ID: 949940121

View in Genome Browser
Species Human (GRCh38)
Location 3:9148337-9148359
Sequence GGCACTGCCCCCAAAATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 456}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949940121_949940123 -6 Left 949940121 3:9148337-9148359 CCAGCAATTTTGGGGGCAGTGCC 0: 1
1: 0
2: 2
3: 23
4: 456
Right 949940123 3:9148354-9148376 AGTGCCTCATGGTGTCATGCAGG 0: 1
1: 0
2: 1
3: 19
4: 242
949940121_949940125 9 Left 949940121 3:9148337-9148359 CCAGCAATTTTGGGGGCAGTGCC 0: 1
1: 0
2: 2
3: 23
4: 456
Right 949940125 3:9148369-9148391 CATGCAGGAAAAGAACATCTAGG 0: 1
1: 0
2: 0
3: 21
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949940121 Original CRISPR GGCACTGCCCCCAAAATTGC TGG (reversed) Intronic
901249277 1:7761899-7761921 GCCTCAGCCCCCAAAAGTGCTGG - Intronic
901538032 1:9895875-9895897 GCCTCTGCCTCCAAAAGTGCTGG + Intronic
901826226 1:11863387-11863409 GCCTCTGCCCCCCAAATTGCTGG + Intergenic
902402114 1:16163741-16163763 GCCCCTGCCCCCAAATTTTCAGG + Intergenic
902407507 1:16193132-16193154 GCCTCTGCCCCCCAAAGTGCTGG - Intergenic
903423294 1:23234254-23234276 GCCTCTGCCTCCAAAAGTGCTGG + Intergenic
904323146 1:29709578-29709600 GGCACAGCCCCCACCAGTGCTGG - Intergenic
904373462 1:30065546-30065568 AGCACTGCCCCCCACATTCCTGG + Intergenic
904469152 1:30725285-30725307 GGCTCTGCCCCTAAACTGGCTGG - Intergenic
904669098 1:32148940-32148962 GCCTCAGCCTCCAAAATTGCTGG + Intronic
904713026 1:32445325-32445347 GGTACCGCCCCTAAAATTTCTGG - Intergenic
905820125 1:40982637-40982659 GGCTCTGCCTCCCAAAGTGCTGG + Intronic
906492143 1:46277042-46277064 GCCTCGGCCTCCAAAATTGCAGG + Intronic
907545206 1:55253690-55253712 GCCACAGCCTCCCAAATTGCTGG - Intergenic
907831485 1:58068514-58068536 GCCTCTGCCCCCCAAAGTGCTGG - Intronic
908067700 1:60425458-60425480 GTCTCAGCCCCCAAAAGTGCTGG + Intergenic
909000221 1:70208585-70208607 GCCTCGGCCCCCGAAATTGCGGG + Intronic
909020847 1:70429033-70429055 GCCTCAGCCCCCTAAATTGCTGG + Intronic
909522422 1:76585133-76585155 GCCTCGGCCTCCAAAATTGCTGG - Intronic
910395685 1:86791459-86791481 GCCTCTGCCTCCAAAAGTGCTGG - Intergenic
910907920 1:92201204-92201226 GGCTCAGCCTCCAAAAGTGCTGG - Intergenic
911145278 1:94546286-94546308 GCCTCTGCCCCCCAAAGTGCCGG + Intergenic
911704881 1:100999589-100999611 GCCTCTGCCCCCCAAAGTGCTGG - Intronic
912586811 1:110774400-110774422 GCCACTGCCCCCAAATTTGCTGG - Intergenic
912828170 1:112925282-112925304 ACCACTGCCTCCAAAAGTGCTGG + Intronic
912925316 1:113907721-113907743 GGCTCGGCCCCCCAAAGTGCTGG + Intronic
913059924 1:115195287-115195309 GCCACTGCTCCCAAAATAGAAGG - Intergenic
913708034 1:121447985-121448007 GAGACTGCTCCCAAAATTCCTGG - Intergenic
914793712 1:150902150-150902172 GCCTCTGCCCCCCAAAGTGCTGG - Intergenic
915373627 1:155372961-155372983 GCCTCTGCCCCCTAAAGTGCTGG - Intronic
915373778 1:155374077-155374099 GCCTCTGCCCCCCAAAGTGCTGG - Intronic
916048152 1:161016225-161016247 GCCACGGCCTCCAAAAGTGCTGG - Intronic
916612949 1:166410814-166410836 GCCTCAGCCTCCAAAATTGCTGG + Intergenic
917551836 1:176040557-176040579 GCCTCAGCCTCCAAAATTGCTGG + Intronic
918956224 1:191211367-191211389 GCCTCTGCCCCCCAAATTGCTGG + Intergenic
919747263 1:201016690-201016712 GGCACTGCCCCCAATAATACTGG - Intronic
921870856 1:220138221-220138243 GCCTCTGCCTCCAAAAGTGCTGG - Intronic
922013970 1:221623916-221623938 GTCTCTGCCTCCCAAATTGCTGG + Intergenic
923057026 1:230434457-230434479 GCCTCTGCCCCCCAAAGTGCTGG + Intergenic
923153959 1:231259396-231259418 GCCTCAGCCTCCAAAATTGCTGG - Intronic
923301564 1:232645664-232645686 GCCTCTGCCCCCCAAAGTGCTGG - Intergenic
923450427 1:234112089-234112111 GCCACTGCCTCCCAAAGTGCTGG - Intronic
924102958 1:240622986-240623008 GCCTCTGCCCCCTAAAGTGCTGG + Intergenic
1062773471 10:124370-124392 GCCATTGCCCCCAAAATAGCAGG - Intergenic
1062841340 10:674518-674540 GCCTCTGCCCCCCAAAGTGCTGG - Intronic
1063036432 10:2290721-2290743 AGCAGTGCCCCCAACACTGCAGG + Intergenic
1063036468 10:2290857-2290879 GGCAGTGCCCCCAACACTGCAGG + Intergenic
1063036501 10:2290995-2291017 GGCAGTGCCCCCAACATTGCAGG + Intergenic
1063036532 10:2291133-2291155 AGCAGTGCCCCCAACACTGCAGG + Intergenic
1064067102 10:12191512-12191534 ATCTCTGCCCCCAAAACTGCAGG + Intronic
1064725816 10:18278764-18278786 GCCTCGGCCCCCAAAAGTGCTGG - Intronic
1065346202 10:24750084-24750106 GCCTCGGCCCCCCAAATTGCTGG - Intergenic
1065998617 10:31083594-31083616 GCCTCAGCCCCCAAAGTTGCTGG - Intergenic
1066258146 10:33702203-33702225 GCCTCTGCCTCCCAAATTGCTGG - Intergenic
1066268745 10:33801352-33801374 GCCTCTGCCTCCAAAAGTGCTGG - Intergenic
1068212805 10:53943237-53943259 GGCTCAGCCTCCAAAAGTGCTGG - Intronic
1069485757 10:68822032-68822054 GCCTCTGCCTCCAAAAGTGCTGG - Intergenic
1070006842 10:72432781-72432803 GGCACAGCCTCCAACATTGCGGG + Intronic
1070350690 10:75589501-75589523 GCCTCAGCCACCAAAATTGCTGG - Intronic
1070768413 10:79069268-79069290 GGCTCTGGCCCCAAACTTACCGG - Exonic
1070868551 10:79726538-79726560 GCCTCTGCCTCCCAAATTGCTGG + Intergenic
1070971493 10:80571122-80571144 GCCACTGCCTCCCAAAATGCTGG + Intronic
1071236462 10:83656097-83656119 GCCTCGGCCCCCCAAATTGCTGG + Intergenic
1071337962 10:84617098-84617120 GGCTCAGCCCCCAAAGTTTCAGG - Intergenic
1072573990 10:96683211-96683233 GGCAAATCCCCCAAAATTTCTGG + Intronic
1072590308 10:96823052-96823074 GCCTCTGCCTCCCAAATTGCTGG + Intergenic
1072678331 10:97485695-97485717 GCCTCTGCCTCCCAAATTGCTGG + Intronic
1073020014 10:100435361-100435383 GGCTCTGCCCCACAAAGTGCTGG + Intergenic
1073264215 10:102215131-102215153 GCCTCAGCCCCCCAAATTGCTGG + Intergenic
1073608642 10:104921388-104921410 TGCACTGTCTCCAAAGTTGCAGG - Intronic
1073745626 10:106465285-106465307 GCCACTGCCTCCCAAAGTGCTGG - Intergenic
1074174724 10:110986723-110986745 GCCTCTGCCTCCCAAATTGCTGG + Intronic
1074695545 10:116047080-116047102 GGCACTGCCCCCAGAAATGTTGG - Intergenic
1075454537 10:122576651-122576673 GGAGCTGCCCCCACAATGGCTGG + Exonic
1075455091 10:122579830-122579852 GGAGCTGCCCCCACAATGGCTGG + Exonic
1075455598 10:122582852-122582874 GGAGCTGCCCCCACAATGGCTGG + Exonic
1075456156 10:122586312-122586334 GGAGCTGCCCCCACAATGGCTGG + Exonic
1075457207 10:122592524-122592546 GGAGCTGCCCCCACAATGGCTGG + Exonic
1075457721 10:122595555-122595577 GGAGCTGCCCCCACAATGGCTGG + Exonic
1075458279 10:122599026-122599048 GGAGCTGCCCCCACAATGGCTGG + Exonic
1075458787 10:122602049-122602071 GGAGCTGCCCCCACAATGGCTGG + Exonic
1075459418 10:122606108-122606130 GGAGCTGCCCCCACAATGGCTGG + Exonic
1075460050 10:122610167-122610189 GGAGCTGCCCCCACAATGGCTGG + Exonic
1075460682 10:122614226-122614248 GGAGCTGCCCCCACAATGGCTGG + Intronic
1075461325 10:122618269-122618291 GGAGCTGCCCCCACAATGGCTGG + Exonic
1075506331 10:123025809-123025831 GCCTCTGCCTCCAAAAGTGCTGG - Intronic
1076573799 10:131450666-131450688 GGCTCGGCCTCCAAAAGTGCTGG - Intergenic
1076702185 10:132279508-132279530 GCCACAGCCCCCCAAAGTGCTGG - Intronic
1077162579 11:1120505-1120527 GGCAGTGGCCCCGAGATTGCAGG - Intergenic
1079070085 11:17337188-17337210 GCCTCAGCCCCCTAAATTGCTGG + Intronic
1079805428 11:24924325-24924347 GCCTCTGCCTCCCAAATTGCTGG + Intronic
1080030437 11:27655354-27655376 GCCACTGACCACACAATTGCTGG + Exonic
1080166634 11:29244936-29244958 ACCACTGCCCTCAAAATTGGAGG + Intergenic
1081223877 11:40497154-40497176 GCCTCTGCCTCCCAAATTGCTGG - Intronic
1081908522 11:46684836-46684858 GTCTCTGCCTCCCAAATTGCTGG - Intronic
1082170103 11:48993353-48993375 GCCACTGCCTCCCAAAGTGCTGG + Intergenic
1082607771 11:55263401-55263423 GCCACGGCCTCCAAAAGTGCTGG - Intronic
1082888354 11:58112036-58112058 GCCTCTGCCTCCAAAAGTGCTGG - Intronic
1083028855 11:59573772-59573794 GCCTCTGCCCCCCAAAGTGCTGG - Intergenic
1083038118 11:59659271-59659293 TGCACTGCCCTCATAATAGCTGG + Exonic
1083330800 11:61897572-61897594 GGCCCTGCTCCCAAAACCGCTGG - Exonic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1083871891 11:65493504-65493526 GTCTCTGCCTCCAAAAGTGCTGG - Intergenic
1083985013 11:66208366-66208388 GCCACTGCCTCCCAAAGTGCTGG - Intronic
1084694620 11:70746167-70746189 GGCTCTGCCCCCAGATCTGCTGG - Intronic
1084969159 11:72760473-72760495 GCCTCTGCCTCCAAAAGTGCTGG + Intronic
1086490592 11:87354563-87354585 GCCTCTGCCTCCAAAAGTGCTGG - Intergenic
1086790508 11:91031998-91032020 GGCTCTGCCTCCCAAATTTCTGG + Intergenic
1088192829 11:107244814-107244836 GCCTCTGCCTCCAAAAGTGCTGG - Intergenic
1088357232 11:108956903-108956925 GCCACGGCCTCCAAAAGTGCTGG - Intergenic
1089222609 11:116887153-116887175 GGCTCTGCCTCCCAAAATGCTGG - Intronic
1089246391 11:117123645-117123667 GCCTCTGCCCCCCAAACTGCTGG - Intergenic
1090910874 11:131118217-131118239 GCCACTGCACCCCAAAGTGCTGG + Intergenic
1091492074 12:941565-941587 GGCTCAGCCTCCCAAATTGCTGG + Intronic
1091987185 12:4920347-4920369 GGATCTACCCCCAAGATTGCTGG + Intronic
1092310476 12:7346232-7346254 GTAGATGCCCCCAAAATTGCTGG + Intergenic
1092433282 12:8425944-8425966 GGCATTGCTCCCAATATTGTAGG + Intergenic
1092549206 12:9479367-9479389 GCCTCTGCCTCCAAAAGTGCTGG - Intergenic
1092740713 12:11626726-11626748 GCCTCAGCCCCCAAAAGTGCTGG - Intergenic
1092749225 12:11702854-11702876 GGCTCAGCCTCCAAAATTGTTGG - Intronic
1093909508 12:24729912-24729934 GCCTCTGCCTCCAAAAGTGCTGG - Intergenic
1093996701 12:25650661-25650683 GCCTCAGCCCCCAAAAGTGCTGG + Intergenic
1094133219 12:27097383-27097405 GCCTCTGCCTCCAAAAGTGCTGG + Intergenic
1094503786 12:31043100-31043122 GCCTCTGCCTCCAAAAGTGCTGG + Intergenic
1094617446 12:32048622-32048644 GCCTCTGCCTCCCAAATTGCTGG - Intergenic
1095289588 12:40462775-40462797 GCCTCTGCCTCCAAAAGTGCTGG + Intronic
1096086950 12:48871722-48871744 GCCTCTGCCCCCCAAAGTGCTGG - Intergenic
1096288150 12:50318053-50318075 GCCTCGGCCTCCAAAATTGCTGG + Intergenic
1096394636 12:51256470-51256492 GCCTCTGCCTCCCAAATTGCTGG - Intronic
1096565549 12:52474906-52474928 GGCTCAGCCTCCAAAAGTGCTGG + Intergenic
1096710037 12:53448709-53448731 TGCTCTGCCTCCAAAAGTGCGGG + Intergenic
1097010140 12:55947410-55947432 GGAACAGCCCCCAAAACTGTAGG - Intronic
1097059904 12:56275077-56275099 GGCACTGCCCACCAAATGGCTGG + Exonic
1097063899 12:56306140-56306162 GCCTCAGCCCCCAAAACTGCTGG + Intronic
1097497405 12:60358161-60358183 TGCACCGCCCTGAAAATTGCTGG + Intergenic
1097835127 12:64265270-64265292 CTCTCTGCCCCCAAAATTGAGGG + Intronic
1099915800 12:88891536-88891558 GCCTCGGCCCCCAAAAGTGCTGG + Intergenic
1100011354 12:89957265-89957287 GCCACTGCCTCCCAAAGTGCTGG + Intergenic
1102070754 12:110017157-110017179 GCCCCAGCCCCCCAAATTGCTGG + Intronic
1102278756 12:111601653-111601675 GCCACTGCCTCCCAAAGTGCTGG - Intergenic
1102812638 12:115837751-115837773 GGCACCGTCCCCTGAATTGCTGG + Intergenic
1102936620 12:116902937-116902959 GCCTCAGCCCCCCAAATTGCTGG + Intergenic
1103109215 12:118260241-118260263 GGCTCTGCCTCCCAAAGTGCTGG + Intronic
1104707746 12:130960100-130960122 GGCACTGGCCAATAAATTGCAGG + Intronic
1104713540 12:131002604-131002626 GACACTGCCCCCAAGAAAGCAGG - Intronic
1105333895 13:19445690-19445712 GCCTCTGCCTCCCAAATTGCTGG - Intronic
1105781526 13:23709018-23709040 GCCACAGCCCCCCAAAGTGCTGG + Intergenic
1106532275 13:30604519-30604541 AGCCCTTCCCCCAACATTGCTGG + Intronic
1106742952 13:32666326-32666348 GCCTCTGCCTCCCAAATTGCTGG + Intronic
1106846038 13:33738728-33738750 GGCTCAGCCTCCCAAATTGCTGG - Intergenic
1107759253 13:43659237-43659259 GCCTCTGCCCCCCAAAATGCTGG - Intronic
1109380847 13:61557985-61558007 GGCGCTGCTCCCAAGATGGCGGG + Intergenic
1109564669 13:64096384-64096406 AGCTCTGCCTCCAAAATTGCTGG - Intergenic
1109651458 13:65332621-65332643 GTCTCTGCCTCCAAAAGTGCTGG - Intergenic
1110051745 13:70910678-70910700 GCCACAGCCTCCCAAATTGCTGG + Intergenic
1111242578 13:85495032-85495054 GGCCCTGCCCCAAGAAATGCTGG + Intergenic
1111437806 13:88235071-88235093 GCCTCAGCCTCCAAAATTGCTGG - Intergenic
1111463555 13:88577252-88577274 GGCCCCGCCTCCAATATTGCAGG + Intergenic
1111532548 13:89558031-89558053 GCCTCAGCCCCCAAAAGTGCTGG - Intergenic
1111616873 13:90670918-90670940 ACCTCTGCCCCCAAAAGTGCTGG + Intergenic
1111874064 13:93870867-93870889 GCCTCTGCCTCCCAAATTGCTGG + Intronic
1112009952 13:95285433-95285455 GCCTCAGCCCCCAAAATAGCTGG - Intronic
1112500985 13:99943041-99943063 GCCTCAGCCCCCAAAATTTCTGG - Intergenic
1112609229 13:100939713-100939735 GCCTCGGCCCCCCAAATTGCTGG - Intergenic
1113828543 13:113275956-113275978 GCCTCTGCCTCCCAAATTGCTGG + Intergenic
1115212883 14:30985352-30985374 GCCTCGGCCCCCAAAAGTGCTGG - Intronic
1118451797 14:65909609-65909631 GTGACTCCACCCAAAATTGCAGG + Intergenic
1119122559 14:72092629-72092651 GCCTCAGCCCCCCAAATTGCTGG + Intronic
1120830245 14:88991572-88991594 AGCACTGCCCCCACAAGTCCAGG + Intergenic
1120891839 14:89498468-89498490 GCCTCTGCCTCCAAAAGTGCTGG + Intronic
1121346950 14:93143263-93143285 GCCTCTGCCTCCCAAATTGCTGG - Intergenic
1121477136 14:94219313-94219335 TGATCTGCCCCCAAAAGTGCTGG + Intronic
1121480782 14:94270668-94270690 GTCTCTGCCTCCCAAATTGCTGG - Intronic
1121923381 14:97904508-97904530 GCCTCTGCCTCCCAAATTGCTGG - Intergenic
1122663098 14:103310942-103310964 GGCACAGCCCACAAAACAGCCGG - Intergenic
1125795353 15:42400479-42400501 GGCTCTGCCTCCCAAAGTGCTGG - Intronic
1126320848 15:47421244-47421266 GGCACTGCCTCAGAAACTGCAGG - Intronic
1126367099 15:47905394-47905416 GCCTCTGCCTCCCAAATTGCTGG - Intergenic
1126808513 15:52377818-52377840 GCCACGGCCTCCAAAAGTGCTGG + Intronic
1128020294 15:64384491-64384513 GCCTCTGCCTCCCAAATTGCTGG - Intronic
1128274730 15:66343747-66343769 GCCTCGGCCCCCAAAAGTGCTGG - Intronic
1128344528 15:66845166-66845188 GGCACTGCCCCACACATTGAAGG + Intergenic
1128952123 15:71896528-71896550 GCCTCTGCCCCCCAAATTGCTGG - Intronic
1129598229 15:76981472-76981494 GTCTCAGCCCCCTAAATTGCTGG + Intergenic
1130558186 15:84937948-84937970 GTCTCTGCCTCCAAAAGTGCTGG - Intronic
1131084065 15:89560541-89560563 GTCACTGCCTCCCAAAGTGCTGG - Intergenic
1131132410 15:89908732-89908754 GCCACTGCCTCCCAAAGTGCTGG - Intronic
1131240373 15:90736506-90736528 GTCTCTGCCTCCCAAATTGCTGG + Intronic
1131414454 15:92241604-92241626 GCCTCTGCCTCCCAAATTGCTGG - Intergenic
1132739597 16:1404942-1404964 GTCTCTGCCCCCCAAAGTGCTGG - Intronic
1132763444 16:1522589-1522611 GCCTCGGCCCCCCAAATTGCTGG - Intronic
1133017231 16:2949661-2949683 GGCACTCCCCCCACAATTACAGG - Exonic
1133334827 16:5000385-5000407 GCCTCTGCCCCCCAAAATGCTGG + Intronic
1133709459 16:8387203-8387225 GCCTCAGCCCCCAAAAGTGCTGG + Intergenic
1133888032 16:9850183-9850205 GGCACTGCCTCCAGAGATGCAGG - Intronic
1135021121 16:18963950-18963972 GCCTCTGCCTCCCAAATTGCTGG + Intergenic
1135398418 16:22148519-22148541 GCCTTGGCCCCCAAAATTGCTGG - Intronic
1135571590 16:23553505-23553527 GCCTCTGCCTCCAAAAGTGCTGG - Intronic
1135672065 16:24383841-24383863 GTCTCTGCCCCCAAAAGTGCTGG + Intergenic
1135765789 16:25176809-25176831 GGCTCGGCCCCCCAAAGTGCTGG + Intronic
1136225163 16:28855468-28855490 GTCTCTGCCTCCCAAATTGCTGG + Intronic
1136242958 16:28955836-28955858 GGCTCAGCCTCCAAAAGTGCTGG + Intronic
1136538504 16:30914470-30914492 CCCACTGCCTCCTAAATTGCTGG - Intergenic
1136538801 16:30916596-30916618 CCCACTGCCTCCTAAATTGCTGG - Intergenic
1136649438 16:31655237-31655259 AGCTCAGCCCCCCAAATTGCTGG - Intergenic
1136669533 16:31843919-31843941 GGCTCTGCCTCCCAAAGTGCTGG - Intergenic
1138230865 16:55335118-55335140 GGCTCTGCCTCCCAAAGTGCTGG - Intergenic
1139090008 16:63634154-63634176 GCCTCGGCCTCCAAAATTGCTGG + Intergenic
1139798363 16:69500906-69500928 GCCTCTGCCTCCCAAATTGCTGG + Intergenic
1140316283 16:73901250-73901272 GCCACGGCCTCCAAAAGTGCTGG + Intergenic
1140467631 16:75195215-75195237 GCCCCAGCCTCCAAAATTGCTGG - Intergenic
1140684459 16:77419690-77419712 AAGACAGCCCCCAAAATTGCTGG - Intronic
1141040097 16:80665768-80665790 GGCACTGTCACCAAGATGGCAGG + Intronic
1141268868 16:82521225-82521247 AGAACTGCCCCCAAAATGCCAGG + Intergenic
1141456647 16:84146465-84146487 GCCTCTGCCTCCCAAATTGCTGG - Intronic
1141682037 16:85550543-85550565 GGCACTGCTCCCCAAATTCCAGG - Intergenic
1142417538 16:89950728-89950750 GCCTCTGCCTCCCAAATTGCTGG - Intronic
1142674142 17:1503133-1503155 GTCTCTGCCTCCCAAATTGCTGG + Intronic
1142748262 17:1971711-1971733 GCCTCTGCCCCCCAAAGTGCTGG - Intronic
1144577880 17:16440738-16440760 GGCTCAGCCCCCAAAGTAGCTGG - Intergenic
1144694191 17:17290494-17290516 GCCTCTGCCTCCCAAATTGCTGG + Intergenic
1144825302 17:18102371-18102393 GCCACAGCCCCCCAAAGTGCTGG - Intronic
1145778102 17:27543460-27543482 GACACAGCCCCCAGAACTGCAGG - Intronic
1146400919 17:32499384-32499406 GCCTCTGCCTCCCAAATTGCTGG - Intronic
1147221642 17:38936298-38936320 GCCTCAGCCTCCAAAATTGCTGG + Intergenic
1147299946 17:39518414-39518436 GCCTCAGCCCCCCAAATTGCTGG + Intronic
1147367418 17:39968287-39968309 GCCTCAGCCCCCAAAAGTGCTGG + Intronic
1149560106 17:57602602-57602624 GCCTCTGCCTCCAAAAGTGCTGG + Intronic
1150917852 17:69454638-69454660 GCCTCTGCCTCCAAAACTGCTGG + Intronic
1152201401 17:78948641-78948663 GCCTCAGCCCCCAAAAGTGCTGG - Intergenic
1152595565 17:81236143-81236165 GGGACTGCCCCCAAGCCTGCGGG + Intronic
1152709590 17:81864442-81864464 GGTCCTGCCCCCAAGAATGCAGG + Intergenic
1152915879 17:83035505-83035527 TGCACTGCCACCAAAAATGTGGG + Intronic
1153029292 18:698869-698891 GCCTCGGCCACCAAAATTGCTGG + Intronic
1153245892 18:3072601-3072623 GCCTCTGCCTCCCAAATTGCTGG + Intronic
1155204923 18:23550258-23550280 GCCTCTGCCTCCCAAATTGCTGG + Intronic
1158093771 18:53746786-53746808 GCCTCTGCCTCCCAAATTGCTGG - Intergenic
1159361764 18:67414546-67414568 GACATTGCCCCCAAAATTACTGG - Intergenic
1159516745 18:69469157-69469179 GGCCCTTGCCCCACAATTGCTGG - Intronic
1159534135 18:69693807-69693829 GCCTCTGCCTCCTAAATTGCTGG - Intronic
1160671171 19:364428-364450 GCCTCTGCCTCCAAAAGTGCTGG - Intronic
1161004551 19:1928366-1928388 GCCTCTGCCTCCCAAATTGCTGG - Intergenic
1161084415 19:2328029-2328051 GCCTCAGCCCCCTAAATTGCTGG - Intronic
1161092607 19:2369686-2369708 GCCACAGCCTCCAAAAGTGCTGG + Intergenic
1162056475 19:8067060-8067082 GCCACAGCCTCCAAAAGTGCTGG - Intronic
1162272217 19:9625506-9625528 GCCTCTGCCTCCAAAAGTGCTGG - Intronic
1162357178 19:10193610-10193632 GCCACTGCCTCCCAAATTGCTGG + Intronic
1163385871 19:17000202-17000224 GCCTTTGCCCCCAAAAGTGCTGG - Intronic
1163459474 19:17428041-17428063 GCCTCAGCCCCCAAAAGTGCTGG - Intronic
1163499501 19:17667722-17667744 GCCACAGCCTCCCAAATTGCTGG + Intronic
1163825530 19:19522053-19522075 GCCTCTGCCCCCCAAAGTGCTGG - Intronic
1163936941 19:20455353-20455375 GCCACAGCCTCCCAAATTGCTGG + Intergenic
1164001193 19:21100956-21100978 GCCTCGGCCCCCAAAAGTGCTGG + Intronic
1164681098 19:30134253-30134275 GCCTCTGCCCCCTAAAGTGCTGG - Intergenic
1165486772 19:36101204-36101226 GGCACTGCAGCCAGTATTGCAGG + Exonic
1166048719 19:40245287-40245309 GCCTCTGCCTCCTAAATTGCAGG - Intronic
1166244072 19:41513481-41513503 GACATTGCTCCCAATATTGCAGG - Intergenic
1166335066 19:42100848-42100870 GGCTCGGCCTCCCAAATTGCTGG - Intronic
1166570346 19:43791949-43791971 GCCTCTGCCTCCAAAATTGCTGG + Intergenic
1166726031 19:45028269-45028291 GGCTGGGCCCCCAAAAGTGCTGG + Intronic
1166938861 19:46350968-46350990 GGCTCTGCCCCCAGGATTTCTGG - Intronic
1167190619 19:47986487-47986509 GGCTCAGCCTCCAAAAGTGCTGG - Intronic
1168095545 19:54112672-54112694 GCCTCAGCCCCCAAAATAGCTGG - Intronic
1168341055 19:55623281-55623303 GGCTCTGCCTCCTAAAGTGCTGG + Intronic
1168656851 19:58135981-58136003 GCCTCTGCCCCCTAAAGTGCTGG - Intronic
925445203 2:3921198-3921220 GGCTCTGCGCCCAGCATTGCCGG - Intergenic
925967549 2:9079922-9079944 GCCTCAGCCCCCAAAAGTGCTGG - Intergenic
929860160 2:45669894-45669916 GCCTCAGCCCCCAAAATAGCTGG - Intronic
931342033 2:61411133-61411155 GCCTCTGCCCCCCAAAGTGCTGG - Intronic
931751662 2:65336103-65336125 GCCTCAGCCCCCAAAAGTGCTGG - Intronic
932608454 2:73180236-73180258 GGCAATGCCCACAAAAGAGCAGG + Intergenic
932789606 2:74642965-74642987 GGCTCTGCCACCCAAAATGCTGG + Intronic
932945804 2:76229033-76229055 GCCTCGGCCCCCCAAATTGCTGG - Intergenic
933119744 2:78521887-78521909 GCCACTTCTCCCAAAATTGCAGG + Intergenic
934667272 2:96181219-96181241 GTCTCAGCCCCCAAAACTGCTGG - Intergenic
936278004 2:111117332-111117354 GGCTTTGCCCCCAAATTAGCCGG - Intronic
936643381 2:114341826-114341848 GCCTCAGCCCCCAAAAGTGCTGG - Intergenic
938044832 2:128109139-128109161 GCCTCTGCCCCGCAAATTGCTGG + Intronic
938207143 2:129433696-129433718 GATACTGCCTCCATAATTGCAGG + Intergenic
938227471 2:129628224-129628246 GCCTCAGCCCCTAAAATTGCTGG + Intergenic
938308581 2:130270130-130270152 CTCCATGCCCCCAAAATTGCAGG - Intergenic
938416556 2:131107775-131107797 GCCTCTGCCCCCCAAATAGCTGG + Intronic
938901324 2:135800770-135800792 GGCACTGCCCCCTACATTGTTGG - Exonic
938920548 2:135990561-135990583 GACAATCCCCCCAAAAATGCAGG - Intergenic
939477557 2:142706290-142706312 GCCTCTGCCTCCCAAATTGCTGG - Intergenic
939618919 2:144394168-144394190 GCCTCTGCCTCCAAAAGTGCTGG + Intronic
940224325 2:151385644-151385666 GCCTCTGCCTCCCAAATTGCTGG - Intergenic
940892579 2:159049227-159049249 AGCACTGCCCCTAAATTTACAGG - Intronic
943150804 2:184110153-184110175 GCCTCTGCCTCCAAAAGTGCTGG - Intergenic
943367146 2:186977190-186977212 GCCTCGGCCCCCAAAAGTGCTGG + Intergenic
943416838 2:187617967-187617989 GGAACTGCCCTCATAATTACAGG + Intergenic
946234375 2:218314170-218314192 GCCTCTGCCTCCCAAATTGCTGG + Intronic
946242605 2:218366236-218366258 GCCACAGCCACCAAAATAGCTGG + Intronic
946663541 2:222026693-222026715 CGCTCAGCCTCCAAAATTGCTGG - Intergenic
947162991 2:227233260-227233282 GCCACTGCCTCCCAAAGTGCTGG + Intronic
948648009 2:239420941-239420963 GCCTCTGCCTCCAAAAGTGCTGG - Intergenic
1169956082 20:11104462-11104484 GCCTCTGCCTCCCAAATTGCCGG - Intergenic
1170966141 20:21073381-21073403 GCCTCTGCCCCCCAAAGTGCTGG + Intergenic
1171494226 20:25543904-25543926 GGCGCTGCCTCCCAAAGTGCTGG + Intronic
1172541307 20:35719279-35719301 GACTCGGCCCCCAAAAGTGCAGG + Intronic
1173286552 20:41676569-41676591 GGAAGTCCCCCCAAAACTGCTGG + Intergenic
1173490299 20:43474197-43474219 GCCTCTGCCCCCTAAAGTGCTGG - Intergenic
1176739158 21:10582980-10583002 GCCTCTGCCTCCCAAATTGCTGG + Intronic
1178517208 21:33258053-33258075 GGCTCGGCCCCCCAAAGTGCTGG - Intronic
1179287112 21:39986928-39986950 GCCTCTGCCCCCCAAAGTGCTGG - Intergenic
1179600853 21:42476397-42476419 GGGACAGCCCCCAGAATGGCCGG - Intronic
1179675853 21:42981672-42981694 GCCACAGCCCCCAAAGTAGCTGG + Intronic
1180615477 22:17123079-17123101 GCCTCTGCCTCCCAAATTGCTGG - Intronic
1181504587 22:23343728-23343750 TGCACTGCTCCCAAAATAACAGG - Intergenic
1181842330 22:25674698-25674720 GCCTCTGCCTCCAAAAGTGCTGG - Intronic
1181923992 22:26343091-26343113 GGCACTGCCCAGAAAAGAGCGGG - Intronic
1182216954 22:28726890-28726912 TTCACTGCCCCCAAGAATGCTGG + Intronic
1182249707 22:28990433-28990455 GGCACGGCCTCCCAAAGTGCTGG - Intronic
1182590470 22:31375771-31375793 GCCTCGGCCTCCAAAATTGCTGG + Intergenic
1183337475 22:37258569-37258591 GCCTCTGCCTCCCAAATTGCTGG + Intergenic
1183844347 22:40528486-40528508 GCCTCTGCCTCCAAAAGTGCTGG - Intronic
1184467699 22:44678562-44678584 GCCTCTGCCCCCCAAAGTGCTGG + Intronic
1185299832 22:50073479-50073501 GCCTCGGCCCCCAAAAGTGCTGG - Intronic
949351093 3:3125986-3126008 GCCTCGGCCCCCAAAAGTGCCGG - Intronic
949748745 3:7326596-7326618 GCCTCGGCCCCCAAAAGTGCTGG - Intronic
949940121 3:9148337-9148359 GGCACTGCCCCCAAAATTGCTGG - Intronic
950463416 3:13138977-13138999 GGCTCTGCCCCCACAGTTCCGGG + Intergenic
951925530 3:27905397-27905419 GGCTCTGCCTCCCAAAGTGCTGG - Intergenic
953477569 3:43218674-43218696 GGCATTGCCCCTTAAGTTGCAGG + Intergenic
954011420 3:47642794-47642816 GCCTCTGCCTCCCAAATTGCTGG - Intronic
954018973 3:47721759-47721781 GCCCCTGCCTCCAAAAGTGCTGG - Intronic
954198318 3:49009129-49009151 GCCTCAGCCCCCCAAATTGCTGG + Intronic
955246049 3:57226125-57226147 GCCACGGCCTCCCAAATTGCTGG + Intronic
955318073 3:57955279-57955301 GCCTCAGCCTCCAAAATTGCTGG - Intergenic
956845790 3:73181454-73181476 GCCTCTGCCTCCAAAAGTGCTGG + Intergenic
958501729 3:94919317-94919339 GCCTCAGCCCCCAAAAGTGCTGG + Intergenic
960666213 3:120111563-120111585 GCCTCTGCCTCCAAAAGTGCTGG - Intergenic
960792363 3:121447410-121447432 GTCTCTGCCTCCCAAATTGCTGG + Intronic
960997720 3:123350847-123350869 GGCACAGCCCCAAAAATGGAAGG + Intronic
961189886 3:124950708-124950730 GGCTCGGCCTCCAAAAGTGCTGG - Intronic
961279159 3:125752010-125752032 GGCACAGCCTCCCAAAGTGCTGG - Intergenic
962816226 3:139003591-139003613 GACACAGCCTCCAAAAGTGCTGG - Intergenic
967749019 3:193092636-193092658 GCCACAGCCTCCCAAATTGCTGG - Intergenic
968147150 3:196309164-196309186 GCCTCAGCCTCCAAAATTGCTGG - Intronic
968283283 3:197493213-197493235 GACACTGCCTCCCACATTGCAGG + Intergenic
969082028 4:4626497-4626519 GCCTCGGCCCCCCAAATTGCTGG + Intergenic
969317050 4:6388650-6388672 GGCTCGGCCCCCCAAAGTGCTGG - Intronic
969991592 4:11269713-11269735 GCCACAGCCTCCCAAATTGCTGG + Intergenic
971210572 4:24611991-24612013 GCCCCTGCCTCCCAAATTGCTGG - Intergenic
972966629 4:44518535-44518557 GCCTCGGCCCCCAAAAGTGCTGG + Intergenic
973312752 4:48727374-48727396 CCCACTGCCCCCCAAATTGGAGG + Intronic
974344880 4:60666495-60666517 GTCTCAGCCCCCCAAATTGCTGG + Intergenic
974623709 4:64395167-64395189 GTCTCAGCCCCCCAAATTGCTGG + Intronic
976314452 4:83644160-83644182 GCCTCTGCCTCCCAAATTGCTGG - Intergenic
976754426 4:88482878-88482900 GGCTCTGCCTCCCAAAGTGCTGG + Intronic
978103657 4:104874904-104874926 GGCTCAGCCTCCAAAAGTGCTGG - Intergenic
979235999 4:118401036-118401058 GGTACTGCCCTCAAAAGTGAGGG + Intergenic
979371692 4:119895872-119895894 GCCACTGCCTCCCAAAGTGCTGG + Intergenic
980318009 4:131230777-131230799 GCCACAGCCTCCCAAATTGCTGG - Intergenic
980710915 4:136566247-136566269 GCCTCTGCCTCCCAAATTGCTGG - Intergenic
982783684 4:159518091-159518113 GCCTCGGCCCCCAAAATTGCTGG - Intergenic
983261043 4:165456986-165457008 GCCACTGCCTCCCAAAGTGCTGG + Intronic
983952251 4:173655804-173655826 GCCTCTGCCTCCAAAAGTGCTGG + Intergenic
985467557 5:12206-12228 GGCACTGCCCCCAACATCTGTGG + Intergenic
986871238 5:12049129-12049151 GCCTCAGCCTCCAAAATTGCTGG + Intergenic
989045431 5:37269105-37269127 GCCTCTGCCTCCCAAATTGCTGG - Intergenic
989641733 5:43589561-43589583 GGTACTGCCCGTAAAAATGCAGG + Intergenic
989791344 5:45405655-45405677 GGCTCTGCCTCCCAAAGTGCTGG + Intronic
990570714 5:57075566-57075588 GCCTCAGCCCCCAAAATTGCTGG - Intergenic
992306285 5:75442468-75442490 GCCACTGCCTCCCAAAGTGCTGG + Intronic
992806012 5:80338820-80338842 GTCTCTGCCCCCCAAAGTGCTGG - Intergenic
992996161 5:82335796-82335818 GTCTCAGCCCCCTAAATTGCTGG + Intronic
993908532 5:93651383-93651405 GCCACTGCCTCCCAAAGTGCTGG + Intronic
994584894 5:101694612-101694634 GCCTCTGCCTCCCAAATTGCTGG - Intergenic
996071725 5:119138587-119138609 GCCACGGCCTCCAAAAGTGCTGG - Intronic
996076342 5:119199135-119199157 GTCACAGCCCCCCAAAGTGCTGG + Intronic
997040000 5:130241819-130241841 GCCTCAGCCACCAAAATTGCTGG - Intergenic
997573660 5:134955555-134955577 GCCTCTGCCTCCAAAAGTGCTGG + Intronic
999219679 5:149964240-149964262 GCCACGGCCTCCCAAATTGCTGG - Intronic
1000152309 5:158515345-158515367 GCCTCGGCCCCCCAAATTGCTGG - Intergenic
1000311929 5:160053341-160053363 GGCTCAGCCTCCCAAATTGCTGG - Intronic
1001094635 5:168766694-168766716 GGCACTGCCCCTAACATGGCAGG - Intronic
1001638047 5:173226913-173226935 GCCTCAGCCCCCAAAAGTGCTGG + Intergenic
1001979020 5:176025202-176025224 GCCTCTGCCTCCAAAAGTGCTGG + Intronic
1002238397 5:177818562-177818584 GCCTCTGCCTCCAAAAGTGCTGG - Intergenic
1002721538 5:181264296-181264318 GCCTCAGCCTCCAAAATTGCTGG - Intergenic
1003021582 6:2514400-2514422 GCCTCGGCCCCCAAAAGTGCTGG + Intergenic
1003909396 6:10729525-10729547 GCCTCTGCCTCCCAAATTGCTGG - Intronic
1004094377 6:12538418-12538440 GCCTCTGCCCCCTAAAGTGCTGG + Intergenic
1005684805 6:28243912-28243934 GCCACAGCCTCCCAAATTGCTGG + Intergenic
1005714729 6:28535953-28535975 GCCTCTGCCTCCAAAAGTGCTGG - Intergenic
1006862440 6:37181748-37181770 GCCACTGCCTCCCAAAGTGCTGG + Intergenic
1006952942 6:37840210-37840232 GCCTCAGCCCCCAAAATAGCTGG + Intronic
1007753883 6:44086309-44086331 GCCTTTGCCCCCAAAAGTGCTGG - Intergenic
1008834844 6:55813538-55813560 GCCTCGGCCCCCAAAAGTGCTGG - Intronic
1009363943 6:62843765-62843787 GACATTACTCCCAAAATTGCTGG + Intergenic
1010579890 6:77582602-77582624 GTCTCTGCCACCAAAAGTGCTGG - Intergenic
1010641785 6:78337460-78337482 GGCCCTGCCTCCCAAAGTGCTGG + Intergenic
1011036828 6:82986221-82986243 GCCACGGCCTCCAAAAGTGCTGG - Intronic
1011285590 6:85719121-85719143 GCCTCGGCCCCCAAAAGTGCTGG - Intergenic
1012394807 6:98784418-98784440 GCCTCTGCCTCCCAAATTGCTGG + Intergenic
1012950837 6:105516062-105516084 TGCACTGCCTCCAACATTTCTGG + Intergenic
1013042732 6:106452155-106452177 GCCTCTGCCTCCAAAAATGCTGG - Intergenic
1013067608 6:106698977-106698999 GGCTCGGCCTCCAAAAGTGCTGG + Intergenic
1013544186 6:111139547-111139569 GCCTCGGCCCCCAAAAGTGCTGG + Intronic
1013764154 6:113554696-113554718 GGCTCAGCCTCCCAAATTGCTGG + Intergenic
1014056209 6:117017781-117017803 GCCTCAGCCCCCCAAATTGCTGG + Intergenic
1014094599 6:117446131-117446153 GCCTCTGCCTCCAAAAGTGCTGG - Intronic
1015468947 6:133580484-133580506 GCCACTGCCTCCCAAAGTGCTGG + Intergenic
1015618059 6:135100172-135100194 GCCACGGCCTCCAAAAGTGCTGG + Intronic
1015971699 6:138748960-138748982 GGCACTGAGCACAACATTGCTGG - Intergenic
1017657958 6:156648135-156648157 GGCACTGCCCCATCAGTTGCAGG - Intergenic
1019512482 7:1424669-1424691 GACACAGCCCCCAACTTTGCTGG - Intergenic
1020824556 7:13010739-13010761 GCCTCTGCCCCCCAAAGTGCTGG - Intergenic
1021266456 7:18530019-18530041 GCCACACCCCCCCAAATTGCTGG - Intronic
1024806627 7:53149095-53149117 GCCTCTGCCTCCCAAATTGCTGG - Intergenic
1025223312 7:57134922-57134944 GCCTCTGCCTCCCAAATTGCCGG + Intronic
1025634117 7:63306581-63306603 GCCTCTGCCTCCCAAATTGCCGG + Intergenic
1025648581 7:63441585-63441607 GCCTCTGCCTCCCAAATTGCCGG - Intergenic
1026271142 7:68838026-68838048 GCCTCTGCCTCCCAAATTGCTGG - Intergenic
1027160022 7:75795698-75795720 GCCTCGGCCCCCAAAAGTGCTGG + Intergenic
1027986432 7:85297055-85297077 GCCTCAGCCTCCAAAATTGCTGG + Intergenic
1028314942 7:89389313-89389335 GCCTCTGCCCCCCAAAATGCTGG + Intergenic
1029343647 7:99963546-99963568 GCCTCTGCCTCCAAAAGTGCAGG + Intergenic
1029610395 7:101623443-101623465 GCCTCTGCCTCCCAAATTGCTGG - Intronic
1029941280 7:104483076-104483098 GGCACTGACTCCAAAATGGATGG + Intronic
1030845854 7:114410060-114410082 GGAACTGCCCCCCAAATAACAGG - Intronic
1033081797 7:138305812-138305834 GCCTCTGCCTCCAAAAGTGCTGG - Intergenic
1033509781 7:142048395-142048417 GGCTCGGCCCCCCAAAGTGCTGG + Intronic
1034180222 7:149131436-149131458 GCCTCTGCCTCCCAAATTGCTGG - Intronic
1035386886 7:158478986-158479008 GCCACTGCCCCCAACAATGTGGG - Intronic
1037724857 8:21474662-21474684 GCCTCTGCCTCCCAAATTGCTGG + Intergenic
1039288808 8:36071794-36071816 GCCACAGCCTCCCAAATTGCTGG - Intergenic
1040924957 8:52670735-52670757 GGCTCTGCCTCCCAAAGTGCTGG - Intronic
1041097194 8:54361705-54361727 GGCACTGCCCCAAACACTGGGGG + Intergenic
1043164650 8:76888655-76888677 GCCTCGGCCTCCAAAATTGCAGG - Intergenic
1043402951 8:79901807-79901829 GTCACTGTCCCCAAATTTCCAGG + Intergenic
1044432324 8:92122918-92122940 GCCTCTGCCTCCCAAATTGCTGG + Intergenic
1044651226 8:94497759-94497781 GCCTCAGCCCCCAAAAGTGCTGG - Intronic
1044941074 8:97344558-97344580 GGCCCTGCCCCCAGAAATTCTGG + Intergenic
1045513352 8:102832887-102832909 GGCTCTGCCTCCCAAAGTGCTGG + Intronic
1046772271 8:118127828-118127850 GCCTCTGCCTCCAAAAGTGCTGG - Intergenic
1047895908 8:129365931-129365953 GGCATGGCCTCCAAAACTGCTGG + Intergenic
1048125742 8:131633967-131633989 GGCACTTCCAACAAAATTGGAGG + Intergenic
1048364395 8:133725788-133725810 GTCTCTGCCACCCAAATTGCTGG - Intergenic
1048608621 8:135997334-135997356 ACCACTGCCCCCAAGATTGGAGG + Intergenic
1048778762 8:137978427-137978449 GCCTCGGCCCCCAAAAGTGCTGG - Intergenic
1049325929 8:142021422-142021444 GCCACTGCCCCCTCAAGTGCTGG - Intergenic
1049473717 8:142787421-142787443 GGCGCTGCCCCCAACGTAGCAGG - Intergenic
1049706093 8:144043242-144043264 GCCTCTGCCTCCAAAAGTGCTGG + Intronic
1050721799 9:8599864-8599886 GCCTCGGCCCCCCAAATTGCTGG + Intronic
1051448468 9:17167874-17167896 GGCACAGCCCCCAGAAGTGCTGG + Intronic
1052021390 9:23529768-23529790 GGCACTGAGCCCAAATGTGCTGG + Intergenic
1052024052 9:23555712-23555734 CCCACTGCCCCCAAAATTAAGGG + Intergenic
1054148780 9:61584036-61584058 GCCTCAGCCACCAAAATTGCTGG - Intergenic
1054900931 9:70369029-70369051 ATCTCTGCCTCCAAAATTGCTGG - Intergenic
1055040747 9:71868936-71868958 GCCACGGCCTCCAAAAGTGCTGG + Intronic
1055058535 9:72045850-72045872 TGCCCTGGCACCAAAATTGCTGG + Intergenic
1057232702 9:93334409-93334431 GCCACTGCCTCCCAAAGTGCTGG + Intronic
1057711442 9:97449334-97449356 GGCTCAATCCCCAAAATTGCTGG + Intronic
1057755058 9:97827360-97827382 GCCTCAGCCCCCAAAAGTGCTGG - Intergenic
1057934308 9:99223639-99223661 GTCTCTGCCTCCAAAAGTGCTGG + Intronic
1058020233 9:100078503-100078525 GCCACTGCCTCCCAAAGTGCTGG - Intronic
1058443051 9:105028204-105028226 GCCACTGCCTCCCAAAGTGCTGG - Intergenic
1058709442 9:107666757-107666779 GCCTCTGCCTCCCAAATTGCTGG - Intergenic
1059304214 9:113341166-113341188 GCCACAGCCTCCAAAAGTGCTGG + Intergenic
1060377402 9:123129105-123129127 GCCACAGCCTCCAAAATTGCTGG - Intronic
1061338249 9:129957800-129957822 GCCTCTGCCTCCCAAATTGCTGG + Intronic
1061481555 9:130899816-130899838 GCCTCTGCCTCCCAAATTGCTGG - Intergenic
1187177725 X:16911734-16911756 GCCTCTGCCTCCAAAAGTGCTGG + Intergenic
1187907700 X:24083139-24083161 GCCTCTGCCCCCCAAAGTGCTGG + Intergenic
1188492493 X:30752341-30752363 GCCTCTGCCCCCCAAAGTGCTGG + Intergenic
1189187226 X:39064924-39064946 GCCTCTGCCCCCCAAAGTGCTGG + Intergenic
1189485987 X:41432450-41432472 GCCACAGCCTCCAAAAGTGCTGG - Intergenic
1191976104 X:66873285-66873307 GCCTCTGCCTCCTAAATTGCTGG - Intergenic
1194091235 X:89583361-89583383 AGCGCTTCCCCCAAAATTGTGGG + Intergenic
1196187229 X:112757467-112757489 GCCACTGCCTCCCAAAGTGCTGG + Intergenic
1197760474 X:130024484-130024506 GGCTCTGTCCCCAAGATTGGTGG + Intronic
1198174465 X:134141889-134141911 GGCTCTGCCTCCCAAAGTGCTGG - Intergenic
1198578945 X:138042241-138042263 GCCACAGCCTCCAAAAATGCTGG - Intergenic
1199730641 X:150628928-150628950 GCCTCTGCCCCCTAAAGTGCTGG + Intronic
1199994434 X:153011696-153011718 GCCTCTGCCTCCAAAAGTGCTGG + Intergenic
1201769794 Y:17609080-17609102 GCCATGGCCTCCAAAATTGCTGG + Intergenic
1201831760 Y:18296907-18296929 GCCATGGCCTCCAAAATTGCTGG - Intergenic
1202083555 Y:21110739-21110761 GCCTCTGCCTCCCAAATTGCTGG + Intergenic
1202340821 Y:23864424-23864446 GACACTGTCCTCCAAATTGCAGG - Intergenic
1202529945 Y:25805662-25805684 GACACTGTCCTCCAAATTGCAGG + Intergenic