ID: 949940430

View in Genome Browser
Species Human (GRCh38)
Location 3:9150304-9150326
Sequence GAGGCAAGTGACCATCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949940426_949940430 -4 Left 949940426 3:9150285-9150307 CCCTGGGCAAAGGCTGGAGGAGG 0: 1
1: 0
2: 1
3: 59
4: 462
Right 949940430 3:9150304-9150326 GAGGCAAGTGACCATCTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 125
949940422_949940430 9 Left 949940422 3:9150272-9150294 CCAGCAGAAGACACCCTGGGCAA 0: 1
1: 0
2: 1
3: 16
4: 154
Right 949940430 3:9150304-9150326 GAGGCAAGTGACCATCTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 125
949940421_949940430 10 Left 949940421 3:9150271-9150293 CCCAGCAGAAGACACCCTGGGCA 0: 1
1: 0
2: 1
3: 14
4: 202
Right 949940430 3:9150304-9150326 GAGGCAAGTGACCATCTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 125
949940428_949940430 -5 Left 949940428 3:9150286-9150308 CCTGGGCAAAGGCTGGAGGAGGC 0: 1
1: 1
2: 3
3: 46
4: 446
Right 949940430 3:9150304-9150326 GAGGCAAGTGACCATCTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 125
949940420_949940430 11 Left 949940420 3:9150270-9150292 CCCCAGCAGAAGACACCCTGGGC 0: 1
1: 0
2: 2
3: 25
4: 222
Right 949940430 3:9150304-9150326 GAGGCAAGTGACCATCTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949940430 Original CRISPR GAGGCAAGTGACCATCTGGC TGG Intronic
903667290 1:25015846-25015868 GAGTCAGGTGACCATCAGGGTGG - Intergenic
904426475 1:30426802-30426824 GAGGCAAGTGTCCATTCTGCAGG + Intergenic
905741292 1:40373797-40373819 GACGCAGATGACCCTCTGGCCGG - Exonic
915669419 1:157476424-157476446 GAGACCAGTGACCATGTGGTGGG + Intergenic
917596012 1:176529785-176529807 AAGGCAAGTGGCCATCTTGAAGG - Intronic
919731935 1:200918573-200918595 GAAGCAAGAGACCAACTGGGAGG - Intergenic
923312325 1:232747085-232747107 GAGGCAAGAAACCATCAGACAGG - Intergenic
924381697 1:243471307-243471329 GAGGCAATTGGCCCTCGGGCGGG + Intronic
924530104 1:244886424-244886446 CAGGCAAGAGAGCATCTGCCCGG - Intergenic
1063677057 10:8150108-8150130 GAGGAAAGCTACCATCTTGCAGG - Intergenic
1065447546 10:25818942-25818964 GAGGCAGGAGCGCATCTGGCAGG - Intergenic
1066444881 10:35473239-35473261 GAGGCAGGTGGGCATGTGGCCGG - Intronic
1067084765 10:43231899-43231921 GGGGCCAGTGGCCATCTGCCGGG + Intronic
1069725030 10:70571959-70571981 GAGGCAAGTGGCGTCCTGGCTGG - Intergenic
1069897263 10:71687469-71687491 GAGTCAGGTAACCCTCTGGCAGG - Intronic
1071718757 10:88122220-88122242 GAAGCAAGGCACCTTCTGGCAGG + Intergenic
1073422033 10:103432203-103432225 GAAGCAAGTAACAGTCTGGCCGG - Exonic
1076303103 10:129442625-129442647 GAGTAAAGTGACCAGCTGCCAGG + Intergenic
1076563518 10:131382546-131382568 GAGGGAAGTGACCACCCGGCAGG - Intergenic
1080234244 11:30050641-30050663 GAGGCATGTGACCTTTAGGCAGG + Intergenic
1081594294 11:44448563-44448585 GAGGGACGTGACCATCTGAGAGG + Intergenic
1083712846 11:64559512-64559534 GAGGCCTATGACCATCTGGCAGG - Intronic
1084666418 11:70578859-70578881 GAGCCCAGAGACCATCTGCCGGG + Intronic
1088533846 11:110838661-110838683 GAGGCAAATTACCCTCTGGCAGG + Intergenic
1089696666 11:120220110-120220132 GAGGACAGAGACCATCTGACTGG + Intronic
1091194611 11:133720278-133720300 GATGCAGGTGACCACCTGGCTGG - Intergenic
1091889540 12:4042303-4042325 AAGGCAAATGACCATCCAGCAGG - Intergenic
1094676299 12:32623556-32623578 CAGGCAGGTGACCTTCAGGCTGG + Intronic
1097685622 12:62688186-62688208 GAGGCAAGTGAATATCTGTTGGG + Intronic
1102552042 12:113698414-113698436 GAGCCAGCTGACCATCTGCCAGG - Intergenic
1102744300 12:115236736-115236758 GAGGAAGGTGATCATCTGTCCGG + Intergenic
1103588119 12:121971223-121971245 GAGGCAAGTGTCCAGCTGAGAGG - Intronic
1103793125 12:123485613-123485635 GAGGCAAGTGTCCCTGGGGCTGG - Exonic
1105819826 13:24070352-24070374 GAGGGAAGTGAGCATATGGTAGG - Intronic
1119015410 14:71047398-71047420 GAGGCAACTGACCATCTATATGG - Intronic
1121863585 14:97341763-97341785 GAGGCAAGGGAACAGCTGGGAGG - Intergenic
1124393768 15:29282899-29282921 GAGGCAAGAGAACATCTGGCTGG - Intronic
1130217736 15:81988104-81988126 GAGGCATGTGGTCATCTGGCTGG + Intergenic
1132668238 16:1091458-1091480 GAGACAAGTGAGCACGTGGCTGG + Intronic
1132863927 16:2084539-2084561 AAGGCAAGGGACCCTCGGGCTGG - Exonic
1135894755 16:26388982-26389004 AAGGCAAATGACAAACTGGCAGG - Intergenic
1138276330 16:55737545-55737567 GATGCAGCTGACCAGCTGGCGGG + Intergenic
1139425939 16:66880141-66880163 GAGGCAGGTGTCCAGGTGGCTGG + Intronic
1139593570 16:67946085-67946107 GAGGCAAGGGACCAGGTGGGCGG + Intronic
1143033091 17:3978598-3978620 GAGGCAAGAGGCCAACAGGCGGG + Intergenic
1143277506 17:5722601-5722623 AAGGCAGGTAACCATCTGGGAGG - Intergenic
1144787010 17:17837505-17837527 GAGGCTAGTGACAATGTGGAGGG + Intergenic
1146987260 17:37232083-37232105 GAGGCAAGTTACCACTGGGCAGG + Intronic
1147889767 17:43709155-43709177 CAGAGAAGTGACCATCTGGCAGG - Intergenic
1149863443 17:60137290-60137312 GAGGCAAGGGAAGATCAGGCGGG + Intergenic
1151345585 17:73499419-73499441 GAGCCAGGTGGGCATCTGGCCGG - Intronic
1151571395 17:74927615-74927637 GAGGCCTGTGACCCTTTGGCAGG - Intronic
1152027595 17:77821889-77821911 GAGGCCCATGACCACCTGGCAGG - Intergenic
1152180673 17:78819512-78819534 GAGGCAAGAGAGCAGCTGGTTGG + Intronic
1153181878 18:2444606-2444628 GAGACAATTGATCATCTTGCAGG - Intergenic
1154102790 18:11491362-11491384 GAGGGAGGTGACCATCTGCAGGG - Intergenic
1154123323 18:11669396-11669418 GAGGCAGGTGACCAGCCAGCAGG + Intergenic
1155046637 18:22109015-22109037 GAGGGAAGTCACCATCTGTAGGG + Intergenic
1156857358 18:41797802-41797824 TGGGCAATTGACCATCTAGCTGG + Intergenic
1157662874 18:49460692-49460714 GTGCCACGTGACCACCTGGCTGG - Exonic
1158309856 18:56146118-56146140 GTGACAAGTGACCATGGGGCTGG + Intergenic
1160382654 18:78472358-78472380 GAGGCAGGTGACGATGGGGCGGG - Intergenic
1160454962 18:78993509-78993531 GAAGCCCGTGACCACCTGGCTGG + Exonic
1160597813 18:79989063-79989085 GAGGAATGTCACCATCAGGCCGG + Intronic
1165057968 19:33190743-33190765 GAGGCAAGGGACCACATGGAGGG + Intronic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
925106088 2:1293804-1293826 GGGAGAAGTGACCCTCTGGCAGG + Intronic
925841612 2:7997208-7997230 GTAGTGAGTGACCATCTGGCAGG + Intergenic
927056189 2:19367596-19367618 GAGGGGAGTGACCATGTGGAAGG - Intergenic
928061362 2:28116508-28116530 GAGCCAAGTGACCTGCTGGCTGG + Intronic
930336765 2:50058803-50058825 CAGGCAAGAGACCATCTGCAGGG - Intronic
932262831 2:70341590-70341612 GGGGCTAGTGACCAGCTTGCAGG + Intergenic
932626208 2:73297857-73297879 GAGGCAAGAGGCCAACTGTCAGG + Intergenic
933154092 2:78951902-78951924 GAGGCAAGAGTGCATTTGGCAGG + Intergenic
934013262 2:87849668-87849690 AAGGCAAGTTACCATTTGGTTGG - Intergenic
936040834 2:109148068-109148090 CAGGGAAGGGACCATCTGGCTGG + Intronic
940454412 2:153877862-153877884 GTGGTAAGTAAACATCTGGCAGG + Intronic
943185386 2:184599462-184599484 GAGGCAGGGAACCATGTGGCTGG + Intronic
943667749 2:190628049-190628071 GAGGCAAGTGTGCAGCTGCCAGG - Intergenic
944237600 2:197454077-197454099 AACGCATCTGACCATCTGGCAGG - Intronic
946156683 2:217811623-217811645 GAGGCCAGTGACCCTCAGGTGGG + Intronic
946763773 2:223021351-223021373 GAGGCAAGTGACACACTGGACGG + Intergenic
948996589 2:241583336-241583358 GGGGCAAGTGACAATATGTCTGG + Intergenic
1171160705 20:22920306-22920328 GAGGCAGGCGACTATCTGGGAGG - Intergenic
1171242973 20:23586413-23586435 GAAGCAGGTGAGCATCTGGGAGG - Intergenic
1177838558 21:26212322-26212344 GAGGCAAGAGACCTGCTGGCAGG - Intergenic
1181411944 22:22730262-22730284 GTGGCAACTGACCATTTGGGAGG - Intergenic
1183620294 22:38968179-38968201 GAGGCAAGTGACCATCACCAAGG - Intronic
1183725577 22:39587389-39587411 GAGGCCTGGGACCATCTGCCTGG + Intronic
949940430 3:9150304-9150326 GAGGCAAGTGACCATCTGGCTGG + Intronic
950125749 3:10508837-10508859 GAGGCAAGAGGCCAGCTGGGAGG + Intronic
953957969 3:47246121-47246143 GAGGCAAGTGCCCAGATGGCAGG + Intronic
961427388 3:126858725-126858747 GAGGCAAGAGCCCAGCGGGCCGG - Intronic
961635372 3:128329716-128329738 CAGGCCTGTGGCCATCTGGCTGG - Intronic
963598581 3:147358267-147358289 GAGACAAGTGGCTATTTGGCAGG + Intergenic
963782322 3:149498844-149498866 GAGGCCATTGACCACCTGGATGG - Exonic
969321696 4:6416765-6416787 GAGGGCTGGGACCATCTGGCAGG + Intronic
976190403 4:82481377-82481399 GAGGAAAGAGACCATCTGTGGGG - Intergenic
977560391 4:98527149-98527171 GAGGCAAGTGAGAATCAGACAGG + Intronic
977569409 4:98613958-98613980 GATGCAAGGGACCATTTAGCCGG - Intronic
983297725 4:165887376-165887398 GAGACCAGTGACCAGCTGGATGG + Intronic
983428224 4:167614929-167614951 GAGGCATGAGACTATCTGACTGG - Intergenic
984770197 4:183430678-183430700 GAGGCCAGTAAACCTCTGGCCGG - Intergenic
985293656 4:188411986-188412008 GAGGCCTGTGACCATCAAGCGGG - Intergenic
994692317 5:103034247-103034269 GAGGTATGTGGCCATCTGGAGGG + Intergenic
997474684 5:134136042-134136064 GGGGCAAGAGACTGTCTGGCTGG + Intronic
1000161489 5:158601871-158601893 GAGGAAAGTGCCCGTCTGGAAGG - Intergenic
1001755387 5:174164626-174164648 GAGGCATGTGCCCAGCTGCCAGG - Intronic
1003181617 6:3796905-3796927 GAGGCAAGTGAGCCTATGGCAGG - Intergenic
1006780936 6:36631811-36631833 GAGGCATGTGAGCAGCTGGAGGG + Intergenic
1007128151 6:39445010-39445032 GGGGAAAGTGAAGATCTGGCTGG + Intronic
1007755476 6:44096521-44096543 CAGGAAAGAGAGCATCTGGCAGG - Intergenic
1008130290 6:47713350-47713372 TAGGCAAGTTTCCATATGGCAGG + Intronic
1011377729 6:86707686-86707708 GTGGCTACTTACCATCTGGCAGG + Intergenic
1013318121 6:108960748-108960770 GAGCCAAGTGACTAACTGGGAGG + Intronic
1013944541 6:115705915-115705937 GAGGCCAGTGATAATCTTGCTGG - Intergenic
1017295737 6:152791552-152791574 GAGGCCAGCGAGCATCTGGTAGG - Intergenic
1021803529 7:24332339-24332361 CAGGCAAGAGACCTTCTGCCAGG + Intergenic
1024268457 7:47624476-47624498 GAGGCATGAGACCATCAGCCAGG - Intergenic
1024295815 7:47840983-47841005 GAGGCACATGACAATCTGGCTGG + Intronic
1026889952 7:73976039-73976061 GAGCCAAGTCCCCATCTTGCTGG + Intergenic
1031601862 7:123719844-123719866 GTGACTAGTGACTATCTGGCTGG - Intronic
1035764717 8:2096876-2096898 GAGGCAAGGGACTCTCTGGGAGG - Intronic
1036655204 8:10673186-10673208 GAGGCAAGGGATCCTCTGGCTGG - Intronic
1037945540 8:22987373-22987395 GAGGGAACTGACCAGCAGGCCGG + Intronic
1038317758 8:26502219-26502241 TAGGAAAGTGCCCATCTGGAAGG + Intronic
1046645762 8:116783775-116783797 GGGGCAACTGCCCATCTGGGAGG - Intronic
1050056533 9:1661095-1661117 GAGCCAACAGACCCTCTGGCAGG - Intergenic
1055599379 9:77899721-77899743 GAGGCAAAAGACCATCTGACTGG + Intronic
1055664426 9:78539165-78539187 GTGGCAAGGGACCATCTGGTGGG + Intergenic
1056035162 9:82596672-82596694 GTGGAAAGTGAACATGTGGCAGG - Intergenic
1057765341 9:97912040-97912062 GAGTCAGATGACCACCTGGCTGG + Intronic
1060891521 9:127192286-127192308 GAGGCAAGTTGCCGTGTGGCAGG + Intronic
1061680266 9:132239607-132239629 GAGGCCACTGAGCATCTGTCTGG + Intronic
1062021783 9:134322995-134323017 GAGGCAAGGGGCCACCCGGCAGG - Intronic
1186500351 X:10045809-10045831 GATGCACGTGACCATGAGGCAGG - Intronic
1189392554 X:40588597-40588619 GAGGCATGTGGCAATTTGGCAGG - Intronic
1191183370 X:57585464-57585486 GATCAAGGTGACCATCTGGCTGG + Intergenic
1191611199 X:63115188-63115210 GTGGAAAATGCCCATCTGGCAGG - Intergenic
1195645535 X:107226911-107226933 GAAGTCAGTCACCATCTGGCAGG + Intronic
1196027451 X:111055894-111055916 GAGGCATGGGACCATATGCCTGG - Intronic
1199131209 X:144188801-144188823 AAGGCAAGTTACCATTTGGTTGG + Intergenic