ID: 949939414

View in Genome Browser
Species Human (GRCh38)
Location 3:9143323-9143345
Sequence TAGGCAACCCACTTTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949939414_949939416 -7 Left 949939414 3:9143323-9143345 CCAGCACCAAAGTGGGTTGCCTA 0: 1
1: 0
2: 1
3: 5
4: 73
Right 949939416 3:9143339-9143361 TTGCCTAGTGCAGTCTGCTCTGG 0: 1
1: 0
2: 0
3: 17
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949939414 Original CRISPR TAGGCAACCCACTTTGGTGC TGG (reversed) Intronic
901330834 1:8407101-8407123 TAGGAAACCCTCTGTGGTACAGG + Intronic
901396087 1:8982857-8982879 TCGGCCTCCCACTTTGGTGCTGG - Intergenic
910552253 1:88488569-88488591 TATGCACAACACTTTGGTGCTGG - Intergenic
916101121 1:161394105-161394127 TAGTGAACACACTGTGGTGCTGG - Intergenic
916229223 1:162522776-162522798 TGGGCAACCCTTTTTTGTGCGGG + Exonic
918823692 1:189294002-189294024 TATGCATCACATTTTGGTGCAGG + Intergenic
918962831 1:191302808-191302830 CAGGGAACTCACTCTGGTGCGGG + Intergenic
922138110 1:222852501-222852523 TAAGAAAACAACTTTGGTGCCGG - Intergenic
922176429 1:223201482-223201504 GAGGCATCCCACTTGGATGCTGG - Intergenic
1070547643 10:77465206-77465228 AAGGCAACGCAGTTTGCTGCAGG - Intronic
1073247178 10:102099347-102099369 TAGGAAACACACTCTGATGCTGG - Intergenic
1074200705 10:111232508-111232530 TAGGAAAGCCAGTTTGGAGCAGG - Intergenic
1074313862 10:112344594-112344616 GAGTCATCCCACTTTGGTTCTGG - Intergenic
1074363603 10:112841037-112841059 TTGGCCTCTCACTTTGGTGCTGG - Intergenic
1077815028 11:5678640-5678662 CAGGTAACCCATTTTGATGCAGG - Intronic
1079176973 11:18151274-18151296 TAAGCAACACACAGTGGTGCTGG + Intronic
1084183450 11:67457873-67457895 GAGGCAAACCACCTTGGTGTGGG + Intronic
1090180582 11:124695696-124695718 TGGGCCATCCACTATGGTGCAGG - Exonic
1100273116 12:93045110-93045132 TAGGCAACCCTCTTGGTTTCTGG + Intergenic
1109352476 13:61202394-61202416 GAGGCAAACAACTTTGGGGCAGG - Intergenic
1111533076 13:89565540-89565562 CAAGCATGCCACTTTGGTGCAGG + Intergenic
1114396089 14:22363029-22363051 GAGGCACCCCACTTTCATGCTGG + Intergenic
1121254152 14:92519343-92519365 TTGGGAGCCCACTTTGGGGCAGG + Intronic
1122060891 14:99136098-99136120 CTGGCAGCCCACTGTGGTGCAGG + Intergenic
1130733557 15:86524482-86524504 TTGGCAACCCATATTGTTGCTGG - Intronic
1130819261 15:87476893-87476915 TAGGCAACTCATTTTGATGTTGG - Intergenic
1145989930 17:29073338-29073360 TAGGCAGCTCATTTTGGGGCAGG - Intergenic
1147245371 17:39116805-39116827 TAGGCAGCCCTCTTTGGACCAGG - Intronic
1148574937 17:48703799-48703821 TAGGCAACCCACTCTCCTGTTGG + Intergenic
1150218570 17:63483497-63483519 AACGAAACCCACTTTGATGCTGG + Intergenic
1150439149 17:65177408-65177430 CATGCATCCCACTATGGTGCTGG + Intronic
1151120137 17:71783853-71783875 TAGACAACCCACTGTGGTTTTGG - Intergenic
1161728816 19:5946448-5946470 GAGGCCCCCCACTTTGTTGCAGG - Intronic
1166070151 19:40382349-40382371 TAGTCCACGCACTTTGGTGGGGG - Intronic
927978136 2:27356097-27356119 GAGGCAACTCACTTTGTTGGAGG - Exonic
929738500 2:44577085-44577107 TAGGAAAGTCACTTTGATGCTGG + Intronic
930946760 2:57084783-57084805 TAGGCCTCCCTCTTGGGTGCCGG - Intergenic
936145270 2:109976479-109976501 TAGGGAACCTAGGTTGGTGCTGG - Intergenic
936199415 2:110394999-110395021 TAGGGAACCTAGGTTGGTGCTGG + Intergenic
937367206 2:121272038-121272060 TAGGCCAGGCACTTCGGTGCAGG - Intronic
939047212 2:137264062-137264084 TAGGCAACTCACCTAGGTGCTGG - Intronic
942828332 2:180207870-180207892 TAGGCAACCCATTCTAGTGTTGG + Intergenic
947000162 2:225445709-225445731 TGAGCAGCCCAATTTGGTGCTGG + Intronic
948676667 2:239600931-239600953 AGGGCACCCCACTTTGCTGCTGG + Intergenic
1169563205 20:6824401-6824423 TAGACAACCCATTTTGGTTCTGG + Intergenic
1171816117 20:29787488-29787510 TAGGCCACCCACTGGAGTGCAGG + Intergenic
1175272260 20:57742593-57742615 TTGGCAACCCACTTGATTGCAGG + Intergenic
1176984232 21:15418053-15418075 CAGGCAACCCTCTTGGGTGGAGG + Intergenic
1178408872 21:32347672-32347694 CTGGCCACCCACTTTAGTGCAGG - Exonic
1180319574 22:11308052-11308074 TAGGCCACCCACTGGAGTGCAGG + Intergenic
1180978937 22:19869649-19869671 TAGGCACCCCAGCTTGGGGCGGG - Intergenic
949683453 3:6541576-6541598 TTGGCCACCCAGTTTTGTGCCGG + Intergenic
949939414 3:9143323-9143345 TAGGCAACCCACTTTGGTGCTGG - Intronic
953410036 3:42685606-42685628 TAGGCCACCCACCATGGCGCTGG + Exonic
960239351 3:115322337-115322359 TAGGCAACCCATTTCAATGCTGG - Intergenic
962066530 3:131987270-131987292 AAGGAAAACCTCTTTGGTGCTGG + Intronic
964411110 3:156398821-156398843 GAGACAACCCACTATGGTGTGGG - Intronic
965093280 3:164189366-164189388 TAGGCAACCCATTTAATTGCAGG + Intergenic
987773482 5:22335864-22335886 GAGGCAAGCCACTTTGGAACTGG + Intronic
997617184 5:135255545-135255567 TAGACAACTCTCTGTGGTGCAGG + Intronic
999187140 5:149719912-149719934 TGGGCAACCTACTTTGTGGCAGG - Intergenic
1001946030 5:175778934-175778956 GAGGGAACCCCCTTTGGTGATGG - Intergenic
1007771094 6:44192897-44192919 TAGTCAACACACTCTTGTGCAGG - Intergenic
1015189985 6:130461783-130461805 TTGGCAACCCACTTAGGGGCTGG + Intergenic
1015724776 6:136289195-136289217 TACTCAACGCACTTTGCTGCGGG + Intronic
1022162471 7:27725546-27725568 GATGCTACTCACTTTGGTGCTGG + Intergenic
1023110540 7:36806560-36806582 TAGGCAACCCTCTGGGATGCTGG + Intergenic
1023874764 7:44280990-44281012 TAGGGACCCCACCTTTGTGCTGG + Intronic
1024376500 7:48644733-48644755 TAACCAAACCACTTTGGAGCAGG + Exonic
1024558098 7:50621118-50621140 TTGGCCACCCCCTTTGGGGCTGG - Intronic
1024724618 7:52178233-52178255 TTGGCCACCCTCTTTGGAGCTGG - Intergenic
1029333349 7:99878639-99878661 TTGGCAACACGTTTTGGTGCTGG + Intronic
1031971021 7:128065305-128065327 TGGGAAACCCACTGTGGTTCAGG + Intronic
1045342299 8:101265903-101265925 TAGGTAATCCACTTGGGTGTTGG + Intergenic
1047021563 8:120780236-120780258 GAGGCAAGCCAATTTGGTGGTGG - Intronic
1049068371 8:140337672-140337694 TAGGCAGCCCATTTTGGTGGGGG - Intronic
1060665202 9:125428493-125428515 TAGTCAAGACACTTTGATGCAGG - Intergenic
1203367805 Un_KI270442v1:273802-273824 TAGGCCACCCACTGGAGTGCAGG + Intergenic
1187996155 X:24929127-24929149 TAGCCAACCCAATTTGGTGCAGG - Intronic
1200870133 Y:8088801-8088823 GAGACACCTCACTTTGGTGCTGG + Intergenic