ID: 949936748

View in Genome Browser
Species Human (GRCh38)
Location 3:9121671-9121693
Sequence AGCTCATTATAGGTGATACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949936739_949936748 9 Left 949936739 3:9121639-9121661 CCTCAGTTAATGAACCCATGAGG 0: 1
1: 0
2: 1
3: 8
4: 115
Right 949936748 3:9121671-9121693 AGCTCATTATAGGTGATACAAGG 0: 1
1: 0
2: 0
3: 5
4: 103
949936745_949936748 -6 Left 949936745 3:9121654-9121676 CCATGAGGGGCTGGCCGAGCTCA 0: 1
1: 0
2: 0
3: 16
4: 138
Right 949936748 3:9121671-9121693 AGCTCATTATAGGTGATACAAGG 0: 1
1: 0
2: 0
3: 5
4: 103
949936744_949936748 -5 Left 949936744 3:9121653-9121675 CCCATGAGGGGCTGGCCGAGCTC 0: 1
1: 0
2: 1
3: 6
4: 98
Right 949936748 3:9121671-9121693 AGCTCATTATAGGTGATACAAGG 0: 1
1: 0
2: 0
3: 5
4: 103
949936737_949936748 25 Left 949936737 3:9121623-9121645 CCGTTCCGTCTGGTGGCCTCAGT 0: 1
1: 0
2: 0
3: 20
4: 152
Right 949936748 3:9121671-9121693 AGCTCATTATAGGTGATACAAGG 0: 1
1: 0
2: 0
3: 5
4: 103
949936736_949936748 26 Left 949936736 3:9121622-9121644 CCCGTTCCGTCTGGTGGCCTCAG 0: 1
1: 0
2: 0
3: 20
4: 133
Right 949936748 3:9121671-9121693 AGCTCATTATAGGTGATACAAGG 0: 1
1: 0
2: 0
3: 5
4: 103
949936738_949936748 20 Left 949936738 3:9121628-9121650 CCGTCTGGTGGCCTCAGTTAATG 0: 1
1: 0
2: 0
3: 16
4: 131
Right 949936748 3:9121671-9121693 AGCTCATTATAGGTGATACAAGG 0: 1
1: 0
2: 0
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949936748 Original CRISPR AGCTCATTATAGGTGATACA AGG Intronic
902720039 1:18297942-18297964 AGCTCCTCATAGGAGATACCTGG + Intronic
910120232 1:83780178-83780200 AAATTATTATATGTGATACATGG - Intergenic
912792504 1:112665973-112665995 ATCCTATTATAGGTGACACACGG - Intronic
915231372 1:154448086-154448108 GGCTCATTATTAGTGATTCATGG - Intronic
916642705 1:166747994-166748016 TCCTCATTATAGATGATGCAGGG - Intergenic
920979664 1:210821496-210821518 TGCAGTTTATAGGTGATACATGG - Intronic
921679994 1:218020254-218020276 AGCTCTTTATAGGTGCAAGATGG - Intergenic
924361706 1:243248222-243248244 AGGTGATTAAAGGTGATACAGGG + Intronic
1064546183 10:16452155-16452177 AACTGATTTTAGGTGATATATGG - Intronic
1068048286 10:51915692-51915714 TGCTAATTATAGGTGTTATAAGG + Intronic
1070189253 10:74096482-74096504 AGATAATTTTAGGTGTTACATGG - Intronic
1072028946 10:91497919-91497941 AAATCATTATAGGTCATAGATGG - Intronic
1073331001 10:102669774-102669796 AGCTCACCATAGGAGACACACGG - Intergenic
1076862720 10:133148030-133148052 AGCTAATTACAGATGATAAAGGG + Intergenic
1079746309 11:24135959-24135981 AGCTGATTTTAAGTGGTACATGG - Intergenic
1080106561 11:28517429-28517451 AGTTCTTTATAGGTAAAACAGGG - Intergenic
1080763136 11:35271932-35271954 AGCTCACTATAGGTAAAAAATGG + Intronic
1086228813 11:84544151-84544173 AGCTCATTTTAGGGGAGAAATGG - Intronic
1088631462 11:111777783-111777805 AGCACATTATAGGAAATACCAGG + Intergenic
1092853273 12:12649834-12649856 AACTCATTTTAGATGATACAGGG + Intergenic
1093257913 12:16894432-16894454 AGCTGATTATTGGTGTTAAATGG - Intergenic
1100824923 12:98465677-98465699 AGATGATTTTAGGTGGTACATGG - Intergenic
1101653385 12:106697307-106697329 AGCTCCTTATACCTTATACATGG - Intronic
1103578360 12:121895708-121895730 AGGTCTTTATAGGTGAAAGAGGG - Intronic
1109228366 13:59724393-59724415 AGCTCAGTATGGGTAATCCACGG + Intronic
1109957682 13:69590040-69590062 AGCACATAATAGGAGATTCATGG + Intergenic
1110320559 13:74155719-74155741 AGTTCCTTATAGCTTATACACGG + Intergenic
1114387540 14:22270461-22270483 AGTTTATTATAGGTGATTCTAGG - Intergenic
1118285943 14:64472664-64472686 ATCTGATTATATGTGCTACATGG + Exonic
1122353298 14:101109831-101109853 AGCTCATATTAGGTGATGCCTGG - Intergenic
1125968358 15:43892133-43892155 AGCTGTTCATAGGTGATGCAGGG + Intronic
1127523661 15:59770809-59770831 TGCTGTTTATAGGTGATAGATGG + Intergenic
1128293981 15:66501410-66501432 TCCTCATTATAGATGATGCACGG + Exonic
1132953961 16:2581182-2581204 AGCGCATTAGAGGTGAAACTGGG + Intronic
1132960384 16:2618981-2619003 AGCGCATTAGAGGTGAAACTGGG - Intergenic
1134360391 16:13525759-13525781 AGATAATTGTAGCTGATACATGG - Intergenic
1135637577 16:24091918-24091940 TGCTGGTTATGGGTGATACATGG + Intronic
1135810551 16:25582857-25582879 AGCTCAATAAAGATGATAAAAGG + Intergenic
1135986135 16:27185768-27185790 AGGTAATTTTAGTTGATACAGGG - Intergenic
1136055372 16:27684526-27684548 AGATGATTTTAGTTGATACATGG - Intronic
1138938076 16:61755078-61755100 AAGTCAATATAGGAGATACAAGG + Intronic
1140111120 16:72006052-72006074 AGCTCATTATTGGTGACCGAAGG - Intergenic
1149507416 17:57205847-57205869 AACATATTATAGGTGATACTGGG - Intergenic
1154408681 18:14122545-14122567 AGCCCTTTATAAGTGATAAAGGG + Intronic
1159035728 18:63275551-63275573 AGCTCATTATTCGTGACACTCGG - Intronic
1159554176 18:69928112-69928134 AGCTCATCATATGTGAAACATGG - Intronic
1159648495 18:70948866-70948888 AGCACATTACAGGTCATAAAAGG - Intergenic
929891975 2:45925723-45925745 AGCTCAGTCTAGGTGATCCTTGG - Intronic
930272031 2:49268521-49268543 AACTCTTTATTGGTGATAGAGGG - Intergenic
932648975 2:73534579-73534601 AATACATTATAAGTGATACAGGG - Intronic
941174910 2:162184889-162184911 AGCAAATAACAGGTGATACATGG + Intronic
942491319 2:176492008-176492030 AGCTCATTCAAGTTGATTCAAGG + Intergenic
943244639 2:185431228-185431250 AGCTTTTTATAGGTAGTACATGG + Intergenic
943508046 2:188786555-188786577 AGTTAATTATAGTTGAAACAGGG + Intronic
944051202 2:195472029-195472051 AACTCATTATAAGTGAAAGAGGG - Intergenic
944173622 2:196804995-196805017 AATTCATTATATGTGATAGAGGG - Exonic
948406174 2:237721332-237721354 ATCTAATTATAACTGATACAAGG - Intronic
1171024983 20:21622143-21622165 AGCTCATTCTAGTGGAGACAGGG + Intergenic
1175198023 20:57259221-57259243 AGCTAATTCTGGGTGATATATGG - Intronic
1177682899 21:24397173-24397195 AGCCCAGTATAAGGGATACAAGG + Intergenic
1185157163 22:49200485-49200507 AGCTCACAAAAGGTGATACTAGG - Intergenic
949936748 3:9121671-9121693 AGCTCATTATAGGTGATACAAGG + Intronic
953993053 3:47498621-47498643 GGCTCATTATGGGTGAAATATGG - Intronic
958880033 3:99659194-99659216 AGCTCATCATAGATGAATCAGGG - Intronic
960240370 3:115333965-115333987 AGTTCATTGTAGGTGATATTTGG - Intergenic
963088497 3:141460402-141460424 AGCTCATTGAAGGAGATAAATGG + Intergenic
972375652 4:38467168-38467190 ATGTCATTATAGGTGGTAAATGG - Intergenic
975058668 4:69969241-69969263 AGTTCATTTTAGTTGATTCATGG + Intergenic
979757178 4:124355532-124355554 AGGTCATTATATATGATAAAGGG + Intergenic
982937141 4:161494708-161494730 AACTCATTATACTTTATACAGGG - Intronic
985421427 4:189788747-189788769 AGGTCATCATAGGTGATCCTCGG + Intergenic
988920700 5:35939057-35939079 GGGTAATTATAGGTGATTCAAGG + Intergenic
989774609 5:45189032-45189054 TGCTCATTACAAGTGCTACAAGG - Intergenic
992896075 5:81246154-81246176 AGCTCATTTTATGAGTTACAGGG - Intronic
992906594 5:81352474-81352496 AGATCATTATAAGTGAAATAAGG + Intronic
996143371 5:119942676-119942698 AGCTAGTTAGAGGTGATACAAGG - Intergenic
998294411 5:140953271-140953293 TGCTCTTTATATGTGATTCAGGG + Intronic
1000459404 5:161495826-161495848 AACTCATTATAGAAGATATAAGG - Intronic
1003066478 6:2908260-2908282 AGCCCATTATAGCTGAAACCAGG - Intergenic
1004656334 6:17665771-17665793 AGCTCACTGTAGGTGAGACCTGG + Intronic
1006623299 6:35382333-35382355 AGCACAGTATAGGTGATGCCAGG - Intronic
1008355770 6:50551267-50551289 AGATCATTAATGGTGATTCATGG + Intergenic
1008504206 6:52213306-52213328 AGCTCATTCTTGGTGATTAAGGG + Intergenic
1009597080 6:65749377-65749399 AGCTCATTATTGGTTGTTCAGGG - Intergenic
1010548191 6:77185201-77185223 AGGTCATTATAAATGATAAAGGG + Intergenic
1010858806 6:80878576-80878598 AGCTCATGATTTGTGATACATGG + Intergenic
1012814784 6:104009456-104009478 AGCTCATTAGAGATGAAACCAGG - Intergenic
1014061991 6:117082369-117082391 AGCAAATTATAGATGATTCAAGG + Intergenic
1014143964 6:117975110-117975132 AGCTCATTAGTGCTGATAAATGG - Intronic
1014759481 6:125340740-125340762 ACCTCATTGTAGGACATACAAGG + Intergenic
1015298786 6:131629388-131629410 AGCTCTTTAGAGTAGATACATGG - Intronic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1029936116 7:104425901-104425923 AGCTCAATATAGGGGAGACTTGG - Intronic
1030534686 7:110751255-110751277 ATCTCATTATATATGATAGACGG + Intronic
1031126877 7:117784172-117784194 TGCTCATTACAATTGATACATGG + Intronic
1032269158 7:130387992-130388014 AGCTCAGTAGGGGTGATTCAGGG - Exonic
1037980222 8:23247767-23247789 AGCTAGTTAAAGGTGATACCGGG + Intronic
1039301919 8:36218577-36218599 GGCTAATTATTAGTGATACAAGG - Intergenic
1041127963 8:54664782-54664804 AGCTCATTATAGGGTACTCATGG + Intergenic
1041842079 8:62283785-62283807 AAGCCATTTTAGGTGATACATGG + Intronic
1045113576 8:98956593-98956615 AGTTCCTTAAAAGTGATACAAGG - Intergenic
1050623347 9:7477680-7477702 TCCTCATTATAGATGATGCACGG + Intergenic
1061448757 9:130657258-130657280 ATCTCTTTATAGGTGATATTTGG + Intergenic
1187764768 X:22629054-22629076 AGCTGATTTCAGGTCATACAGGG - Intergenic
1190105176 X:47555495-47555517 AGTTCATTATATGTTATATAGGG - Intergenic
1195637077 X:107130171-107130193 AGCCCATTATTGGTGACTCAAGG - Intronic
1195836811 X:109124900-109124922 ACATTATTTTAGGTGATACATGG - Intergenic
1195942039 X:110174925-110174947 AGCTCAGTGTAGGTCAAACACGG - Exonic
1199203575 X:145122083-145122105 AGCCCATCATAGGAAATACATGG - Intergenic