ID: 949933773

View in Genome Browser
Species Human (GRCh38)
Location 3:9101005-9101027
Sequence CTGACAGGTTTCCATGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949933766_949933773 28 Left 949933766 3:9100954-9100976 CCCATAGGCAGGAAGGACCAGTG 0: 1
1: 0
2: 0
3: 15
4: 194
Right 949933773 3:9101005-9101027 CTGACAGGTTTCCATGTGACAGG 0: 1
1: 0
2: 0
3: 15
4: 138
949933770_949933773 11 Left 949933770 3:9100971-9100993 CCAGTGGATGGTCACGATTTCTG 0: 1
1: 0
2: 0
3: 2
4: 42
Right 949933773 3:9101005-9101027 CTGACAGGTTTCCATGTGACAGG 0: 1
1: 0
2: 0
3: 15
4: 138
949933767_949933773 27 Left 949933767 3:9100955-9100977 CCATAGGCAGGAAGGACCAGTGG 0: 1
1: 1
2: 1
3: 8
4: 192
Right 949933773 3:9101005-9101027 CTGACAGGTTTCCATGTGACAGG 0: 1
1: 0
2: 0
3: 15
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949933773 Original CRISPR CTGACAGGTTTCCATGTGAC AGG Intronic
901925122 1:12561280-12561302 CTGGCTGGTTCCCATGTGATTGG - Intergenic
905717397 1:40163417-40163439 TTGACAAGCTTCAATGTGACTGG - Intronic
906247971 1:44290376-44290398 CTCACAGGTGTCCCTGTGGCAGG - Intronic
909466352 1:75978288-75978310 CTGTCTGGTTGCCATGTGGCAGG - Intergenic
911753591 1:101526977-101526999 CTGACATGTTTCTATGGGAAAGG - Intergenic
911959137 1:104277269-104277291 CTGACATTTTTCAATGTTACAGG + Intergenic
915331112 1:155112894-155112916 CTGACAGGCTTCCCTGGGGCTGG - Intergenic
915860082 1:159434795-159434817 CTGAGAGCTTTCCATGTGCCAGG - Intergenic
917716022 1:177738815-177738837 CTGAGAGTTTTCTATGTGCCTGG + Intergenic
920658988 1:207899056-207899078 CTGAAACATTTCCAGGTGACAGG + Exonic
920915254 1:210253377-210253399 CTGACAGGTTTGCCTGTTAAAGG - Intergenic
921756682 1:218864754-218864776 TTGGGAGCTTTCCATGTGACAGG + Intergenic
1065434389 10:25692277-25692299 CTGCCAGGACTCCATGTGGCAGG - Intergenic
1065720095 10:28619922-28619944 CAGACAGGTTTACATGTAAAAGG - Exonic
1066268719 10:33801056-33801078 CTGACAGATTTCTATCTGTCTGG - Intergenic
1067801390 10:49361717-49361739 ATGATAGGTTTCCCTGAGACAGG - Intergenic
1068502583 10:57858489-57858511 CTGTTAGGTTTCCATGTCAATGG - Intergenic
1069296700 10:66854679-66854701 CTGACAGGTATGCAAATGACAGG + Intronic
1071971454 10:90911851-90911873 CTGACAAGCTCCCAGGTGACAGG - Intergenic
1073435977 10:103516337-103516359 GTGCCAGGTTTTCAGGTGACTGG + Intronic
1074896137 10:117779092-117779114 CTGGCAGGTTTCTATGTTAAGGG - Intergenic
1075916457 10:126171954-126171976 CTGAAAGCTTTCCATGTGTCTGG + Intronic
1077890585 11:6415335-6415357 CTGACAGCTTCCCATATGCCAGG + Intronic
1078106868 11:8363225-8363247 TTGACAGTATTCCATGTGGCTGG - Intergenic
1078150008 11:8750509-8750531 CTGACAGTCATCCAGGTGACTGG - Intronic
1079083544 11:17429984-17430006 CTGCCAGGGTCCCATGAGACAGG + Intronic
1081699770 11:45145785-45145807 CTGACAGGTTGCGATGGGGCTGG - Intronic
1081742044 11:45447805-45447827 ATGAGCGGCTTCCATGTGACAGG + Intergenic
1088354577 11:108929122-108929144 CTGCTAGTTTACCATGTGACTGG + Intronic
1089033497 11:115359188-115359210 CTGACAGTTTTCCAGCTGAGTGG + Intronic
1091296875 11:134480110-134480132 CTGGCAGATTTCCATTTGTCTGG - Intergenic
1094393385 12:29977855-29977877 CAGTCAGGTTTCTATGTGATAGG + Intergenic
1097549780 12:61053300-61053322 CTGACATGATTCCTTGTGCCTGG - Intergenic
1097922527 12:65091854-65091876 CTGAGTAGTTTCCATGTGCCAGG + Intronic
1099529250 12:83755785-83755807 CTCCCAGGTTTCCATGTTAGTGG - Intergenic
1101825006 12:108213355-108213377 CTGAGAGGATTCCAGGTGAAAGG + Intronic
1108396228 13:49994726-49994748 CTGAAATGTTTCCATATGGCTGG + Intergenic
1111108690 13:83678778-83678800 CTGAGAGGTTTTCATGTGCCAGG + Intergenic
1113488027 13:110669399-110669421 CCCACAGGTTTCGAGGTGACTGG + Intronic
1115847975 14:37558376-37558398 CTAACATGTTTCCAAGTGACTGG - Intergenic
1118898904 14:69970295-69970317 CTGAGAGCTTTCCATCTGCCGGG + Intronic
1121027209 14:90625367-90625389 CTTTCAGGTTCCCATGTGGCTGG + Intronic
1121407922 14:93730139-93730161 CTGACCAGTTTCTATGTGCCAGG + Intronic
1122463805 14:101917081-101917103 CTGTGAGGGTTCCATGAGACAGG - Intronic
1122601752 14:102925148-102925170 CTGGCAGGTGTGCAGGTGACAGG - Intronic
1123387749 15:19833816-19833838 CTGACAAGTTTCTTTGTGATGGG - Intergenic
1125870626 15:43098402-43098424 CTGAAAGGCTTCCTTGAGACAGG + Intronic
1125929281 15:43589021-43589043 CTGACAGGAATCAATGTGAATGG + Intronic
1125942448 15:43688853-43688875 CTGACAGGAATCAATGTGAATGG + Intergenic
1125967225 15:43884180-43884202 ATGACAGGGCTCCATGTGAAGGG + Intronic
1127205340 15:56711308-56711330 TTGAGTGGTTTCCATGTGCCAGG - Intronic
1128072571 15:64806921-64806943 CTGCCAGGTCTCCTTGTGCCAGG - Intergenic
1132262540 15:100439431-100439453 CTGAGAGTTTTCCATGTGTAAGG + Intronic
1133767156 16:8846074-8846096 CTGACAGGTTCCCAAGTGGCTGG + Intronic
1137002295 16:35239849-35239871 CTGTCAGGATTCAATTTGACAGG - Intergenic
1141567216 16:84910836-84910858 CTGGCAGGTTTGCATGTGTATGG + Intronic
1141903200 16:87006214-87006236 CTCACAGGTTATGATGTGACAGG - Intergenic
1142268084 16:89074080-89074102 GTGACAGGTTCACATGTGACAGG - Intergenic
1142268110 16:89074299-89074321 GTGACAGGTCTACACGTGACTGG - Intergenic
1142268169 16:89074798-89074820 GTGACAGGTCTACACGTGACTGG - Intergenic
1142268188 16:89074958-89074980 GTGACAGGTCCACATGTGACAGG - Intergenic
1142629792 17:1217456-1217478 CTGAGTGGTTACCATGTGTCAGG + Intronic
1146208518 17:30924053-30924075 CTGACAGCTTTCTTTGTGTCTGG - Intronic
1147484783 17:40802183-40802205 TTGACAGTTTTCCATTTGCCAGG - Intergenic
1147590541 17:41680355-41680377 TTGTCAGGATTCCATGGGACAGG + Intergenic
1149958117 17:61076251-61076273 CTGACAGCTTTTCATCGGACAGG + Intronic
1151504027 17:74514463-74514485 GTGACAGGTGATCATGTGACAGG + Intergenic
1152995032 18:398613-398635 CTGTGAGATTTCCCTGTGACTGG - Intronic
1161689078 19:5720348-5720370 CTCACAGCCTTCCACGTGACCGG - Intronic
1168502807 19:56907886-56907908 CTGACCGGTTTGCATGAGAGAGG - Intergenic
1168542325 19:57223422-57223444 ATGGCTGGTTTGCATGTGACAGG + Intergenic
925077703 2:1032074-1032096 CTGACAGCATTGCTTGTGACAGG + Intronic
927723349 2:25401845-25401867 CTGGCAGGTGTCCATGAGTCAGG - Intronic
931357504 2:61549988-61550010 CTGAAAAGTTTGCATGTGATAGG - Intergenic
932491707 2:72127002-72127024 CAGAAAGGTTTCCATGTGAGAGG - Intergenic
934077915 2:88443507-88443529 CTGACAGCTTTCCATGACAAAGG + Intergenic
935135457 2:100296565-100296587 CTGCCAGGTTTCCTTGTGGTTGG + Intronic
939163200 2:138612999-138613021 CTGAGGGGATTCCAGGTGACTGG - Intergenic
943473618 2:188327444-188327466 CTTACAAGTTTCCTTGGGACTGG + Intronic
944956594 2:204819205-204819227 CTGACAGGCTTGCTTGAGACAGG - Intronic
945273464 2:207964474-207964496 ATGACAGGATTCCATGAGAGTGG + Intronic
945855371 2:215062978-215063000 CTGAGAGGCTTCTATGTGCCAGG - Intronic
946016009 2:216604639-216604661 CTGACAGCTATCCAAGTGGCAGG - Intergenic
947871023 2:233438093-233438115 CTTACAGGTGTGCATGTGTCAGG + Intronic
948821768 2:240553424-240553446 CTGCCAGGTTCACAGGTGACAGG + Intronic
1169343724 20:4814358-4814380 CTGAGTGGTTTCCAAGTCACAGG + Intronic
1170367998 20:15618349-15618371 CTGCCTTGTTTCCATGTGGCTGG - Intronic
1174970107 20:55265296-55265318 CTGACACCTCTCCATGTCACTGG - Intergenic
1175771947 20:61629602-61629624 CTAACAGGTTTCCCTGTCACTGG - Intronic
1176385381 21:6136419-6136441 CTGTCAGGTGTCTCTGTGACAGG - Intergenic
1177296453 21:19182548-19182570 CTCACAGGTTTTCATCTGAGTGG - Intergenic
1179738092 21:43401833-43401855 CTGTCAGGTGTCTCTGTGACAGG + Intergenic
1183285276 22:36958784-36958806 ATCATCGGTTTCCATGTGACAGG - Intergenic
949933773 3:9101005-9101027 CTGACAGGTTTCCATGTGACAGG + Intronic
950125918 3:10509731-10509753 ATGCGAGGCTTCCATGTGACTGG - Intronic
954577944 3:51687047-51687069 CTGACAGGCTCCCATGGGAGCGG - Intronic
956780057 3:72596558-72596580 CTGAGCGCTTTCCATGTGCCGGG + Intergenic
959410116 3:106010232-106010254 CTAATAGCTTTCCATGTCACTGG - Intergenic
961861272 3:129918426-129918448 CTGTCAGGTTTCCATGTTCTTGG - Intergenic
964529141 3:157648311-157648333 CTGACAGCTTCCAATGTGACAGG + Intronic
966619864 3:181952310-181952332 CTGACATCTTACCATGTGATTGG + Intergenic
968586591 4:1419804-1419826 GTGACAGGGTTCTATGGGACCGG - Intergenic
970005749 4:11409162-11409184 AGGACAGATTTCCATGTGTCTGG - Intronic
970564211 4:17315690-17315712 CTGACAGCTTTCAATCTGCCAGG - Intergenic
971496533 4:27272205-27272227 ATGAAAGGTTTCCATCTGGCAGG - Intergenic
972645180 4:40961127-40961149 CTGCCAGGCTTCTATGTGAAAGG + Intronic
975610761 4:76200516-76200538 CTGAGAGCTTTCTATGTGCCCGG + Intronic
975644876 4:76536228-76536250 CTGACAAGTATCCATGTGCAGGG + Intronic
975725400 4:77286696-77286718 CTGAAAGGGTTCCATCTGATTGG + Intronic
976215133 4:82708925-82708947 CTGAGAGCTTTCTATGTGCCAGG + Intronic
976215519 4:82712007-82712029 CTGAGAGCTTTCTATGTGCCAGG + Intronic
981257771 4:142683406-142683428 CAGACAGGTTTCCATGTGGAGGG + Intronic
982076225 4:151739714-151739736 CCCCTAGGTTTCCATGTGACAGG + Intronic
982128380 4:152204220-152204242 CTCACTGGCTTCCATGTCACTGG + Intergenic
986249625 5:6044458-6044480 CTGGCAGTGTTCCAGGTGACAGG + Intergenic
987322212 5:16780930-16780952 CTGACAGGGTACCATGTGTCAGG - Intronic
989637646 5:43554010-43554032 CACACAGGTTTCCAGGTGCCAGG + Intronic
990991648 5:61690259-61690281 CTGACAGTTTTCGAGATGACTGG - Intronic
992138491 5:73771602-73771624 CTGACAGGTTTTCCTGTGTTGGG + Intronic
994682501 5:102906683-102906705 CTGAGGGCTTTCCATGTGCCAGG - Intronic
997276343 5:132595314-132595336 CTGAGAGCTTTCTATGTGCCAGG - Intronic
999286744 5:150398711-150398733 GTGGCAGGTTTCCAGGTGAAAGG + Intronic
1003855549 6:10270230-10270252 CTGACAGGCTTTCATCTGTCTGG - Intergenic
1012764818 6:103353873-103353895 CTGAGAGGTTTAGATGTGAGTGG - Intergenic
1013845831 6:114450301-114450323 TTGAAAGGTTTCCATGTACCTGG - Intergenic
1015240923 6:131022328-131022350 GTGTCACGTTACCATGTGACAGG - Intronic
1015343340 6:132127525-132127547 TAGACAGGTTTCCATGTGCAAGG + Intergenic
1020341704 7:7118163-7118185 CTAAAAGGTTTCCATGTGCACGG - Intergenic
1021915159 7:25424239-25424261 CTTACAGGATGCCATGTGGCAGG + Intergenic
1030463683 7:109873336-109873358 CTGACAGGTTTCTTCATGACTGG - Intergenic
1030708027 7:112715325-112715347 CTCACAGGTCTCCATGTGTCTGG - Intergenic
1031004284 7:116454104-116454126 CTGACATGTTTTTATGTGACAGG + Intronic
1032247831 7:130228353-130228375 CTGACAAGTTTCCAAGTACCAGG + Intergenic
1033978607 7:147134144-147134166 CTGGTGGGTTTCCATGTAACAGG + Intronic
1034351177 7:150415781-150415803 CCAGCAGGTTTCCATGTGCCAGG - Intergenic
1041759359 8:61347362-61347384 GTGACAGCTTTCAATGTGTCAGG - Intronic
1043180208 8:77079178-77079200 AGGACAGGTTTCCTTGAGACAGG - Intergenic
1043229187 8:77778412-77778434 AGGACAGGTTTCCATGGGAGTGG - Intergenic
1044845457 8:96376002-96376024 CTGGGAGGTTTCCATGGGCCAGG - Intergenic
1047893882 8:129343894-129343916 GTCACAGGTTCCCTTGTGACAGG - Intergenic
1048034600 8:130665594-130665616 CTGAGAGCTTTCTATGTGCCAGG + Intergenic
1049116908 8:140696783-140696805 CTGACAGCTTTCCATATGCTCGG + Intronic
1050592049 9:7171080-7171102 CTGTCAGGATCCCATCTGACTGG - Intergenic
1054353089 9:64036317-64036339 TTGACATGTCTCCATGTGTCTGG - Intergenic
1056780131 9:89543059-89543081 CTGACAGATTTCCCTGTGTCAGG + Intergenic
1056862738 9:90202054-90202076 CTGACTGGTTTGCATTTGAAAGG + Intergenic
1057422748 9:94925697-94925719 CTCACAGGACTCCATGTGGCAGG - Intronic
1057548257 9:96034036-96034058 CTGATGGGTTTCCCAGTGACCGG - Intergenic
1060826094 9:126688881-126688903 CTACCAGGGTTCCATGAGACAGG - Intronic
1062608088 9:137357291-137357313 CTGACAGGTTTCCAGATGTGAGG - Intronic
1188025556 X:25205156-25205178 CTGACTGCTTTTCATGTGTCAGG - Intergenic
1188052612 X:25506423-25506445 GTGACTGGTTTCTTTGTGACTGG - Intergenic
1196573099 X:117286301-117286323 TTGACAGCTTACCATGTGGCAGG + Intergenic
1199545630 X:149005117-149005139 CTGACAGGTTTGCATGTGGAGGG - Intergenic