAGGG 0: 1
1: 0
2: 0
3: 31
4: 257
949925879_949925885 -4 Left 949925879 3:9041257-9041279 CCCAGGGAAGCTGGTTCCACCTC 0: 1
1: 1
2: 2
3: 17
4: 199
Right 949925885 3:9041276-9041298 CCTCCACAAACACAAGGTGAGGG 0: 1
1: 0
2: 0
3: 31
4: 257
949925875_949925885 18 Left 949925875 3:9041235-9041257 CCTAACTTCAAGTCTAAGTTTAC 0: 1
1: 0
2: 0
3: 9
4: 188
Right 949925885 3:9041276-9041298 CCTCCACAAACACAAGGTGAGGG 0: 1
1: 0
2: 0
3: 31
4: 257
949925880_949925885 -5 Left 949925880 3:9041258-9041280 CCAGGGAAGCTGGTTCCACCTCC 0: 1
1: 1
2: 2
3: 29
4: 232
Right 949925885 3:9041276-9041298 CCTCCACAAACACAAGGTGAGGG 0: 1
1: 0
2: 0
3: 31
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949925885 Original CRISPR CCTCCACAAACACAAGGTGA GGG Intronic
900829967 1:4958986-4959008 AGGCCAGAAACACAAGGTGAAGG + Intergenic
900994641 1:6113891-6113913 CCTCCAGAAACAAAAGGGGAGGG + Intronic
901831808 1:11897314-11897336 CACACACACACACAAGGTGATGG + Intergenic
901936926 1:12633254-12633276 CCCCCACCCCCACAAGGTGATGG + Intergenic
903623933 1:24717881-24717903 CCTCCACACACATTATGTGAAGG - Intergenic
907029302 1:51154997-51155019 CCTAGACAAACAAAAGCTGAGGG + Intergenic
907261810 1:53224244-53224266 CCTAGACAAACAAAAGCTGAGGG + Intergenic
908313295 1:62907241-62907263 ACTCCATAAGCACAAGGAGAGGG + Intergenic
909047029 1:70722781-70722803 AGTCCAGAAACACAAGGTGCTGG - Intergenic
909062033 1:70890123-70890145 CCTGCAGAAACACAGAGTGAAGG + Intronic
910295341 1:85638735-85638757 CCCACACAAACAAAAGCTGAGGG + Intergenic
910819076 1:91326553-91326575 CCTAGACAAACAAAAGCTGAGGG + Intronic
913558759 1:119997047-119997069 CCTCCATTGACACAAGGTGAGGG + Exonic
914279363 1:146156530-146156552 CCTCCATTGACACAAGGCGAGGG + Exonic
914540407 1:148607460-148607482 CCTCCATTGACACAAGGCGAGGG + Intronic
914626238 1:149463754-149463776 CCTCCATTGACACAAGGCGAGGG - Intergenic
915995255 1:160555814-160555836 CCTTCACAAACGCAAGATAATGG - Intronic
920950943 1:210571153-210571175 CATGCCCAAAGACAAGGTGAAGG - Intronic
923023314 1:230184136-230184158 CTTCCTCAAACACAAGTTGAGGG - Intronic
1063027608 10:2196840-2196862 TCTGCACAAACACGAAGTGAGGG + Intergenic
1067530649 10:47069188-47069210 CCTCCAAAGACTGAAGGTGAGGG - Intergenic
1069243788 10:66175515-66175537 CCTCCAAAAAGTCAGGGTGAAGG + Intronic
1069867062 10:71510629-71510651 CTTCCTCAAACTCAAGGAGAGGG - Intronic
1069980875 10:72251656-72251678 ACTCCACACACACAAGGCAAAGG - Intergenic
1072862898 10:99024855-99024877 CCCACACAAACAAAAGCTGAGGG + Intronic
1073123844 10:101137502-101137524 CCAGCACAAACACAAGGTCATGG + Exonic
1074288793 10:112122691-112122713 CCACTACAAACAGAAGGTGTTGG - Intergenic
1075535824 10:123271345-123271367 CCTGAATAAACAAAAGGTGAAGG + Intergenic
1075691376 10:124397106-124397128 CCTCTACTGACACAAGGTGAAGG - Intergenic
1079539046 11:21550052-21550074 CCTCCACAGAGACTAGGAGAGGG + Intronic
1079674771 11:23212915-23212937 TCTACACAGACACAAGCTGAAGG - Intergenic
1079961206 11:26926479-26926501 CCCCAACAAACAAAAGCTGAGGG - Intergenic
1080213490 11:29815343-29815365 CCTAGACAAACAAAAGCTGAGGG - Intergenic
1080309019 11:30868147-30868169 CTTACACCAAGACAAGGTGAAGG + Intronic
1086060878 11:82698741-82698763 GCTCCACAGTCAGAAGGTGAGGG + Intergenic
1086261235 11:84943943-84943965 CCCAGACAAACAAAAGGTGAGGG - Intronic
1088368512 11:109063746-109063768 CATGCACAAACACATGGTGGGGG - Intergenic
1088931103 11:114351537-114351559 CCTCTCCATACATAAGGTGATGG - Intergenic
1089923033 11:122228873-122228895 CCTACACAAACCCCAGGGGACGG + Intergenic
1090066378 11:123507269-123507291 CCACCACAAACCAAAGGTGTGGG - Intergenic
1090231131 11:125104703-125104725 AGTCCACAAACATCAGGTGAGGG + Intronic
1090629739 11:128635729-128635751 CCTCCCCAAACACATCATGAAGG + Intergenic
1091234692 11:134013267-134013289 GCTCTACAAAGACAAGGTGGTGG + Intergenic
1092046501 12:5434720-5434742 CCTGCACAAACACATGGAGTGGG + Intronic
1092624864 12:10316241-10316263 CCTACTCAAACAAAAGGGGAAGG + Intergenic
1092788704 12:12053330-12053352 CCTCGAAAAACACAAGGGCAGGG + Intronic
1095049312 12:37542628-37542650 CCTCCACGAGCATAAGGGGAGGG - Intergenic
1095049693 12:37544837-37544859 CCTCCACAGGCACAAGGGGAGGG - Intergenic
1095227791 12:39697302-39697324 CCTAGACAAACAAAAGCTGAGGG + Intronic
1095312698 12:40718976-40718998 CCTCCAAACATCCAAGGTGAGGG - Intronic
1095690315 12:45081124-45081146 CCAGCCCACACACAAGGTGAGGG + Intergenic
1096096086 12:48936646-48936668 CCCCCAAAAAAACAAGGTGAGGG + Exonic
1097532461 12:60821598-60821620 CCTCCACAAACCAAAGGACAAGG + Intergenic
1097899000 12:64855002-64855024 CCTAGACAAACAAAAGCTGAGGG - Intronic
1098060533 12:66556366-66556388 CCTAGACAAACAAAAGCTGAGGG + Intronic
1098363680 12:69680158-69680180 CCTCCCCAAACACCAAGGGAAGG + Intronic
1102254229 12:111406595-111406617 CCTCCCCAGGCACAAGTTGAGGG - Intronic
1104772894 12:131375366-131375388 CCTCCAGGAACACAAGCTGCTGG + Intergenic
1105242240 13:18619206-18619228 CCACCACAAACAGAAAGTGCAGG + Intergenic
1105293473 13:19069508-19069530 CCACCAAAAGCACAACGTGAGGG + Intergenic
1108099454 13:46938288-46938310 CCCAGACAAACAAAAGGTGAGGG + Intergenic
1110417043 13:75264497-75264519 CCTCCAGAAGCCCAAGGTGAAGG - Intergenic
1114204174 14:20552597-20552619 CTTCCACTAACACAAAGGGACGG + Intergenic
1114433628 14:22684864-22684886 CCCCGACAAACAAAAGCTGAGGG + Intergenic
1116194383 14:41704060-41704082 TCTCCACAAAAAGAAGCTGAAGG + Intronic
1116646314 14:47533555-47533577 CCTCCACACACATATGGAGAAGG + Intronic
1117268745 14:54118686-54118708 CCACCACCACCACAAGCTGATGG - Intergenic
1119471130 14:74900035-74900057 CCTTCACACAGATAAGGTGAGGG - Intronic
1122304597 14:100754249-100754271 CCTGCACAAACAGCAAGTGAAGG + Intergenic
1125678021 15:41512803-41512825 CCCACACAGACACAATGTGACGG - Exonic
1126053021 15:44704810-44704832 CCTAGACAAACAAAAGTTGAGGG - Intronic
1127140645 15:55972063-55972085 CCTGGACAAACAAAAGCTGAGGG + Intronic
1129037411 15:72658994-72659016 CCTCCAGAAACACAAGCCCAAGG - Intronic
1129212476 15:74078231-74078253 CCTCCAGAAACACAAGCCCAAGG + Intronic
1129397923 15:75262848-75262870 CCTCCAGAAACACAAGCCCAAGG - Intronic
1129401534 15:75287129-75287151 CCTCCAGAAACACAAGCCCAAGG - Intronic
1129855437 15:78821348-78821370 CCAACACAAACATAAGGTGATGG + Intronic
1130327365 15:82891546-82891568 ACTCCACAAACAGAAGGTGTGGG - Intronic
1131513814 15:93064504-93064526 CCCCCACACGCAGAAGGTGAAGG - Intronic
1131531430 15:93196205-93196227 TCTGCACAAACAGAAGGTGAGGG - Intergenic
1131693536 15:94852385-94852407 CACCCACAAACACAAAGTAAAGG - Intergenic
1132118651 15:99157986-99158008 GCTCCACAAACAGAAGGACAAGG + Intronic
1132981214 16:2739512-2739534 GCTCCCCAGACACAAGGAGAAGG - Intergenic
1134362702 16:13546417-13546439 CCCAGACAAACACAAGCTGAGGG - Intergenic
1135860773 16:26053986-26054008 CCACCACAAAGACAAGGAAAAGG + Intronic
1140764574 16:78145271-78145293 CTCCCACAATCACAAGCTGAGGG + Intronic
1140799402 16:78471498-78471520 CCACCACAATCAAAAGGTGCTGG - Intronic
1143247694 17:5500251-5500273 GCTCCCCAAACACAAAATGATGG + Intronic
1143715770 17:8767740-8767762 CCTCCACCATCACCAGGAGATGG - Intergenic
1144375934 17:14641580-14641602 CCTCCTCCATCACAAGGTAACGG - Intergenic
1145880440 17:28349026-28349048 GCTCCACAAACAGAAGCTGTAGG - Intronic
1146242314 17:31241939-31241961 CCTAGACAAACAAAAGCTGAGGG - Intronic
1146904279 17:36608221-36608243 CCTGCACAGACACAAGGACAAGG - Exonic
1146952961 17:36919363-36919385 ACCCCACAAAGACAAGGGGAAGG - Intergenic
1148377330 17:47160056-47160078 CCTCCACAAACAGATCTTGAGGG - Intronic
1149443429 17:56694560-56694582 GCTCCACAAACAAAAGGTATGGG - Intergenic
1152596948 17:81242428-81242450 CCACCTCACACACAGGGTGAAGG - Intergenic
1153457622 18:5296616-5296638 CCCCCACAAACTCAATGTGCCGG - Intronic
1154329914 18:13421328-13421350 CCTCCACAGACCCAGGGAGAGGG - Intronic
1154446709 18:14440672-14440694 CCACCACAAACAGAAAGTGCAGG - Intergenic
1157937188 18:51885818-51885840 CCTAGACAAACAAAAGCTGAGGG + Intergenic
1159080797 18:63733333-63733355 CCTAGACAAACAAAAGCTGAGGG + Intergenic
1159896280 18:73999836-73999858 CCTAGACAAACAAAAGCTGAGGG - Intergenic
1160337642 18:78056976-78056998 CCTCCCCAGACACCAGGTGAGGG + Intergenic
1160549004 18:79681134-79681156 CCTCAACAAACACAGGGTCAGGG - Intronic
1161777851 19:6273472-6273494 CCACCAAACACACGAGGTGAGGG + Intronic
1164899744 19:31908594-31908616 CCTCCACATCCCCAAGGTCAGGG + Intergenic
1164937306 19:32224406-32224428 CCTTCTCAAACTCAAGGGGAAGG + Intergenic
1165724003 19:38100099-38100121 CCTCAACACCCCCAAGGTGACGG + Exonic
1167037654 19:47003601-47003623 CCTCCCCAAACGCTAGGCGATGG - Exonic
925046501 2:777016-777038 CCTTCACAAACTCAAGGAGAAGG - Intergenic
927416469 2:22885867-22885889 CCTCCACAAATACATGGAAAGGG - Intergenic
927481503 2:23457515-23457537 CCTCGGGGAACACAAGGTGACGG - Intronic
928243294 2:29605356-29605378 CCTCCACAACCCCAAGGCCATGG - Intronic
929926356 2:46215279-46215301 CTTCCCCAAACAAAAGCTGAGGG - Intergenic
931407131 2:61989804-61989826 GCTCTACAAACACATGTTGAAGG - Intronic
932302622 2:70677877-70677899 ACTGCACAAACACAAGGTCATGG + Exonic
932336203 2:70932751-70932773 CCTCCCCCACCCCAAGGTGAAGG + Exonic
932478313 2:72022954-72022976 CCTCCACACAATCAGGGTGAGGG + Intergenic
932689004 2:73896656-73896678 CCACCTCAAACCCAATGTGAGGG - Intronic
935255599 2:101307701-101307723 CCTTCACCAACATAAAGTGATGG - Intronic
935682790 2:105652385-105652407 CCACCACAAACCCCAGGAGAGGG + Intergenic
937457866 2:122058509-122058531 CCCTCACAGACACAAGGTGATGG + Intergenic
937467162 2:122143691-122143713 ACACCACTAACAGAAGGTGATGG - Intergenic
937521318 2:122716010-122716032 CTTACACTATCACAAGGTGAAGG + Intergenic
938692206 2:133802000-133802022 CCTGCAAAGACACAAGGAGAGGG - Intergenic
939335938 2:140828055-140828077 CCCACACAAACAAAAGCTGAGGG + Intronic
940346739 2:152636679-152636701 CCTCCACAAACAGAGGGAAATGG - Intronic
940922513 2:159324507-159324529 GCACCACAAACCCAAGCTGAAGG - Intronic
941630348 2:167877431-167877453 CCTCACCAAGCATAAGGTGAGGG + Intergenic
941742435 2:169048971-169048993 CCTAGACAAACAAAAGATGAGGG + Intergenic
946908901 2:224441997-224442019 CCTACACAAACAAAAAGTCATGG - Intergenic
949034108 2:241808611-241808633 CCTCCACAAACAAGTGGAGAAGG - Intergenic
1169296363 20:4403343-4403365 CCACCACAAACCCATGGGGATGG - Intergenic
1169339191 20:4783144-4783166 CATCTCCACACACAAGGTGAGGG + Exonic
1171994826 20:31723305-31723327 CCTGCACAAAGACTGGGTGAGGG + Intronic
1172153650 20:32808585-32808607 CCCCCACAAACCCAAGGGCAGGG + Exonic
1172653566 20:36522847-36522869 CCACCACACACAAAAGGTGCTGG - Intronic
1173575294 20:44109489-44109511 CCACCACATACAGGAGGTGAAGG + Intergenic
1174871765 20:54189484-54189506 CCTCCACCTACACAAGGCCAAGG + Intergenic
1175299631 20:57933767-57933789 CCTCTAAAAACCCAAGGTGGAGG + Intergenic
1175838231 20:62010173-62010195 AATCCAAAAACACAAGGTAAGGG + Intronic
1175949882 20:62577736-62577758 CCTCCACACACAGCAGGTGGGGG - Intergenic
1178438354 21:32578994-32579016 CCTTCACAAACGCTTGGTGAGGG - Intronic
1178787168 21:35664373-35664395 CCTCCACCCACAGAAGGAGAGGG + Intronic
1179677474 21:42993452-42993474 CTTCCACAAACTGAAGGTGCTGG - Intronic
1179713418 21:43275725-43275747 CCACCACAGACACCAGGTGAGGG + Intergenic
1179713428 21:43275755-43275777 CCACCACAGACACCAGGTGAGGG + Intergenic
1179713444 21:43275817-43275839 CCACCACAGACATCAGGTGAGGG + Intergenic
1179713453 21:43275847-43275869 CCACCACAGACACCAGGTGAGGG + Intergenic
1179713463 21:43275877-43275899 CCACCACAGACATCAGGTGAGGG + Intergenic
1179713472 21:43275907-43275929 CCACCACAGACACCAGGTGAGGG + Intergenic
1179713482 21:43275937-43275959 CCACCACAGACACCAGGTGAGGG + Intergenic
1179713599 21:43276411-43276433 CCACTACAGACACCAGGTGAGGG + Intergenic
1182080487 22:27525297-27525319 CCTACACAATCACAAACTGAAGG + Intergenic
1182850955 22:33473755-33473777 CTTCTACATACACAAGGTGCTGG + Intronic
1183322666 22:37174638-37174660 CCTCCCCAAAGACAAGGTTTAGG - Intronic
1183340324 22:37276881-37276903 CCACCAGAGCCACAAGGTGAGGG - Intergenic
949090914 3:27872-27894 CCTGCAAAAAGAGAAGGTGATGG - Intergenic
949571792 3:5300733-5300755 CCTACACAGACACTAGGTAAGGG + Intergenic
949925885 3:9041276-9041298 CCTCCACAAACACAAGGTGAGGG + Intronic
950865202 3:16183173-16183195 CCTGCACAAAGAGAAGGGGATGG + Intronic
955943562 3:64169633-64169655 CAAACACAAACACAAGGTAAAGG + Intronic
956008303 3:64804043-64804065 CCTCCCCAAAGAGCAGGTGATGG - Intergenic
956237160 3:67084974-67084996 CCTAGACAAACAAAAGCTGAGGG + Intergenic
957031234 3:75244085-75244107 CCTGCAAAAAGAGAAGGTGATGG - Intergenic
957118453 3:76057961-76057983 CCTTCACAAACACACGGTAAAGG - Intronic
957966324 3:87325393-87325415 CCCACACAAACAAAAGCTGAAGG + Intergenic
958606265 3:96362296-96362318 CCACCACAAAAAAAAAGTGAGGG - Intergenic
958668949 3:97178551-97178573 CCTTGACAAACAAAAGCTGACGG - Intronic
958839692 3:99188526-99188548 CCTAGACAAACAGAAGCTGAGGG + Intergenic
959328547 3:104971856-104971878 CCTGGACAAACAAAAGCTGAGGG - Intergenic
959874936 3:111371963-111371985 CCTGGACAAACAAAAGCTGAGGG + Intronic
960565146 3:119125098-119125120 CCCCGACAAACAAAAGCTGAAGG + Intronic
960784801 3:121360992-121361014 CCTAGACAAACAAAAGCTGAGGG - Intronic
961617891 3:128198015-128198037 ACTGCACAAACAAAAGGTTAAGG - Intronic
962038568 3:131681330-131681352 CCTAGACAAACAAAAGCTGAGGG - Intronic
962668018 3:137675485-137675507 CCTGGACAAACAAAAGCTGAGGG + Intergenic
963330733 3:143911891-143911913 CCTAGACAAACAAAAGCTGAGGG + Intergenic
963443897 3:145376517-145376539 CCTAGACAAACAAAAGCTGAGGG + Intergenic
964350020 3:155793292-155793314 CCTAGACAAACAAAAGCTGAGGG + Intronic
964759180 3:160117247-160117269 CCTAGACAAACAAAAGCTGAAGG + Intergenic
964864073 3:161234744-161234766 CCACCACAAACACTTGTTGAAGG - Exonic
965527075 3:169732239-169732261 CCTAGACAAACAAAAGCTGAGGG + Intergenic
969562764 4:7960034-7960056 CCTCCACAGGCACAAAATGAAGG + Intergenic
970451958 4:16177646-16177668 CTTCCTCAACCACAAGGTTAAGG + Intronic
971838386 4:31799579-31799601 CCTAGACAAACAAAAGCTGAGGG - Intergenic
973815020 4:54611526-54611548 CCTCCTCAAATAGAAGGGGATGG - Intergenic
975046440 4:69809745-69809767 TATGCAGAAACACAAGGTGAGGG - Intergenic
975375820 4:73644698-73644720 CCCAGACAAACACAAGCTGAGGG - Intergenic
975519815 4:75288527-75288549 CATCCCCAAAATCAAGGTGATGG + Intergenic
975917183 4:79339611-79339633 ACTCCTCACACTCAAGGTGAGGG + Intergenic
976701628 4:87975646-87975668 CCTCCACCAACACAGGGAGGCGG - Intronic
979352234 4:119657565-119657587 TCACCAGACACACAAGGTGAAGG - Intergenic
980448341 4:132940607-132940629 CCCACACAAACAAAAGTTGATGG + Intergenic
981067834 4:140504316-140504338 CCTTGTTAAACACAAGGTGATGG + Intergenic
981227465 4:142313573-142313595 CCTCCACAGACACAGGCAGATGG - Intronic
981557719 4:146013550-146013572 CATACACAAACACAATGTTATGG + Intergenic
983932271 4:173465502-173465524 CCTGCCCACACTCAAGGTGAGGG - Intergenic
984386215 4:179061235-179061257 CCTCAACAAACAACAGCTGAGGG + Intergenic
984994381 4:185414522-185414544 CCTCCACATACAGAGGGTCAGGG + Intronic
985312120 4:188613787-188613809 TTTCCACAAACACATGGTGCTGG - Intergenic
986796069 5:11213234-11213256 CCTCCACAATCAGAGGGTGGAGG + Intronic
986899168 5:12411095-12411117 CCCAGACAAACAAAAGGTGAGGG - Intergenic
987126097 5:14814223-14814245 CCTCCACATAAACAACGTGAGGG + Intronic
987576944 5:19741826-19741848 CTCCCACAACCACAAAGTGATGG - Intronic
987721641 5:21641930-21641952 CCTGCCCAAACTCAAGGAGAAGG + Intergenic
989754300 5:44934412-44934434 CCTAGACAAACACAAAGTGAGGG - Intergenic
990578435 5:57146143-57146165 CCTGGACAAACAAAAGCTGAGGG - Intergenic
991205446 5:64044214-64044236 ACTCAACAAACAAAAGCTGAGGG + Intergenic
991985893 5:72286813-72286835 CCTCAACAAGCACTGGGTGATGG + Intronic
992003528 5:72457159-72457181 CCTCCACAATGACATGGTTATGG + Intronic
997232745 5:132256303-132256325 CCTCCTCCACCACAAAGTGATGG + Intronic
997586610 5:135047346-135047368 CGTAGACAAACACAAAGTGAGGG + Intronic
997631642 5:135373251-135373273 CCTGCACAAAAAAAAAGTGAAGG - Intronic
998643804 5:144041009-144041031 TCTCCAAAGGCACAAGGTGATGG - Intergenic
1000931104 5:167252489-167252511 CCTCCAAAGACACATGATGAAGG - Intergenic
1003351402 6:5320881-5320903 CCCCCACAACCACCACGTGAGGG - Intronic
1004384391 6:15159834-15159856 CCTCAGCAAATACAATGTGATGG - Intergenic
1004782579 6:18927661-18927683 CCTAGACAAACAAAAGCTGAGGG - Intergenic
1004808867 6:19237931-19237953 CCACCACCAACTCAATGTGATGG + Intergenic
1008494350 6:52117537-52117559 CCTGCACATACTCAAGGGGAGGG - Intergenic
1014692636 6:124580024-124580046 CCTAGACAAACAAAAGCTGAGGG + Intronic
1019170947 6:170132890-170132912 CCCCGACACACACAAGGTCAAGG + Intergenic
1019380231 7:717858-717880 CCTACACACACTCAAGGGGAGGG - Intronic
1020150568 7:5678768-5678790 GCTCCTCACACAGAAGGTGACGG + Intronic
1021070254 7:16229836-16229858 CCTGGACAAACAAAAGCTGAGGG - Intronic
1021536510 7:21711150-21711172 CCAGCAAAAACAAAAGGTGACGG + Intronic
1022506170 7:30909812-30909834 CCTCCAAAACTTCAAGGTGAGGG + Intergenic
1023704584 7:42928157-42928179 CCCCCACAAATACCAAGTGAGGG - Intronic
1024519267 7:50289485-50289507 TCTCCAAGAACACAGGGTGAAGG - Intergenic
1024685199 7:51737118-51737140 TCTTCACAAACAGAAAGTGATGG + Intergenic
1025295214 7:57771207-57771229 CCTCCACGAGCACAAGGGGAGGG - Intergenic
1025295604 7:57773426-57773448 CCTCCACGGGCACAAGGGGAGGG - Intergenic
1025711029 7:63910068-63910090 CCACCACAAACACTTGTTGAAGG + Intergenic
1026615334 7:71897522-71897544 CCTCTGGAAACACAAGGTAAAGG + Intronic
1026661630 7:72307978-72308000 CCTTCACAAAGACACGGTGATGG + Intronic
1027224945 7:76237875-76237897 CCTCCCCAAGCAAAAGGTGATGG + Intronic
1028521782 7:91740342-91740364 CCTAGACAAACAAAAGCTGAGGG - Intronic
1030217435 7:107059514-107059536 CCTTCTCAAAAACAAGTTGATGG - Intronic
1030501216 7:110362449-110362471 CCTAGACAAACAAAAGTTGAGGG - Intergenic
1031862477 7:126996142-126996164 CCTAGACAAACAAAAGCTGAAGG + Intronic
1032697089 7:134346514-134346536 CCACAGCAAACACAAGCTGATGG + Intergenic
1033483670 7:141766645-141766667 CCTCCACAACCAGCAAGTGAGGG + Intronic
1035026199 7:155827985-155828007 CCTGCACAAACAAGAGATGATGG - Intergenic
1035241895 7:157537712-157537734 CCTCCACCATCCCCAGGTGATGG + Intergenic
1037386899 8:18352519-18352541 CCTTCACAAACAGGAGGTGGAGG - Intergenic
1037757318 8:21719352-21719374 CCTCCAAAAACACAAGCAGATGG + Intronic
1039400536 8:37265449-37265471 CCTGCCCAAACCCAAGGGGAGGG - Intergenic
1042069508 8:64915362-64915384 CCTCCCAAAACACAAAGGGACGG - Intergenic
1042864298 8:73344054-73344076 CCTCTACAAAGAGAAGATGAGGG + Intergenic
1045171474 8:99675136-99675158 CCTGGACAAACAAAAGCTGAGGG - Intronic
1045688428 8:104735660-104735682 CCTCCACAAACCCAATGTCTTGG - Intronic
1046215382 8:111139432-111139454 CCCAGACAAACACAAGCTGAGGG - Intergenic
1046861761 8:119100852-119100874 GCTCCCCAAACAGAAGGTGGGGG - Intronic
1047178630 8:122566383-122566405 CCAGCACAAACCCAAGGGGAGGG + Intergenic
1047460230 8:125056706-125056728 CCTGGACAAAGACAAGCTGAGGG - Exonic
1047719691 8:127628124-127628146 CCTCCAGAAACACAAGGCTTCGG + Intergenic
1048573469 8:135673166-135673188 TCTCAACAAACACAAAGTGCTGG - Intergenic
1049168979 8:141146361-141146383 TCTCAACAAACAAAAGGGGAAGG - Intronic
1049424104 8:142530435-142530457 CCTCCCTCAACCCAAGGTGAGGG + Intronic
1050184224 9:2955616-2955638 ACTCCAAAGACCCAAGGTGAGGG - Intergenic
1050489658 9:6174653-6174675 CCTAGACAAACAAAAGCTGAGGG + Intergenic
1055579764 9:77696422-77696444 CCTAGACAAACAGAAGCTGAGGG - Intergenic
1056443774 9:86645280-86645302 CCTGCACAAACATAAGGCCAGGG - Intergenic
1058128659 9:101225186-101225208 CCTGCACAAACACAAATTCATGG - Intronic
1060980307 9:127788098-127788120 CATCCACAGAAACAAGGTGGGGG + Exonic
1061526059 9:131163660-131163682 CCACCTCAAACACAACATGATGG - Intronic
1186843510 X:13508643-13508665 CTTCCATAAACACAAAGAGAAGG - Intergenic
1187405367 X:18999273-18999295 CCTCCACAAACTCCAGCTGCTGG - Exonic
1189019543 X:37320084-37320106 TCTCCTCAAACACAAGGAAAAGG - Intergenic
1189961265 X:46327068-46327090 CCGCCACACACACAGGGGGAAGG - Intergenic
1190380009 X:49829921-49829943 CTGCCACAACCACAAGGTCATGG - Intronic
1190530590 X:51370591-51370613 CCTGGACAAACAAAAGCTGAGGG + Intergenic
1190993140 X:55573590-55573612 CCTACACAAACAAAAGCTGAGGG + Intergenic
1191083692 X:56540668-56540690 CCCAGACAAACACAAGCTGAGGG + Intergenic
1191118985 X:56883240-56883262 CCTAGACAAACAAAAGCTGATGG - Intergenic
1191130979 X:57010482-57010504 CCCTCACAAACAAAAGATGAGGG - Intergenic
1191603645 X:63038789-63038811 ATTCCAAAAACACAAGGAGAGGG - Intergenic
1193417274 X:81239955-81239977 CCCCGACAAACAAAAGCTGAGGG + Intronic
1193488141 X:82113611-82113633 CCTACACACACAAAAGATGAGGG - Intergenic
1193663956 X:84293051-84293073 CCTAGACAAACAAAAGCTGAGGG - Intergenic
1193846447 X:86478304-86478326 CCTAAACAAACAAAAGCTGAGGG - Intronic
1194219460 X:91173563-91173585 CCTAGACAAACACAAGCTGAGGG - Intergenic
1194839454 X:98722328-98722350 CCTAGACAAACAAAAGCTGAGGG + Intergenic
1197816865 X:130506664-130506686 CCCCCACAAAAAAAAGGAGAGGG - Intergenic
1198537857 X:137603730-137603752 CCTAGACAAACAAAAGCTGAGGG + Intergenic
1199876460 X:151932734-151932756 CCTTCAAGAACACAAGATGAAGG + Intergenic
1200555972 Y:4637319-4637341 CCTAGACAAACACAAGCTGAGGG - Intergenic