ID: 949939414

View in Genome Browser
Species Human (GRCh38)
Location 3:9143323-9143345
Sequence TAGGCAACCCACTTTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949939414_949939416 -7 Left 949939414 3:9143323-9143345 CCAGCACCAAAGTGGGTTGCCTA 0: 1
1: 0
2: 1
3: 5
4: 73
Right 949939416 3:9143339-9143361 TTGCCTAGTGCAGTCTGCTCTGG 0: 1
1: 0
2: 0
3: 17
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949939414 Original CRISPR TAGGCAACCCACTTTGGTGC TGG (reversed) Intronic