ID: 949929651

View in Genome Browser
Species Human (GRCh38)
Location 3:9068792-9068814
Sequence TTACTAGAAGGGCTCCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949929651_949929658 16 Left 949929651 3:9068792-9068814 CCTTCCAGGAGCCCTTCTAGTAA 0: 1
1: 1
2: 0
3: 10
4: 101
Right 949929658 3:9068831-9068853 GTCCTTTCCCTAATCCTGGGAGG 0: 1
1: 0
2: 1
3: 17
4: 121
949929651_949929656 12 Left 949929651 3:9068792-9068814 CCTTCCAGGAGCCCTTCTAGTAA 0: 1
1: 1
2: 0
3: 10
4: 101
Right 949929656 3:9068827-9068849 ATGAGTCCTTTCCCTAATCCTGG 0: 1
1: 0
2: 0
3: 16
4: 131
949929651_949929657 13 Left 949929651 3:9068792-9068814 CCTTCCAGGAGCCCTTCTAGTAA 0: 1
1: 1
2: 0
3: 10
4: 101
Right 949929657 3:9068828-9068850 TGAGTCCTTTCCCTAATCCTGGG 0: 1
1: 0
2: 1
3: 15
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949929651 Original CRISPR TTACTAGAAGGGCTCCTGGA AGG (reversed) Intronic
901508753 1:9703489-9703511 TGACTAGAAGGGCGCATGGGAGG - Intronic
903623593 1:24715401-24715423 TTACTGGAAGGGCTGCTTCAAGG - Intergenic
904255993 1:29255208-29255230 TGGCCAGGAGGGCTCCTGGAGGG - Intronic
905533776 1:38702490-38702512 CTCCTAGAAGAGCTCCTGGCAGG - Intergenic
906716396 1:47972870-47972892 TTACTAGGAGGGATCCAGGAGGG - Intronic
913562415 1:120035189-120035211 TTACAAGTAGTGCTTCTGGAAGG - Intronic
913635709 1:120758418-120758440 TTACAAGTAGTGCTTCTGGAAGG + Intergenic
914283004 1:146194570-146194592 TTACAAGTAGTGCTTCTGGAAGG - Intronic
914544034 1:148645288-148645310 TTACAAGTAGTGCTTCTGGAAGG - Intronic
914622590 1:149425722-149425744 TTACAAGTAGTGCTTCTGGAAGG + Intergenic
915251622 1:154593631-154593653 TTAGTAGAAGAGCAGCTGGAGGG + Intronic
915843822 1:159240828-159240850 TTACCCTAAGTGCTCCTGGAGGG - Intergenic
917966891 1:180184492-180184514 TTCCTAGAAGGGATGCTGTAGGG - Intronic
919233650 1:194808394-194808416 TTGCTAGAAAGGTTCCTGCAAGG - Intergenic
923616396 1:235541855-235541877 TTATTTGAAGGGCTCATGGCAGG + Intergenic
923898737 1:238302706-238302728 TTACTTAAAGGGCTTTTGGAAGG + Intergenic
1067804056 10:49381255-49381277 TTACCAGGTGGGCGCCTGGATGG - Intronic
1068589859 10:58842472-58842494 CTACTAGATGGGCTTCTGGAGGG - Intergenic
1069858012 10:71452239-71452261 GGTCTAGAAGGGATCCTGGAGGG + Intronic
1070156159 10:73836831-73836853 TTCCCAGCAGGGCTCCTGGTGGG + Intronic
1072004345 10:91229130-91229152 TAACTAGAAGGGTTCTTGGTTGG - Intronic
1073664619 10:105516757-105516779 ATAGCAGAAGAGCTCCTGGATGG - Intergenic
1076840040 10:133041353-133041375 TTTCTAGCAGGGCACCTGGCAGG + Intergenic
1078627025 11:12967130-12967152 ATGCTGGAGGGGCTCCTGGAAGG + Intergenic
1079073407 11:17367743-17367765 TTATTAGAAGGGCTGCTAGCAGG - Intronic
1080045167 11:27800565-27800587 TTACTAGAAAGGGGCCTTGAGGG - Intergenic
1080819936 11:35795956-35795978 CTACCAGAAGAGCTGCTGGAAGG - Intronic
1081092436 11:38889265-38889287 TGACTGGAAGTGCTCATGGAAGG - Intergenic
1082862913 11:57872511-57872533 TTACTAGAAGGACTGAGGGATGG - Intergenic
1084170754 11:67399800-67399822 TAACTAGAATTGCTCCTGGAAGG - Intronic
1088289544 11:108222046-108222068 TTATTAGAAGGGCGCCAGGAAGG + Intronic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1091054484 11:132405642-132405664 TTAATAGAGAGCCTCCTGGATGG - Intergenic
1091641458 12:2240557-2240579 TGGCTGGAAGGACTCCTGGAGGG + Intronic
1092300933 12:7249512-7249534 TTGTTTGAAGGGCTACTGGAGGG + Intergenic
1097051983 12:56229157-56229179 TTACTAACAGGGTTGCTGGAAGG - Exonic
1099150603 12:79107922-79107944 GTACTAGATGGGCTACTGGATGG + Intronic
1100872189 12:98921641-98921663 GGACTAGAAGGGTTCCTGGGTGG + Intronic
1107726643 13:43306029-43306051 TGGTTAGAAGGGCTCCAGGAGGG + Intronic
1112561458 13:100518473-100518495 TTATTTGAAGGGCTTCTGTAGGG + Intronic
1118717387 14:68569923-68569945 CTCATAGAAGGGCTACTGGAGGG + Intronic
1121360577 14:93254614-93254636 TCACTTTAAGGGCTCCTGTATGG + Intronic
1125182819 15:36896892-36896914 TTGCTAGAAGAGCTCAGGGACGG + Intronic
1125478284 15:40062502-40062524 ATACTAGAAGGGATGGTGGATGG + Intergenic
1127543676 15:59968683-59968705 TTATTACCAGGGCTCCTGCAAGG - Intergenic
1128563335 15:68682920-68682942 TTACAGGAAGGGCACCTGGTGGG + Intronic
1131871439 15:96768710-96768732 TTCCTAGAAACTCTCCTGGATGG + Intergenic
1139122049 16:64032440-64032462 GAACTAGAAGAGCTCCTGGGAGG + Intergenic
1142545673 17:700889-700911 TTACCAGACCTGCTCCTGGAAGG - Intronic
1144402693 17:14921547-14921569 TTATTAGAAGTGCTACTAGAGGG + Intergenic
1145393840 17:22478279-22478301 TTACCAGCCGGGCTCCTGGCCGG - Intergenic
1146420204 17:32677940-32677962 TTTCTGGAAGGACACCTGGAGGG - Intronic
1146778034 17:35639716-35639738 TTACTAGAAAGCTTCCTGGAGGG + Exonic
1148657775 17:49301078-49301100 GTATAAGAAGGGGTCCTGGAGGG - Intronic
1153293635 18:3525183-3525205 CTACGAGTAAGGCTCCTGGAGGG - Intronic
1157586754 18:48805977-48805999 TTGCTAGAAGGGCTTCCTGAAGG - Intronic
1158467083 18:57700102-57700124 TTCTTAGCAGGGCTACTGGAAGG - Intronic
1158875007 18:61725098-61725120 TTTCTAGAAGGGCTCTTACACGG + Intergenic
1163090613 19:15017273-15017295 TTACTAGAGGGGGTCAGGGAGGG + Intronic
1163389417 19:17021333-17021355 GGACTAGAAGGGCTTCTAGAAGG + Intronic
925313658 2:2905958-2905980 TACCTAGCAGGGTTCCTGGAAGG + Intergenic
926213708 2:10890622-10890644 TTACTAAAAGGGGACCTGGGTGG - Intergenic
929897515 2:45974866-45974888 CTTCTAGAAGGTCTCCTAGAAGG - Intronic
931325567 2:61218584-61218606 ATACTAGATGGGATCCTGGAAGG - Intronic
937169362 2:119850270-119850292 TTACAAGCAGGGCTCTTGTAGGG + Intronic
938602697 2:132858674-132858696 AAATTAGAATGGCTCCTGGAGGG + Intronic
946085276 2:217164275-217164297 ATACTAGATGAGCTCCTGGCTGG + Intergenic
947566161 2:231194937-231194959 TTACTAGGATGGCTCATAGAAGG - Intergenic
947903641 2:233743650-233743672 GTACTCGAAGGGGTCCTCGAAGG + Intronic
947905031 2:233755003-233755025 CTACTCGAAGGGGTCCTTGAAGG + Intronic
948571672 2:238921726-238921748 GTATTAGAGGGGCCCCTGGAAGG + Intergenic
948635835 2:239336867-239336889 TTCCTGGATGGGATCCTGGATGG - Intronic
948826740 2:240576726-240576748 TTCCTGGACCGGCTCCTGGATGG + Exonic
1168809561 20:695603-695625 TTTCTAGAATGTCTCCAGGAAGG + Intergenic
1168877108 20:1179507-1179529 TCACTAAAATGGCTCCTGTAGGG + Intronic
1170503707 20:17002229-17002251 TTACTAGAAGGACACCCAGAAGG + Intergenic
1170969788 20:21105659-21105681 TTACTGGAGGGACTCCTGGCCGG - Intergenic
949547892 3:5088138-5088160 TTAATAAAAGGGCTCCTTCAGGG - Intergenic
949929651 3:9068792-9068814 TTACTAGAAGGGCTCCTGGAAGG - Intronic
959925058 3:111911587-111911609 TAAGTACCAGGGCTCCTGGATGG + Intronic
971261590 4:25062187-25062209 TTACTTGAGGAGCTCATGGATGG + Intergenic
979311987 4:119213292-119213314 TTACTTAAAGGGGTCCAGGATGG + Intronic
979887035 4:126040864-126040886 CCCCTTGAAGGGCTCCTGGAAGG - Intergenic
981125620 4:141102894-141102916 TTACTAAAATGGAGCCTGGAGGG + Intronic
983930735 4:173450610-173450632 CTATTAAAAGGGCTCCTTGACGG + Intergenic
985401191 4:189595873-189595895 TGACTGGAAGGGCACCAGGAAGG - Intergenic
986680249 5:10225781-10225803 TTTCTAGAAGTGTTCCTGGTGGG - Intergenic
988019983 5:25609539-25609561 TGAGTATAAGGACTCCTGGATGG - Intergenic
989821218 5:45797344-45797366 GTATTAGAAGGGCTGTTGGAGGG - Intergenic
990919292 5:60945130-60945152 TTACTAGAAGGGCTCCAGGATGG + Exonic
996039800 5:118797048-118797070 TTACTAGAAGGGCACCAATATGG - Intergenic
1002304066 5:178273178-178273200 TTTCTAGAAGTGCCCGTGGAAGG + Intronic
1008150932 6:47950220-47950242 TTACTTGAAAAGCTCCTGGAGGG + Intronic
1013688659 6:112614776-112614798 TAACTAGAAGTGCTCCCAGAAGG - Intergenic
1014613444 6:123572439-123572461 TGGCTAGAAAGCCTCCTGGATGG + Intronic
1016637065 6:146304797-146304819 TTTCCAGAAGGTGTCCTGGAAGG - Exonic
1021639919 7:22727245-22727267 TTCATAGCTGGGCTCCTGGAGGG - Exonic
1026807270 7:73436170-73436192 TTACAAGAAAGACTCCTGCAGGG - Intergenic
1029834818 7:103297739-103297761 TCACTAGCAGGTCTCCTGGCGGG - Intronic
1031734906 7:125346639-125346661 TTTCTAAAAAGGCTCGTGGAAGG - Intergenic
1034416230 7:150965613-150965635 TTTCTAGAGGGGGTCCTAGAAGG - Intronic
1035172089 7:157022376-157022398 TTTCTAGAAGGGGCGCTGGATGG - Intergenic
1037955389 8:23052924-23052946 ATACAAGAAGGGCTCCTGTATGG + Intronic
1038757274 8:30353125-30353147 GTGCTTGAAGAGCTCCTGGATGG - Intergenic
1039361397 8:36881147-36881169 TTTGTAGAAGGGCTCCCGAAAGG - Intronic
1045883382 8:107066702-107066724 TGACTAGAAGGTCCCATGGAAGG + Intergenic
1046052880 8:109044589-109044611 TTAGCAGAAGTTCTCCTGGAGGG + Intergenic
1046211136 8:111078763-111078785 TTACAAGAAGGGATTGTGGATGG - Intergenic
1050737609 9:8781906-8781928 TTACTAGAATGTCTTATGGATGG - Intronic
1057931585 9:99198149-99198171 TTGCTAGAATGGATCCTGCAGGG - Intergenic
1188844978 X:35061267-35061289 TTGCTGGAAGGGCAACTGGAGGG + Intergenic
1191900674 X:66038038-66038060 TTCCTGGAATGCCTCCTGGATGG + Intronic
1194383474 X:93223602-93223624 TTACTAGAAAGCTTCCTGGAGGG - Intergenic