ID: 949926059

View in Genome Browser
Species Human (GRCh38)
Location 3:9042787-9042809
Sequence GCCTGGGATTGTAGTGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949926054_949926059 0 Left 949926054 3:9042764-9042786 CCCATGAAAGTGGTCAGGCGATG 0: 1
1: 0
2: 0
3: 4
4: 49
Right 949926059 3:9042787-9042809 GCCTGGGATTGTAGTGAACAAGG 0: 1
1: 0
2: 1
3: 14
4: 177
949926049_949926059 24 Left 949926049 3:9042740-9042762 CCCTCCTGTTAGAGCTGATGGCA 0: 1
1: 0
2: 1
3: 8
4: 157
Right 949926059 3:9042787-9042809 GCCTGGGATTGTAGTGAACAAGG 0: 1
1: 0
2: 1
3: 14
4: 177
949926050_949926059 23 Left 949926050 3:9042741-9042763 CCTCCTGTTAGAGCTGATGGCAG 0: 1
1: 0
2: 1
3: 11
4: 110
Right 949926059 3:9042787-9042809 GCCTGGGATTGTAGTGAACAAGG 0: 1
1: 0
2: 1
3: 14
4: 177
949926051_949926059 20 Left 949926051 3:9042744-9042766 CCTGTTAGAGCTGATGGCAGCCC 0: 1
1: 0
2: 1
3: 8
4: 103
Right 949926059 3:9042787-9042809 GCCTGGGATTGTAGTGAACAAGG 0: 1
1: 0
2: 1
3: 14
4: 177
949926055_949926059 -1 Left 949926055 3:9042765-9042787 CCATGAAAGTGGTCAGGCGATGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 949926059 3:9042787-9042809 GCCTGGGATTGTAGTGAACAAGG 0: 1
1: 0
2: 1
3: 14
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949926059 Original CRISPR GCCTGGGATTGTAGTGAACA AGG Intronic
903584927 1:24407071-24407093 GCCAGGGATTGCAGGGAAAAAGG - Intronic
903975964 1:27150475-27150497 GCCTGGGAGTCAGGTGAACATGG + Intronic
904804606 1:33121892-33121914 GCATGGGTTTGGAGTGAACGAGG + Intergenic
906437000 1:45804247-45804269 GCCTGGGGTTGTATTGGAAATGG + Intronic
906501141 1:46342486-46342508 GCCTGGGACTGGGGTGAGCAAGG - Intronic
907331251 1:53673046-53673068 GCATGAGATTGTGGGGAACACGG - Intronic
908042723 1:60132332-60132354 CCCTGGTATTGTAATGAGCATGG - Intergenic
909920978 1:81379714-81379736 GGCTGGACTTGTAGAGAACATGG - Intronic
910776680 1:90883654-90883676 GCCTGGGATTCTTCTCAACATGG - Intergenic
911096861 1:94062046-94062068 GCCTGGGATGGGAGTGTCCAGGG + Intronic
913687265 1:121244324-121244346 GAATGGGATTTCAGTGAACAGGG + Intronic
914039126 1:144031962-144031984 GAATGGGATTTCAGTGAACAGGG + Intergenic
914150330 1:145035968-145035990 GAATGGGATTTCAGTGAACAGGG - Intronic
920474594 1:206262842-206262864 GAATGGGATTTCAGTGAACAGGG + Intronic
921334212 1:214070062-214070084 GCTTGGGATTTTAGTTTACAGGG + Intergenic
921769798 1:219022503-219022525 GCCTGGGGTGGCAGTGCACATGG + Intergenic
924647366 1:245891065-245891087 GCCTGGGAAGGTAGTGGGCAAGG + Intronic
1065129510 10:22606453-22606475 GCCTGGGGTTGTGGTTTACATGG - Intronic
1066164552 10:32772442-32772464 GCCTAGCTTTGCAGTGAACAGGG - Intronic
1069124339 10:64610730-64610752 GCCTGAGATTTTCTTGAACAAGG + Intergenic
1074893187 10:117752212-117752234 GTCCGGGAATGTGGTGAACAAGG + Intergenic
1078154289 11:8785531-8785553 TCATGGGATTATAGTGACCAGGG - Intronic
1081297883 11:41414101-41414123 GCCTGAGGTTGTTGTGAAAACGG + Intronic
1081556409 11:44166369-44166391 GATTGAGATTGTAGTGAATAGGG + Intronic
1082118859 11:48356645-48356667 GCCTGGGGTTGTGGGGAACATGG + Intergenic
1082778761 11:57269795-57269817 GCCTGGGAATGGAGGGAGCAAGG + Intergenic
1083295328 11:61712307-61712329 CCCTGGGGTTGTAGTGAGGATGG + Intronic
1083942100 11:65901490-65901512 GCCTGGGCTTGGAGTGCCCACGG - Intergenic
1090317189 11:125803508-125803530 GCCTGGCATTGGAGTGGACCTGG + Intergenic
1091613750 12:2033404-2033426 GCCTGGGTTTGGAGAGAAAATGG - Intronic
1091833022 12:3563622-3563644 ACCTGGGATTCTTGTGGACATGG - Intronic
1092418253 12:8308596-8308618 ACCTGGGATGGTAGTGAAGTGGG + Intergenic
1092884632 12:12914348-12914370 GCCTGGCTTTGTACTGAAAAGGG + Exonic
1095400918 12:41814056-41814078 GCCTGGGAATGGAGTGTAGAGGG + Intergenic
1097529588 12:60781313-60781335 GCCTGGGAATGGGGTGAAGATGG - Intergenic
1098006540 12:66003553-66003575 GCCTGGACTTGGGGTGAACAGGG - Intergenic
1099801134 12:87457732-87457754 GCCAGGAAGTGTAGTGAAGAGGG + Intergenic
1102257677 12:111425532-111425554 GCCTGGGGTTCGAGGGAACAGGG + Intronic
1105560103 13:21482353-21482375 GCCTTGGATTGAGGAGAACAAGG + Intergenic
1109806475 13:67451063-67451085 GACTGGAATTGTAGTGAACATGG + Intergenic
1110150655 13:72249006-72249028 ACCTGGGATCTTAGTGAACAGGG + Intergenic
1110638280 13:77791334-77791356 GCCTGGGTTTGGAGTAAAGAGGG - Intergenic
1111233517 13:85376923-85376945 GTCTGGGAATGAAGTAAACAAGG - Intergenic
1114532587 14:23404990-23405012 GGCTGGGATTGCAGGGAGCATGG - Intronic
1117000479 14:51366210-51366232 GCCTGGGATTCTTGTGACCATGG + Intergenic
1118480460 14:66159686-66159708 CCCTGGGGTTGGAGAGAACATGG + Intergenic
1120059403 14:79964597-79964619 GCCTGGGTTTCTAATGATCATGG - Intergenic
1121492722 14:94371681-94371703 GCCTTATATTGAAGTGAACATGG - Intergenic
1121924117 14:97912564-97912586 CCCTGGGATGGTTGTGAACTTGG - Intergenic
1125360735 15:38861976-38861998 GCCTGGGAAGGTAATGAACTGGG + Intergenic
1128159497 15:65414208-65414230 GCCTGGGATTGCAGTGTGAAGGG + Intronic
1129457759 15:75684742-75684764 GCCTGTGTTTGTAGTGAGGATGG + Exonic
1130108001 15:80943363-80943385 TGCTGGGAGTGTAGTGAAGAGGG - Intronic
1130109009 15:80949725-80949747 ACCTGGCATTGCAGTGCACATGG - Exonic
1130431080 15:83847465-83847487 GCATGGTATTGTACAGAACAGGG - Intronic
1130715419 15:86329211-86329233 GCCTGGGAGTGAAGTGGAGAGGG - Intronic
1131041959 15:89276958-89276980 GCCTGGGAGTTTGGTGGACAAGG + Intronic
1133584824 16:7182887-7182909 GCATGTAATTGTTGTGAACAGGG - Intronic
1135791300 16:25398763-25398785 TCCTGGGATTCCAGTGATCATGG + Intergenic
1136497007 16:30650956-30650978 TCCCGGGATTGGAGTGAAGAGGG + Intronic
1137236521 16:46623052-46623074 GCCTGGACTTGGGGTGAACAGGG - Intergenic
1137562629 16:49512714-49512736 GCCTCGGGTTGTTGTGAAGATGG - Intronic
1138565352 16:57828780-57828802 GGCTGGGCTTGTAGTGGAGAGGG - Intronic
1139331167 16:66191718-66191740 TCCTGGGATTGTATTGGAAAGGG - Intergenic
1142016711 16:87752662-87752684 GCCTGGGATTGTAACTAAGATGG - Intronic
1143727236 17:8857510-8857532 GCCTGGGTTAATAATGAACACGG + Intronic
1144258581 17:13495420-13495442 GCCTGGGAATTTAGAAAACAAGG + Intergenic
1144287245 17:13788623-13788645 TCCTGGGAATGCAGTTAACAAGG - Intergenic
1144573049 17:16412333-16412355 GCCTTGGATTGTAGCCATCAGGG - Intergenic
1146917186 17:36685737-36685759 ACCTGGGATTGGAGTGGGCAGGG + Intergenic
1148561458 17:48609160-48609182 GCCTGGGATAGGATGGAACATGG + Intronic
1148584803 17:48769749-48769771 GCTTGGGGTTGTAGTGAGCTGGG + Exonic
1150509441 17:65734280-65734302 GCATGGGATCATAGAGAACATGG + Intronic
1150550407 17:66204484-66204506 GCCTGGGATTGTGGTGACTAGGG + Intergenic
1155533844 18:26795222-26795244 GCCTGTGATGGTAGTGGCCATGG + Intergenic
1155848171 18:30735368-30735390 GCCTAGGAATGCAGTTAACAAGG + Intergenic
1158126342 18:54103537-54103559 GCCTGTGACTGTCATGAACAAGG - Intergenic
1160110486 18:76024910-76024932 GCCTGGCACTGTGGTGAAGAGGG - Intergenic
1160576390 18:79856658-79856680 GCCTGGGACTGCAGAGGACAGGG + Intergenic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1165792440 19:38500271-38500293 GGCTGGGATTGCAGGGCACACGG + Intronic
925461189 2:4064067-4064089 GCCTGGGACCGTGGTGAAAATGG + Intergenic
925815097 2:7739698-7739720 GCCTGGGATTGTAGCAGGCATGG + Intergenic
926328605 2:11806342-11806364 GCCTGGGATTGCTATGAACTAGG + Intronic
927825644 2:26307891-26307913 GCAGGAGAATGTAGTGAACATGG + Intergenic
929536533 2:42787651-42787673 GCCAGGGACTGTGGTGAGCATGG - Intronic
932172679 2:69571894-69571916 ACCTGGGAATGTTGTGAAGATGG + Intronic
932229467 2:70070959-70070981 GCCAGGGACTGTGGTGTACAGGG - Intergenic
932971636 2:76550288-76550310 GCCTGGGATGGTAGTGGACTTGG + Intergenic
935490316 2:103711423-103711445 GCCTAGGAATGTAGCTAACAAGG - Intergenic
935812997 2:106817949-106817971 GCCTGGGCTAGTAGTGGCCATGG + Intronic
937360062 2:121223468-121223490 GCCTGGTATTGTGGTGGTCAAGG + Exonic
941560629 2:167040354-167040376 GCCTGGGATTGCTGAGCACAAGG + Intronic
942257358 2:174117069-174117091 GGATGGGGTTGTAGAGAACATGG + Intronic
942560517 2:177213346-177213368 GCCTGGGATTGGAGGGAAGAGGG + Intronic
943121417 2:183740679-183740701 GCCTAGGAATGTAGTGAGAATGG - Intergenic
944602751 2:201320357-201320379 GCCTGGCTTTGCAGTGGACAGGG + Intronic
945495012 2:210499238-210499260 GCCTGGGAGTGGAGTGGAGAGGG + Intronic
945814420 2:214586804-214586826 GAATGGGGTTGTAATGAACATGG + Intergenic
948461846 2:238133465-238133487 TCCTGGGATTGTGGTGAAGGAGG + Intergenic
1170905860 20:20514811-20514833 GCCTGGGCTTGGAGTGCAAAAGG - Intronic
1172657044 20:36543693-36543715 GCCTGGGATTGGTGTAAACTGGG + Intronic
1176688102 21:9872898-9872920 GCATGGGATTGTGGAGCACAAGG + Intergenic
1179436307 21:41364383-41364405 GCCTGAGAGTGTGGTGAAAAGGG - Intronic
1181271457 22:21661178-21661200 CCCTGGGATTGTTCTGAGCAGGG + Intronic
1182273062 22:29167864-29167886 GCCTGTGGTTGAAGTGATCATGG - Exonic
1183591579 22:38782182-38782204 GCCTGGGATGGGAATGAACTTGG - Intronic
1184280244 22:43433332-43433354 CCCTGGGCTTGTTGTGAGCAGGG + Intronic
1185015824 22:48342017-48342039 GCCTGGGATTGCAGGGTTCATGG - Intergenic
949926059 3:9042787-9042809 GCCTGGGATTGTAGTGAACAAGG + Intronic
950006930 3:9697393-9697415 GCCTGCGCTGGGAGTGAACACGG - Intronic
951837536 3:26999829-26999851 GCTTGGGATTCTAGTGGAGAGGG - Intergenic
952882835 3:37995927-37995949 GGCTGGGGTTGTGGGGAACAAGG + Intronic
953245825 3:41190798-41190820 GCCTTGCATTATAGTGCACATGG - Intergenic
953608910 3:44431104-44431126 GCCTATGATATTAGTGAACATGG + Intergenic
956935615 3:74097521-74097543 GCCTGGCATTGTGTTGAATATGG + Intergenic
958868770 3:99532502-99532524 GCCTGGGAATGCAGTTCACATGG + Intergenic
961023291 3:123529024-123529046 GCCAGGGCTTGTAATGAACAAGG - Intronic
961333240 3:126155198-126155220 ACCTGGGAGGGTAGCGAACAGGG - Intronic
961615408 3:128175443-128175465 GGGTGGCATTGGAGTGAACAAGG + Intronic
961685464 3:128626955-128626977 GCCTGGTTTTGTTGTAAACATGG - Intronic
961749641 3:129087750-129087772 GCCTGGACTTGGGGTGAACAGGG - Exonic
964545680 3:157830805-157830827 GCCTGGCATTGTGGTGTGCATGG - Intergenic
969717350 4:8874143-8874165 GCCTGGGATGGGAGCGAAGAGGG + Intergenic
971140002 4:23914448-23914470 GCCTGAGATTGTAGTGATTGTGG - Intergenic
971614066 4:28764638-28764660 GCCTGGGCATGGAGTGAAGAGGG - Intergenic
972984963 4:44752145-44752167 GCCTAGGAATGTAGCTAACAAGG - Intergenic
980446987 4:132922429-132922451 GCCAGGGATTTCAGGGAACATGG + Intergenic
982417746 4:155156961-155156983 GCCTGGCATTGTGGTAAAGAAGG + Intergenic
983952399 4:173657930-173657952 GCCTCTGATTCTAGTGGACACGG - Intergenic
985750014 5:1668241-1668263 GCCTGGGGTTGTGGTGAAAATGG + Intergenic
988622404 5:32836365-32836387 GCCTGGGAATGAAGCCAACATGG + Intergenic
991093412 5:62714756-62714778 GCCTTGGTTTGTTGTTAACATGG + Intergenic
994477579 5:100290482-100290504 GCTTGGGATGGCAGTGAATATGG - Intergenic
995697748 5:114899339-114899361 GCCTGGGATGGTGGTGGCCATGG - Intergenic
997611074 5:135216193-135216215 CCCTGGGATGGGAGAGAACATGG - Intronic
1000420475 5:161032935-161032957 GGCTGGGGTTGGAGTGAACAAGG - Intergenic
1001713612 5:173797170-173797192 ACCTGGGATTTTAATGTACAGGG - Intergenic
1004310769 6:14542998-14543020 GCCTGGGTATGTGGTGACCAGGG + Intergenic
1004943092 6:20581892-20581914 GCCAGGCATTGTTCTGAACAAGG + Intronic
1005465954 6:26113515-26113537 GCCTTGGATTGAGGAGAACAAGG + Intergenic
1007088311 6:39166343-39166365 GCCTGGGAGTATAGAGACCAGGG - Intergenic
1008641982 6:53473802-53473824 GCCTGGGGTGGTAGTGGCCATGG - Intergenic
1010514226 6:76753555-76753577 GCCTGGGGCTGTAGTGACCATGG + Intergenic
1010798144 6:80141643-80141665 GGCTTGGATTAAAGTGAACAAGG + Intronic
1012998143 6:105993716-105993738 GGCTAGGATTTTAGTGAAGAGGG + Intergenic
1014314106 6:119842363-119842385 GCCTGGGGTTGGGGTGAACCTGG + Intergenic
1015348619 6:132190209-132190231 GGCTGGAAGTGTGGTGAACATGG + Intergenic
1016229842 6:141789295-141789317 GCCTGTGGTGGTGGTGAACATGG + Intergenic
1017387417 6:153901863-153901885 GCTTGGGCTTTAAGTGAACATGG + Intergenic
1017445546 6:154504130-154504152 ACCTGGGCTTGCAGTGAGCATGG - Intronic
1018751246 6:166808109-166808131 GCTTGGCCTTGTTGTGAACATGG - Intronic
1027934848 7:84589275-84589297 GCCTGGGTGTGGAGTGAAGAGGG - Intergenic
1028299498 7:89180423-89180445 GCCTGGGGTGGGCGTGAACATGG - Intronic
1033716201 7:144005044-144005066 GCCTGAGATTGAAGTAGACATGG - Intergenic
1036192491 8:6683128-6683150 GCCAGGGGTTGTGGTGAAGATGG - Intergenic
1040757622 8:50798592-50798614 GCCTTGGATTGTTGTGATAAAGG + Intergenic
1041165238 8:55085577-55085599 GCCTGGGACTGTAGTCTCCAAGG - Intergenic
1041616084 8:59907871-59907893 GCCTGTGGTGGTAGTGGACATGG + Intergenic
1041887669 8:62830635-62830657 GCCTGGGCTTGGAGTGGAGAGGG - Intronic
1043130569 8:76455841-76455863 GGCTGGGGGTGTAGGGAACAGGG + Intergenic
1044534652 8:93344992-93345014 GGCTGGTATTTTAGTGAACCAGG - Intergenic
1044841778 8:96343246-96343268 GCCTGGGAGTGTGGTGCACTTGG - Intergenic
1045172483 8:99686624-99686646 GCCTGGGATGGTGGTGGCCATGG - Intronic
1046682149 8:117182432-117182454 GCCAGGCCTTGTGGTGAACATGG + Intergenic
1047733006 8:127741799-127741821 TCCTGGGTTTGGAGTGAGCAGGG - Intergenic
1048799314 8:138181534-138181556 GCCTGGGATTGGAGAGGACCAGG - Intronic
1049303829 8:141886846-141886868 GCCTGGGATAGTCCTGACCAGGG + Intergenic
1053040102 9:34863001-34863023 GCCTGGGAGTGTGGTGGCCATGG + Intergenic
1055364483 9:75528032-75528054 GCCTGAGACTGTAGGGAAGAAGG + Intergenic
1055585429 9:77754329-77754351 GCTTGGGATGCTAGTGAACAGGG - Intronic
1057038711 9:91832160-91832182 ACCTGGAATGGCAGTGAACATGG - Intronic
1057196099 9:93116215-93116237 GCCTGTGTTTGTAGTCAGCAGGG - Intergenic
1058249031 9:102668657-102668679 GCCTAGGATGGTGGTGACCATGG - Intergenic
1059792140 9:117651571-117651593 GCCAGGGTTTGTATTGGACATGG - Intergenic
1061396140 9:130344110-130344132 GGCTGAGATTGTGGTAAACAAGG + Intronic
1187610541 X:20938812-20938834 GCCTGGGATGGTGGTGACTATGG - Intergenic
1188070715 X:25715121-25715143 ACCTGGGATTTTAGTGGAAAGGG - Intergenic
1191135838 X:57063911-57063933 GCCTGAGATGGTAATGAACATGG - Intergenic
1191640513 X:63426672-63426694 GTCTGGGATTGTTGTGAAAATGG + Intergenic
1192799352 X:74450948-74450970 GCCTGGGATTAAAGGGAACTAGG + Intronic
1193280299 X:79641197-79641219 GCCTGTGGTGGTAGTGAGCATGG - Intergenic
1193549436 X:82872316-82872338 GCCTGGCTTTGCAGTGGACAGGG - Intergenic
1197050070 X:122046966-122046988 ACCTGGCTTTGTAGTGAACAGGG - Intergenic
1197361079 X:125504526-125504548 GACTGGGGTAGTAGTGACCATGG - Intergenic
1199322359 X:146455586-146455608 ACCTGGGATTGTGGTGCAGAGGG + Intergenic
1202343990 Y:23902278-23902300 GCTTGAGGCTGTAGTGAACAAGG - Intergenic
1202526778 Y:25767805-25767827 GCTTGAGGCTGTAGTGAACAAGG + Intergenic