ID: 949933020

View in Genome Browser
Species Human (GRCh38)
Location 3:9094638-9094660
Sequence GATTGTTTTACCTACCAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949933013_949933020 27 Left 949933013 3:9094588-9094610 CCTGGGAACGCATGAGGGTCCTG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 949933020 3:9094638-9094660 GATTGTTTTACCTACCAACTGGG 0: 1
1: 0
2: 1
3: 13
4: 123
949933015_949933020 8 Left 949933015 3:9094607-9094629 CCTGAGGCTCCACATTCTTGCCA 0: 1
1: 6
2: 20
3: 239
4: 1036
Right 949933020 3:9094638-9094660 GATTGTTTTACCTACCAACTGGG 0: 1
1: 0
2: 1
3: 13
4: 123
949933016_949933020 -1 Left 949933016 3:9094616-9094638 CCACATTCTTGCCAGCACTTAGG 0: 1
1: 0
2: 18
3: 173
4: 1030
Right 949933020 3:9094638-9094660 GATTGTTTTACCTACCAACTGGG 0: 1
1: 0
2: 1
3: 13
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949933020 Original CRISPR GATTGTTTTACCTACCAACT GGG Intronic
903405535 1:23092228-23092250 GATGGTTGTATTTACCAACTTGG + Exonic
905151826 1:35934617-35934639 GATTGTTTTAAATACTAAATTGG - Intronic
908578834 1:65491707-65491729 GATTATTTTACCAACCATCAGGG + Intronic
908713964 1:67050568-67050590 CATTATTTTAACTACCAATTTGG - Intronic
908979369 1:69935382-69935404 GATATTTCTACCTACCAAATTGG + Intronic
909086551 1:71175208-71175230 CATGATTTTTCCTACCAACTGGG - Intergenic
909206650 1:72767072-72767094 GATAGTTTTACCTCCCAATATGG - Intergenic
910547096 1:88430911-88430933 CATTATTCTACCTACCAACATGG - Intergenic
911261186 1:95688110-95688132 GATTTTTGTACATATCAACTGGG + Intergenic
913086965 1:115447911-115447933 GATTGTATTATCTACCATCGTGG + Intergenic
913663894 1:121030060-121030082 GATTGTTTTCCATACCAAGGAGG - Intergenic
914015288 1:143813339-143813361 GATTGTTTTCCATACCAAGGAGG - Intergenic
914162530 1:145147886-145147908 GATTGTTTTCCATACCAAGGAGG + Intergenic
914653906 1:149721880-149721902 GATTGTTTTCCATACCAAGGAGG - Intergenic
923099551 1:230801439-230801461 GATCATTTTGCCTGCCAACTTGG - Intronic
923782743 1:237040676-237040698 TATTATTTTACCTACCATCTGGG + Intergenic
1066146673 10:32566109-32566131 AATTGTTTTGCCTACCATCTTGG + Intronic
1067164400 10:43853645-43853667 GATTGTTTTCCCTAACAAATAGG - Intergenic
1068353220 10:55877506-55877528 AATTGTTTTACCTTCAAATTTGG + Intergenic
1069971800 10:72177234-72177256 GATTGTAAAACCTACCAAGTTGG - Intronic
1070737964 10:78877562-78877584 CATGGTTTTACCCACTAACTTGG + Intergenic
1074698300 10:116070911-116070933 GTTTGCTTTTCCTACAAACTTGG + Intronic
1075920164 10:126204767-126204789 GCTTATCTTACCTACCAAATGGG + Intronic
1078540657 11:12210603-12210625 GAATGTTTAAGCTGCCAACTTGG + Intronic
1079339025 11:19596881-19596903 GATAGTTATACCTACCTACTGGG - Intronic
1081824082 11:46029893-46029915 AAGTATTTTACCTACCAATTAGG - Intronic
1082190112 11:49232742-49232764 GTTTATTTTACCTAGCAATTTGG + Intergenic
1082254284 11:50015217-50015239 AATTGTTTTGGCTACCACCTTGG + Intergenic
1085679543 11:78559772-78559794 GAGTGTTTTAACTACCCACAGGG + Intronic
1085734746 11:79029709-79029731 GTTTCTTTTGCCTTCCAACTTGG - Intronic
1086676101 11:89608956-89608978 GATTGTATTATCTGCCAACAAGG + Intergenic
1086932979 11:92713324-92713346 TATTATTTTAGCTACCAACTTGG + Intronic
1088863029 11:113820144-113820166 TCTTTTTTAACCTACCAACTGGG + Intronic
1094349587 12:29508932-29508954 GATTTTTTTACCTAGCATCTAGG - Intronic
1097681718 12:62655676-62655698 GATTCTGTTACACACCAACTGGG + Intronic
1098305387 12:69097539-69097561 TAGTGTTTGACCTAACAACTAGG + Intergenic
1100456936 12:94760854-94760876 GTTTTTTTTACCTATCAAATGGG + Intergenic
1101331852 12:103763412-103763434 GCTTGCTTTACCTGCCAACTTGG + Intronic
1101716016 12:107313180-107313202 GATTATTTTGCCTACCAGATTGG - Intergenic
1106575623 13:30971825-30971847 GATCATTTTACCTTTCAACTAGG - Intronic
1108152633 13:47552256-47552278 GATTGTTTTCAGTATCAACTGGG - Intergenic
1108496245 13:51027990-51028012 GTTTGCTGTACCTATCAACTAGG - Intergenic
1111335345 13:86814242-86814264 GATTATTTGACCTGCAAACTTGG - Intergenic
1113882284 13:113633988-113634010 GATTGGTCTGCCCACCAACTCGG + Exonic
1114690198 14:24574103-24574125 GATTGTTTTCCCCATCAACCTGG - Intronic
1120537064 14:85709894-85709916 GATTGTTTTATCTGCCAGCCAGG + Intergenic
1127376284 15:58387984-58388006 GCTAGTTTTACGTGCCAACTTGG + Intronic
1127937916 15:63661216-63661238 GATTATTTTACCAAACTACTGGG + Intronic
1129948111 15:79559874-79559896 GATTGGTCTGCCCACCAACTCGG - Intergenic
1130657753 15:85803935-85803957 GATTTTTTGAGCTTCCAACTTGG - Intergenic
1131378928 15:91947990-91948012 AATTGTTTATCCTCCCAACTAGG + Intronic
1133422475 16:5658327-5658349 GCTTGTTTCAGCTACAAACTTGG - Intergenic
1133649698 16:7800158-7800180 ATTTATTTTACATACCAACTAGG + Intergenic
1134154820 16:11834663-11834685 GATTGTTTTCCATAGAAACTAGG - Exonic
1138043056 16:53695140-53695162 GATTCTTTTACTGACCAATTAGG + Intronic
1139037722 16:62967730-62967752 GATTGTTTTACCTCGCAACATGG + Intergenic
1140937234 16:79684571-79684593 AAATGTTTTACCAGCCAACTGGG - Intergenic
1146155708 17:30522632-30522654 GATTGGTTTACCTGCCTCCTAGG - Exonic
1146207045 17:30913841-30913863 GATTGTCTTACCAAGCATCTGGG - Intronic
1149948619 17:60959992-60960014 GATTGTTTTAAGTACCAACCTGG + Intronic
1151089186 17:71415769-71415791 GATGGTTTAAACTACCACCTAGG - Intergenic
1155510709 18:26573835-26573857 GATTTTTTCACCTACAGACTGGG + Intronic
1156933548 18:42675089-42675111 CATTGTTTGACCAAGCAACTAGG - Intergenic
1158614276 18:58971611-58971633 GACTGTTTTACCTATCACTTTGG + Intronic
1159399509 18:67912466-67912488 GTTTGTTTTTCCTCCCAACCTGG + Intergenic
1159849289 18:73507709-73507731 TATTGTTTTACCTATCAGGTTGG + Intergenic
1164660845 19:29965803-29965825 GTTGGCTTTACCTACAAACTGGG - Intronic
928052447 2:28013355-28013377 GTTTGGCTTACCTAGCAACTGGG + Intronic
936721809 2:115260264-115260286 GACTGTTTTACATAGCAATTAGG + Intronic
936820418 2:116513148-116513170 AAATGTTGTACTTACCAACTGGG - Intergenic
944061683 2:195575877-195575899 GATTGTTTTAAGAATCAACTTGG + Intergenic
945437652 2:209838201-209838223 GATCATTTTACCTCCCCACTGGG + Intronic
946457863 2:219843369-219843391 GATTTTTTTACCCATCAAATGGG - Intergenic
947614512 2:231546697-231546719 GTTAGTTTTACATGCCAACTTGG + Intergenic
1173618947 20:44421985-44422007 GATTGTCTTACTTACCAACATGG + Intronic
1177000079 21:15601483-15601505 TAGGGTTTTACCAACCAACTGGG - Intergenic
1178700972 21:34834056-34834078 TATTTTTTTACCTACCCATTAGG - Intronic
949799932 3:7892636-7892658 GAATGTTTTACCTAGCAGCCTGG + Intergenic
949933020 3:9094638-9094660 GATTGTTTTACCTACCAACTGGG + Intronic
951390052 3:22091568-22091590 TATTGTTTTATCTACCCAGTAGG + Intronic
951508012 3:23470392-23470414 GAATGTTTGACCTACCAGGTAGG + Intronic
957850710 3:85803843-85803865 GATTGTTTAACCAAACATCTGGG + Intronic
960237095 3:115296150-115296172 TATTGTTTAAGCTACCAAGTTGG + Intergenic
960920507 3:122742571-122742593 TATTGTTTGACCAAACAACTGGG - Intronic
962472086 3:135718722-135718744 TAGTGTTTGACCTAACAACTGGG + Intergenic
965386341 3:168050573-168050595 GAGTGTTTTTCCTTCCAGCTGGG - Intronic
967253608 3:187567734-187567756 GGTTGTTTTATGCACCAACTTGG - Intergenic
968892998 4:3381678-3381700 GATTCAGTTACCTCCCAACTGGG + Intronic
970052898 4:11936116-11936138 GTTTATTTTATCTACCTACTGGG - Intergenic
970102531 4:12541116-12541138 GATTGTTTTTCCTATGAGCTGGG - Intergenic
971328166 4:25661343-25661365 GCGTGTTTTACCTACCACCCAGG - Intronic
975124727 4:70768811-70768833 GATTGTTTTTCCTTCCAGTTTGG + Intronic
976095473 4:81503931-81503953 GATAGTTTTACGTACCTAATAGG + Intronic
976783491 4:88789319-88789341 GATTGTTTTCTCTCCCAACAAGG + Intronic
977110568 4:92948200-92948222 TATAATTTTACCTACCAAATTGG - Intronic
980581805 4:134763904-134763926 GCTCATTTTACCTATCAACTTGG + Intergenic
982937240 4:161496335-161496357 GAGTGTTTGACCAAACAACTGGG - Intronic
986757355 5:10850619-10850641 GATTCTTTTTCCTGCGAACTTGG + Intergenic
986766158 5:10930043-10930065 GATGATTTTACCTTCCAACAAGG + Intergenic
987014409 5:13802688-13802710 GAATGTTGTACCTAAGAACTAGG - Intronic
990887627 5:60612626-60612648 GTGTGTTTTTCCTACAAACTAGG - Intronic
991572910 5:68074495-68074517 GATTATTTTACATATCACCTGGG - Intergenic
991665068 5:68991484-68991506 TGTTGTTTTACTGACCAACTAGG + Intergenic
992408614 5:76483511-76483533 GATTCTCTAACCTACCATCTTGG + Intronic
992779247 5:80113318-80113340 ACTAGTTTTACCTACCAAATTGG - Intronic
996637284 5:125708704-125708726 GATAGTTATCCCTAACAACTTGG - Intergenic
998584778 5:143416030-143416052 GATTGGTTTACATATGAACTGGG + Intronic
998607966 5:143655597-143655619 GATTTTTTCACCTATCAAATTGG + Intergenic
999074162 5:148779290-148779312 GATTATTTCACCTACAATCTGGG - Intergenic
1001741153 5:174053758-174053780 TACTTTTTTACCTACCAAATTGG + Intronic
1004262910 6:14123835-14123857 GATTGTCTTAGCTACGTACTTGG + Intronic
1010904966 6:81476352-81476374 TAGTGTTTGAACTACCAACTAGG - Intergenic
1011957666 6:93043441-93043463 GATTTTTTTGCCTAGAAACTTGG - Intergenic
1014134249 6:117869420-117869442 GATTGTTTTTCTTCCTAACTAGG + Intergenic
1016983960 6:149880347-149880369 GATCGTGTTAACTACCAACTGGG - Intergenic
1017021823 6:150146082-150146104 GAATTTATTACCTACCTACTAGG + Intronic
1024217282 7:47258074-47258096 GATGGATGTACCAACCAACTGGG - Intergenic
1027459571 7:78435883-78435905 GTCTGTAGTACCTACCAACTTGG - Intronic
1028677128 7:93478371-93478393 CATTTTTTTCCCTACCAAGTTGG + Intronic
1030524884 7:110640954-110640976 GATTTTTTTACCTGCCTATTTGG - Intergenic
1032858969 7:135859833-135859855 GATGAGTTTACCTACCCACTGGG + Intergenic
1035063699 7:156090255-156090277 GAGACTTTTACCTACCTACTCGG - Intergenic
1036107331 8:5855122-5855144 GATTTTTTTACCCACATACTGGG - Intergenic
1038956513 8:32474162-32474184 GATTGTTTTACCTACAAGTATGG - Intronic
1040370114 8:46761770-46761792 GATGCTTTTATCTTCCAACTGGG - Intergenic
1041048718 8:53912371-53912393 GATATTTTTACCTACAAAATTGG - Intronic
1041360282 8:57045748-57045770 CAATGTTTTACCAGCCAACTAGG + Intergenic
1052001925 9:23294236-23294258 GATTCTTTTGCCTCCTAACTTGG - Intergenic
1052607967 9:30729920-30729942 GATTAATTTATATACCAACTTGG + Intergenic
1055903116 9:81263594-81263616 GATTCTTTTGCCTAGAAACTTGG + Intergenic
1060612815 9:124983805-124983827 CATTGTTTTACATTCCAACTTGG + Intronic
1060787414 9:126461327-126461349 GATTGTTTTAATTACAAACTTGG - Intronic
1061891367 9:133622583-133622605 GATTGTTTTTCCTACACGCTTGG + Intergenic
1188053909 X:25519629-25519651 CATTGTTTTACCTAGCAACTGGG + Intergenic
1189002618 X:36962834-36962856 GATTGGTCTGCCCACCAACTCGG - Intergenic
1192824751 X:74683336-74683358 GGTTGTTTTAAATACCAGCTAGG + Intergenic
1198896026 X:141455426-141455448 GATAGATTTAAATACCAACTTGG + Intergenic
1199998458 X:153042838-153042860 GATAGTTTGACCAAGCAACTGGG + Intergenic