ID: 949940255

View in Genome Browser
Species Human (GRCh38)
Location 3:9149249-9149271
Sequence CAGATGGGCTCTCTAGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949940255_949940259 -2 Left 949940255 3:9149249-9149271 CCTGAAGCTAGAGAGCCCATCTG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 949940259 3:9149270-9149292 TGGCACATGTGTCTTCCCCTAGG 0: 1
1: 0
2: 1
3: 13
4: 166
949940255_949940263 19 Left 949940255 3:9149249-9149271 CCTGAAGCTAGAGAGCCCATCTG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 949940263 3:9149291-9149313 GGTCCCAGTTAGTTGAGAGCTGG 0: 1
1: 0
2: 1
3: 27
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949940255 Original CRISPR CAGATGGGCTCTCTAGCTTC AGG (reversed) Intronic
901221865 1:7587951-7587973 CAGATGGCAGCTGTAGCTTCTGG + Intronic
907409228 1:54273064-54273086 CAGCTGGGCTCTGTAGCATGGGG + Intronic
915260216 1:154671726-154671748 CTCATGGTCTCGCTAGCTTCAGG - Intergenic
915625145 1:157109816-157109838 GAGATGGGGTCTCAAACTTCTGG + Intergenic
919879118 1:201890562-201890584 CAAATGGGCTCTGGAGCTGCTGG - Exonic
922501672 1:226101432-226101454 CAGATGGGATGTCTAGTTGCAGG + Intergenic
922557110 1:226540984-226541006 CAGGTGGGCCCTCTAGTTTGGGG - Intergenic
1063689918 10:8277116-8277138 AAGAGGGGCTCCCTAGCTTCTGG + Intergenic
1063852956 10:10213768-10213790 CAGATGGGTTCTCTACCTGCCGG + Intergenic
1063958891 10:11290156-11290178 CAGATGTGCTGCCTACCTTCGGG + Intronic
1065866842 10:29921766-29921788 CAGATGGGACCTCTAGTTGCAGG + Intergenic
1066620510 10:37344729-37344751 CAAATGGACTCTCAAACTTCTGG + Intronic
1067337690 10:45378261-45378283 AAGCTGGGCCTTCTAGCTTCCGG + Intronic
1067836971 10:49647587-49647609 CTGATGCGCTCTCCAGCTGCTGG + Intronic
1069886461 10:71626979-71627001 AGGATGGGCTCCCTGGCTTCCGG - Intronic
1072204051 10:93186956-93186978 CAGATGGGCTCCCTTTCATCTGG + Intergenic
1077670591 11:4153938-4153960 CAGAAGGGCTCTCTAGATCTTGG - Intergenic
1078320598 11:10331203-10331225 TTGATGGGCTCTCTGCCTTCAGG + Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084668527 11:70591434-70591456 CAGATTGGCTCTGTGGATTCCGG - Intronic
1089566205 11:119373048-119373070 CTGATTGGCTGTCCAGCTTCTGG + Exonic
1090736194 11:129613956-129613978 CAGATAGGGTCTCTGCCTTCTGG - Intergenic
1095517634 12:43024124-43024146 CAGGTAGGCTCTCTTGCTTCTGG + Intergenic
1098979718 12:76943106-76943128 CACATGGGAGCTCCAGCTTCTGG + Intergenic
1100815768 12:98385805-98385827 CAGATGAGTTCTCTAGCTGGCGG - Intergenic
1101837554 12:108305898-108305920 CAGGTGGGCTGTCTGGGTTCAGG - Intronic
1108153806 13:47564367-47564389 CAGAATGCCTCTCTAGATTCAGG + Intergenic
1108369963 13:49759549-49759571 CAGATGGGACCTCTAGTTGCAGG - Intronic
1111246018 13:85542309-85542331 CAGATTCTCTCTCTAGCTGCAGG + Intergenic
1112103831 13:96218755-96218777 CAGATGGGCTTTCCTGCTGCTGG + Intronic
1117845011 14:59901782-59901804 CACATGGACTCTCTAGCTTGTGG + Intergenic
1118865479 14:69699992-69700014 CAGATGGGTTCTCTACCTGGTGG + Intronic
1119849517 14:77857098-77857120 CGGATGGGCCCTCTGGCTGCTGG + Intronic
1124784776 15:32669335-32669357 GACTTGGGCTCTCTAGCATCTGG - Intronic
1132286274 15:100665325-100665347 CAGGTGGGCTCTCTGGCACCTGG + Intergenic
1132868375 16:2104740-2104762 CAAGTGGGCTCTCCAGCTGCAGG - Intronic
1133621480 16:7530851-7530873 CTCATGGGTTCTCTGGCTTCTGG + Intronic
1134237763 16:12481009-12481031 CAGATTGTCTCTCTAGCCTGGGG - Intronic
1134523356 16:14928261-14928283 CAAGTGGGCTCTCCAGCTGCAGG + Intronic
1134710948 16:16326745-16326767 CAAGTGGGCTCTCCAGCTGCAGG + Intergenic
1134948635 16:18341864-18341886 CAAGTGGGCTCTCCAGCTGCAGG - Intergenic
1136286189 16:29244163-29244185 CATATGGAAACTCTAGCTTCTGG - Intergenic
1137945335 16:52728675-52728697 CAGATGGGATGTCTAGTTGCAGG - Intergenic
1138652116 16:58466522-58466544 CAGATGGGGTCACCAGATTCTGG + Intronic
1141502826 16:84455479-84455501 CGGAGGTGCTCTCTAGGTTCTGG + Intronic
1142091531 16:88214355-88214377 CATATGGAAACTCTAGCTTCTGG - Intergenic
1145083537 17:19916058-19916080 ATGCTGAGCTCTCTAGCTTCGGG + Intronic
1146379012 17:32314778-32314800 CAGATTGGGTCGCTAGATTCAGG + Intronic
1147849848 17:43433543-43433565 CAGATGGATTCTACAGCTTCAGG - Intergenic
1148166069 17:45484899-45484921 CTGATTGGATCTCTGGCTTCTGG + Intronic
1149622701 17:58058083-58058105 CAGATGGACTTTCTCACTTCAGG - Intergenic
1150397292 17:64831623-64831645 CTGATTGGATCTCTGGCTTCTGG + Intergenic
1150877674 17:68987550-68987572 CAGAAGGGCACTCTAGCCACAGG + Intronic
1153892617 18:9532376-9532398 CAGAGGGGCTCTCTAGATCTTGG + Intronic
1156113479 18:33757207-33757229 CAGATGGTCTAGCTTGCTTCAGG + Intergenic
1156924690 18:42561657-42561679 CACATGGGCTCTCAAGCTTAGGG - Intergenic
1160317378 18:77860081-77860103 CAGGTGAGCTCCCTGGCTTCTGG + Intergenic
1163313963 19:16530473-16530495 GACATGGGCTCTCTGGCTGCTGG + Intronic
925416859 2:3676454-3676476 GAGATGAGGTCTCTAGCTCCTGG + Intronic
928375028 2:30766970-30766992 CAGATGGGCTCTCTACATTTGGG + Intronic
928545298 2:32323850-32323872 AAGATGGGCAGTCTAGCTCCAGG - Intergenic
930247255 2:48997133-48997155 CCAGTGGTCTCTCTAGCTTCTGG + Intronic
934519672 2:95012102-95012124 TAGAGGGGCTCCCTACCTTCAGG + Intergenic
942195114 2:173509395-173509417 CAGATGGGCTCTAGAACTCCAGG + Intergenic
945039365 2:205731163-205731185 CAGATGAGCTCTCTGCCTTGTGG - Intronic
1172564940 20:35922205-35922227 CAGGTGGGCACTCTTGGTTCAGG - Intronic
949940255 3:9149249-9149271 CAGATGGGCTCTCTAGCTTCAGG - Intronic
951403255 3:22261749-22261771 CAGATGGGCTCTGTGGCCTTTGG - Intronic
952079434 3:29740216-29740238 CACATGGGCTCTTTTGCTTTGGG - Intronic
952191687 3:31029525-31029547 CAGATGAACTCTCTGGCCTCTGG + Intergenic
954030560 3:47817103-47817125 CAGGTGGTTTCTCAAGCTTCAGG + Intronic
954332215 3:49897107-49897129 GTGATGGGCTCTCTTGCCTCTGG + Intronic
954611052 3:51944756-51944778 CACATGTGCCCTCTATCTTCAGG + Exonic
954924479 3:54220492-54220514 CAAAAGGGCTCTCTAGCTGGAGG + Intronic
958714342 3:97762291-97762313 GAGATGGGGTCTCCAACTTCTGG + Intergenic
963536798 3:146539447-146539469 CAGCTGGGCTCCCCAGCTCCTGG - Intronic
964195332 3:154057980-154058002 CAGCCGGGCTCCCTTGCTTCTGG - Intergenic
968982248 4:3856623-3856645 CAGATGGGCTCCCAGCCTTCAGG - Intergenic
969569331 4:7999525-7999547 GAGGAGGGCTCCCTAGCTTCAGG + Intronic
971694306 4:29878373-29878395 TAGATGGGTTTACTAGCTTCTGG - Intergenic
972660456 4:41110984-41111006 CAGATGGGATGTCTAGTTGCAGG - Intronic
972722972 4:41719355-41719377 TAGATGATCTCTCTAGCTGCAGG + Intergenic
980799911 4:137734709-137734731 CTTGTGGGCTCTCTAGCTTCAGG - Intergenic
981176428 4:141689093-141689115 CTCATGGGCTCACTGGCTTCAGG + Intronic
981424065 4:144583509-144583531 GAAATGGACACTCTAGCTTCTGG - Intergenic
981589485 4:146343350-146343372 CAGATGTGCTTTCTATATTCTGG - Intronic
983773872 4:171582821-171582843 CAAAAGGGCTCCATAGCTTCGGG - Intergenic
984565964 4:181330416-181330438 CAGAGGGGCTCTCTTTCCTCCGG + Intergenic
985369251 4:189267760-189267782 CAGATGGTCTCTGTGGCTGCAGG + Intergenic
990418497 5:55609155-55609177 CTGAGGGGCTTTCCAGCTTCAGG - Intergenic
991978698 5:72209680-72209702 AAGATGGGCTCCCTGGCTTTTGG + Intergenic
996581297 5:125034931-125034953 GAGATGGGGTTCCTAGCTTCAGG + Intergenic
1000129036 5:158276958-158276980 CTGATGTGTTCTCTACCTTCAGG - Intergenic
1001106346 5:168857905-168857927 AAGACTGGCTCTCCAGCTTCTGG + Intronic
1006411308 6:33875526-33875548 CAGATGGGCTGTCTACCTGACGG - Intergenic
1007702556 6:43773289-43773311 CAGAGGGGCACTCTAGCCTACGG - Intronic
1020035705 7:4961728-4961750 CAGATGGTCTCTCTCTCTCCTGG + Intergenic
1020334722 7:7053978-7054000 CAGATGTGCTCTCTACCTAAAGG - Intergenic
1020602502 7:10293490-10293512 CAGAGGGACTCTCTACCTTGAGG + Intergenic
1026677929 7:72443771-72443793 CAGAGGGTCTCTCTAGCTAGGGG - Intronic
1029453817 7:100657033-100657055 CAGAAGGGTTATCTATCTTCAGG + Intergenic
1030661244 7:112221599-112221621 CAGATGGACTGTCTAGTTGCAGG - Intronic
1032248206 7:130230955-130230977 CTCATGGGCTCGCTGGCTTCAGG - Intergenic
1035572424 8:681608-681630 CGGATGGGTTCTGTGGCTTCTGG - Intronic
1035714088 8:1740520-1740542 CTGATGGGTTCTCTGGCTTCAGG - Intergenic
1037170396 8:15885412-15885434 CAACTGGGCTCTCCAGATTCAGG + Intergenic
1038420021 8:27428059-27428081 CAGATGGACTGTCTAGTTGCAGG - Intronic
1039311495 8:36322120-36322142 CAGCTGGACTCTCTAGCCTCAGG + Intergenic
1039637468 8:39181261-39181283 CTCATGGGCTCGCTGGCTTCAGG - Intronic
1039711506 8:40060571-40060593 TAGATGGGCTGTCTAGATGCAGG + Intergenic
1043190541 8:77216466-77216488 AAAATGTCCTCTCTAGCTTCAGG + Intergenic
1044109135 8:88249853-88249875 CAGTTGGGCCCTCTTGCTTTGGG - Intronic
1044202813 8:89456611-89456633 CAGATGGGCCCTCAAGATTTAGG - Intergenic
1046093732 8:109533901-109533923 CAGCTGAGCTCTCTGGGTTCTGG - Intergenic
1046975082 8:120265967-120265989 CAGAGGGGATGTCTAGCCTCAGG - Intronic
1047878095 8:129162702-129162724 AAGATGGATTCACTAGCTTCTGG + Intergenic
1049419877 8:142511728-142511750 CGGGTGGGCTCTCTTGCTTTGGG + Intronic
1049556714 8:143286114-143286136 CTGATGGGTATTCTAGCTTCTGG + Intergenic
1055790106 9:79914557-79914579 AAGATGCTCTTTCTAGCTTCAGG - Intergenic
1056576635 9:87859821-87859843 CAGCTGGACTCTCTAGCCTCAGG + Intergenic
1057303335 9:93898947-93898969 CAGAGGTGCTCTCTTGCTTGGGG + Intergenic
1058637339 9:107049335-107049357 CAGATGGCCCCTCTGGCTGCCGG - Intergenic
1058973051 9:110100676-110100698 CAGCTGGGCTCTTTTGCATCAGG + Intronic
1060965908 9:127712195-127712217 CAGCTGGTCTCTCTGGCTCCTGG - Exonic
1062576355 9:137210417-137210439 GAGATGGGGTCTCAAGCTTCTGG + Intronic
1062688598 9:137828947-137828969 CAGATGGCCTCTTTTGCCTCTGG + Intronic
1185964261 X:4582407-4582429 CAGATGGGCATGCTACCTTCTGG + Intergenic
1187873560 X:23783901-23783923 CACTTGGTCTCTCTGGCTTCTGG - Intronic
1194091145 X:89582773-89582795 CAGCTGGACTCTGTAGCTTGGGG - Intergenic
1194896363 X:99446244-99446266 CATATGAGCTCTCTTACTTCAGG - Intergenic
1196319354 X:114269714-114269736 CTCATGGGCTCGCTGGCTTCAGG + Intergenic
1198815999 X:140590980-140591002 AAGATGGGCTCTCTAGCCTATGG - Intergenic
1200241583 X:154497892-154497914 CAGCTGGGCTCGGTGGCTTCAGG - Intergenic
1200443787 Y:3238838-3238860 CAGCTGGACTCTGTAGCTTGGGG - Intergenic