ID: 949941121

View in Genome Browser
Species Human (GRCh38)
Location 3:9155510-9155532
Sequence GAACTCTGCTTGGCATATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949941115_949941121 5 Left 949941115 3:9155482-9155504 CCTTCATTCCCTCCATTCTCTTC 0: 2
1: 1
2: 15
3: 233
4: 2465
Right 949941121 3:9155510-9155532 GAACTCTGCTTGGCATATACTGG 0: 1
1: 0
2: 0
3: 13
4: 153
949941117_949941121 -3 Left 949941117 3:9155490-9155512 CCCTCCATTCTCTTCTTCTGGAA 0: 1
1: 3
2: 13
3: 49
4: 538
Right 949941121 3:9155510-9155532 GAACTCTGCTTGGCATATACTGG 0: 1
1: 0
2: 0
3: 13
4: 153
949941118_949941121 -4 Left 949941118 3:9155491-9155513 CCTCCATTCTCTTCTTCTGGAAC 0: 1
1: 4
2: 7
3: 36
4: 427
Right 949941121 3:9155510-9155532 GAACTCTGCTTGGCATATACTGG 0: 1
1: 0
2: 0
3: 13
4: 153
949941119_949941121 -7 Left 949941119 3:9155494-9155516 CCATTCTCTTCTTCTGGAACTCT 0: 1
1: 1
2: 21
3: 114
4: 642
Right 949941121 3:9155510-9155532 GAACTCTGCTTGGCATATACTGG 0: 1
1: 0
2: 0
3: 13
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949941121 Original CRISPR GAACTCTGCTTGGCATATAC TGG Intronic
903152065 1:21416545-21416567 GAACTCTGAATAACATATACAGG + Intergenic
903636018 1:24816736-24816758 GAACTCTGATAGAGATATACAGG - Intronic
903977683 1:27161804-27161826 GAACTATGCTTGACATACAGTGG - Intronic
905086786 1:35386916-35386938 GAACGGTGCTTGGCATATGTAGG + Intronic
905704577 1:40045148-40045170 GAAGTCTTATTGGCATCTACTGG - Intronic
906807034 1:48789189-48789211 GAACACTGCTTGTCATCCACTGG + Intronic
911056674 1:93714410-93714432 GAACACTGCCTGGCACATAGTGG + Intronic
911389452 1:97220560-97220582 GAGCTCTGCCTGGGATATAGTGG + Intronic
912739952 1:112185105-112185127 CAACAGTGCTTGGCATATAGTGG + Intergenic
916767664 1:167877359-167877381 GCACTGTGCTTGGCATACATAGG - Intronic
917033486 1:170720911-170720933 GAACACTACTTGGCATATAAGGG - Intronic
924317880 1:242817310-242817332 GAACTCTCCTAGGCAGATAGGGG - Intergenic
924907098 1:248467305-248467327 GAAATATGCTTAGCAGATACTGG - Intergenic
924917012 1:248580841-248580863 GAAATATGCTTAGCAGATACTGG + Intergenic
1068608582 10:59033589-59033611 CCACTCTTTTTGGCATATACAGG + Intergenic
1070005149 10:72417040-72417062 GAAGACTGCTTGGCACATAGTGG + Intronic
1070492740 10:76992998-76993020 AAAGTCTCCTTGCCATATACAGG + Intronic
1072283962 10:93894975-93894997 GATCCCAGCTTGCCATATACCGG + Intronic
1072616597 10:97053563-97053585 GAGCACTGCCTGGCATAGACAGG + Intronic
1072820552 10:98552381-98552403 GAACTGTGCCTGGCACATATAGG + Intronic
1073498611 10:103916868-103916890 GAACAGTGCCTGGCATATAGTGG - Intronic
1078969597 11:16392338-16392360 GAACAGTGCCTGGCATATAGTGG - Intronic
1079501239 11:21103560-21103582 AAACTATGCTTGGCATAAAGTGG + Intronic
1081069603 11:38595035-38595057 GAACTCTCCTAGGCAGATAAAGG + Intergenic
1081771621 11:45653729-45653751 GAACAGTGCCTGGCACATACAGG - Intronic
1083113439 11:60435088-60435110 GACCTTTGCTAGGCATAAACTGG + Intronic
1083556749 11:63635460-63635482 GAACTCTGCTTATTGTATACAGG + Intronic
1089040439 11:115443724-115443746 GCAGACTGCTTGGCACATACTGG - Intronic
1090568666 11:128023700-128023722 GAAGGCTGCTTGGGATAGACAGG + Intergenic
1093030007 12:14279688-14279710 GATCTGTGCTTGGCTTTTACTGG - Intergenic
1098219817 12:68257239-68257261 GAACAGTGCCTGGCATATAGTGG + Intergenic
1098845348 12:75528518-75528540 CATCTCTGCTTGGCACAGACTGG + Intergenic
1104564548 12:129868963-129868985 GAACTCTGCTTAGCATCTGTGGG + Intronic
1106318136 13:28613339-28613361 GAAATGTGCTTGACATATTCAGG - Intergenic
1106677985 13:31981964-31981986 GAACTCTGCCTGGCAAATGATGG - Intergenic
1108008070 13:45972869-45972891 AAACTCTGCTTTGCATGTAATGG - Intronic
1108501390 13:51072675-51072697 GAAGAGTGCTTGGCAAATACGGG + Intergenic
1109267379 13:60217037-60217059 GAATTCTGCTTGGCTTATCTTGG + Intergenic
1110557675 13:76878560-76878582 GAACTTCTGTTGGCATATACTGG - Intergenic
1112201494 13:97280730-97280752 AAAGCCTGCTTGGCATATTCAGG - Intronic
1117385956 14:55212940-55212962 GAACTCTCCTAGGCAGATAGGGG - Intergenic
1125300665 15:38251813-38251835 TTACTCTGCTTGGAATATCCGGG - Intergenic
1126135196 15:45383067-45383089 GCACTGTGCTAGGGATATACTGG - Intronic
1126446270 15:48748181-48748203 GAAGCCTGCTTGACGTATACTGG + Intronic
1127065946 15:55238566-55238588 GCACAATGGTTGGCATATACTGG + Intronic
1127631326 15:60829935-60829957 GCACTGTGCTTGGCATACAGTGG + Intronic
1128888886 15:71313011-71313033 GAACAGTGCCTGGCATATAACGG + Intronic
1129160887 15:73747113-73747135 GAAGTGTGCTTGGCATATGCAGG - Intronic
1130010756 15:80151902-80151924 GAATAGTGCCTGGCATATACAGG - Intergenic
1130843018 15:87719415-87719437 GAACTCTGGTTGGCCAGTACAGG - Intergenic
1131651898 15:94409399-94409421 GAGCTCTGCTTGGCATCTGGTGG - Intronic
1131652019 15:94410367-94410389 GAACTCTGCTTGGCATCTGGTGG - Intronic
1133861909 16:9603999-9604021 GAACACTGCTTAGCACATATAGG - Intergenic
1134004070 16:10805800-10805822 GAACTGTGCTTGGCACACAAAGG + Intronic
1136048156 16:27631764-27631786 GAACTGTGCCTGGCACATAGTGG - Intronic
1139926665 16:70491904-70491926 GAACTGTGCCTGGCACATCCAGG - Intronic
1141239840 16:82255449-82255471 GCACTCTGTTTGGCCTATAGTGG - Intergenic
1142602430 17:1060528-1060550 GAACTCTTCTTTGCTTATGCTGG - Intronic
1143948393 17:10614260-10614282 GAACAGTGCTTGGCACATAGAGG + Intergenic
1144333995 17:14252926-14252948 GAACTCTCCTAGGCAGATAGGGG + Intergenic
1146312034 17:31776647-31776669 GTGCTCTGCTTGGCCTATTCTGG - Intergenic
1148995452 17:51705474-51705496 AAACAGTGCTTGGCACATACAGG + Intronic
1151339982 17:73464978-73465000 GAACAGTGCTTGGCATATGGGGG + Intronic
1151960519 17:77403158-77403180 GGCCTCTGCTGGGCATATCCAGG - Intronic
1152012939 17:77730032-77730054 GGACTCTGCTTGGTATTTCCTGG - Intergenic
1152722992 17:81931916-81931938 GAACCATGCTTGGTATATATGGG - Intergenic
1153395166 18:4611479-4611501 GCACTGTGCTTAGCATATGCTGG + Intergenic
1155082375 18:22423544-22423566 GAACGCTGCTTGGCACATATGGG - Intergenic
1162054882 19:8056508-8056530 GACCTCTGCTGGGCATCTAGGGG + Intronic
925294553 2:2768588-2768610 GAACCCTGCTTGGGACAGACGGG - Intergenic
927248216 2:20975077-20975099 GAGCTCTGCTTGGTAGATTCTGG + Intergenic
927668901 2:25052474-25052496 GAATTCTGCCTGGCACATAGTGG - Intronic
932091173 2:68807711-68807733 GAACCCTGCTGGGCAGATTCAGG + Intronic
932377845 2:71253935-71253957 GAAGTGTGCCTGGCATATAGTGG + Intergenic
933172406 2:79138533-79138555 GAGCTCTTCCTGGCATATCCTGG + Intergenic
933215698 2:79627418-79627440 GCACTCTGCTGGGTATTTACAGG - Intronic
935871869 2:107459502-107459524 GATCTCTGCTTGGCCTTTTCTGG - Intergenic
939056300 2:137368908-137368930 GAACTCTGCTTGGAATTTCTTGG + Intronic
939884950 2:147671455-147671477 GAACACTGCCTGGCATATATTGG - Intergenic
946581727 2:221135617-221135639 GAACAATGCCTGGCATATAGGGG + Intergenic
947496686 2:230642940-230642962 TCACCCTGCTTGGCAAATACAGG + Intergenic
1169691344 20:8335742-8335764 GAGCTCTTCTTGGCATCTCCAGG + Intronic
1171037980 20:21731772-21731794 GAACTGTGCCTGGCATATGTTGG + Intergenic
1172865511 20:38093877-38093899 GAACTCTGGATGGTATATCCTGG + Intronic
1172906332 20:38372680-38372702 GCTCTCTGCTTGGCATATAGTGG + Intronic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1174940823 20:54924872-54924894 AAACTGTACTTGGCATATACAGG - Intergenic
1175496511 20:59418240-59418262 GCACAGTGCTTGGCATATAGTGG - Intergenic
1178590471 21:33905287-33905309 GAAATGTGCCTGGCATAGACAGG - Intronic
1178898297 21:36578647-36578669 GCACTCTGCTAGGCATGTGCTGG + Intergenic
1183891505 22:40933599-40933621 GATCTCTGCTTTACATATGCTGG - Intergenic
1184267946 22:43359940-43359962 GAACAGTGCTTGGCATATAGTGG - Intergenic
1184915198 22:47564172-47564194 GACATCTGCTGGGCATGTACCGG - Intergenic
949591710 3:5501093-5501115 GGACACTGATTAGCATATACTGG + Intergenic
949941121 3:9155510-9155532 GAACTCTGCTTGGCATATACTGG + Intronic
950111133 3:10419359-10419381 AAATAGTGCTTGGCATATACTGG + Intronic
953188404 3:40660359-40660381 GAAGTCTGGTGGGCATATAAGGG + Intergenic
953929395 3:46998470-46998492 GAACTATGCTGGACATGTACTGG - Exonic
954806381 3:53223357-53223379 GAACACTGCTAGGCAGATACGGG - Intergenic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
957139453 3:76334407-76334429 GAAATCTGCTTGGATTTTACAGG + Intronic
957498325 3:81020150-81020172 GAAATCAGCTTGGCATAAACAGG - Intergenic
960491555 3:118322004-118322026 GAACTCTGGCTGGCATATGGCGG - Intergenic
962352550 3:134666438-134666460 GACCAATGCTTGGCATATCCTGG - Intronic
962431721 3:135326372-135326394 GAACTCTACAGGGCATACACAGG + Intergenic
967411816 3:189173854-189173876 GACCTTTGCTTAGCATCTACTGG + Intronic
968526205 4:1058829-1058851 GGACTGTGCCTGGCATACACAGG + Intronic
972176751 4:36417467-36417489 GAACTCTCCTAGGCAGATATGGG - Intergenic
973771321 4:54209700-54209722 AGACAGTGCTTGGCATATACTGG - Intronic
977139395 4:93348713-93348735 GACCTCTGCTTAGCATATTCTGG + Intronic
978819782 4:112952992-112953014 GAATAGTGCTTGGCATATCCTGG - Intronic
982062587 4:151619705-151619727 GAACAGTGCCTGGCATATATTGG - Intronic
985430063 4:189870673-189870695 GTGCTCTGCTTGGCATTTATAGG + Intergenic
990030083 5:51248102-51248124 GAAGAATGTTTGGCATATACTGG - Intergenic
993059782 5:83025389-83025411 GAAATCTGATTGGAATAAACTGG - Intergenic
994644337 5:102450573-102450595 GATCTCAGCTTGGCATTTCCGGG + Intronic
996284825 5:121777115-121777137 GAACTGTGCTTGGCAAATAGGGG + Intergenic
997011902 5:129888293-129888315 TAACTCTGCTTGGGAAATTCTGG - Intergenic
1000449276 5:161364405-161364427 GAACTGTGCCTAGCATATAGAGG + Intronic
1000970518 5:167709206-167709228 GAACTCAGCTTGGAAAAGACAGG - Intronic
1002274071 5:178092795-178092817 AAATTCTGCTTGGCATCTATTGG - Intergenic
1005641235 6:27798448-27798470 GAACTGTCATTGGCATAAACTGG - Intergenic
1006923237 6:37639793-37639815 GAACAGTGCCTGGCATATAATGG + Intronic
1007488777 6:42201470-42201492 GAACAGTACTTGGCATGTACAGG + Intergenic
1007503134 6:42313803-42313825 GAACTCTCCTGGTCATATTCAGG + Intronic
1012287576 6:97411321-97411343 GAGCTCTGATGGGTATATACAGG - Intergenic
1012635192 6:101529278-101529300 GAATTTTGCTTGGCATTTAGAGG + Intronic
1013241972 6:108254584-108254606 CAACACTGCTTGGCACATAGTGG - Intronic
1014722972 6:124940279-124940301 GAAATAAGCTTGGCATATACAGG + Intergenic
1015257119 6:131190964-131190986 ATACTGTGCTTGGCACATACAGG + Intronic
1015449612 6:133350197-133350219 GAACACTGCATGGCACATAATGG - Intronic
1018331293 6:162730083-162730105 GAACTGTGCTTAGCAAACACTGG - Intronic
1019906699 7:4070345-4070367 AAACTCTGCTTTGCAAAGACAGG + Intronic
1023705242 7:42933721-42933743 GCACATTGCTTGGCATATAGTGG - Intronic
1027449752 7:78317736-78317758 GAGCTCTGGTTGGCATATGGTGG + Intronic
1028122250 7:87069433-87069455 GGACTCTACTGGGGATATACTGG - Intergenic
1028245100 7:88467760-88467782 GTGCTCTGCTTTGCATGTACTGG - Intergenic
1028821831 7:95220633-95220655 GTACATTGCTTGGCATATAGTGG - Intronic
1033645153 7:143295901-143295923 GAAGTCTGCTGGGCATAAAGGGG + Intronic
1037318621 8:17623012-17623034 GAACTCTCCTAAGCAGATACGGG - Intronic
1038086197 8:24198997-24199019 GAAATCAGCTTGGCATCTTCCGG - Intergenic
1039276480 8:35938415-35938437 AGACACTGCTTGGCATTTACAGG + Intergenic
1039422800 8:37458566-37458588 GACCGCTGGTTGGCATATAGTGG - Intergenic
1039738422 8:40357126-40357148 CAATTCTGCTTGCCTTATACTGG + Intergenic
1039888559 8:41669510-41669532 GATCTCTACTTGGCATCTCCAGG + Intronic
1040400623 8:47045868-47045890 GAACCCTGCCTGTAATATACAGG - Intergenic
1041619010 8:59943409-59943431 CAACTCTGCCTGGCACATAGAGG - Intergenic
1043789100 8:84440697-84440719 GAATACTGCTTGGCATAAAAAGG - Intronic
1044553177 8:93534587-93534609 GAATTCTGCCTGGGATATTCTGG - Intergenic
1045379290 8:101607170-101607192 GAACTGTGCTTGGCACACAATGG - Intronic
1047852535 8:128874109-128874131 GCACTGTGCTTGGCACATAACGG - Intergenic
1050527531 9:6559068-6559090 GTGCTCTGCTTGGCTTATCCAGG + Intronic
1051801765 9:20942685-20942707 GTATACTGCTTGGCGTATACAGG - Intronic
1057974129 9:99586028-99586050 CAACCATGCTTGGCACATACTGG + Intergenic
1059989988 9:119855744-119855766 GAATTCTTCTTTGCATATTCTGG - Intergenic
1060014288 9:120073017-120073039 GAACTGTGCCTGGCATGTAGTGG - Intergenic
1060020525 9:120126536-120126558 GAACACTGCCTGGCATACAATGG - Intergenic
1185811558 X:3115197-3115219 GTACTCTTCTTGGTATATAAGGG - Intergenic
1186973650 X:14875977-14875999 GAACTGTGCTGGGCATACAAAGG - Intronic
1189357572 X:40323016-40323038 GAAATCTCCTTGCCATATCCTGG + Intergenic
1189958063 X:46296773-46296795 GAATACTGCTTGGAATATATTGG - Intergenic
1190522393 X:51293803-51293825 GATCTCTGCTGAGCATACACTGG - Intergenic
1190543855 X:51504657-51504679 GATCTCTGCTGAGCATACACTGG + Intergenic
1196306855 X:114113018-114113040 GCACTGTGCTTGGAACATACTGG + Intergenic
1197961909 X:132016293-132016315 AAACTCTGCTTAGCACATAAAGG - Intergenic
1201221357 Y:11773821-11773843 GAACTCTCCTAGGCAGATAGGGG - Intergenic
1201907565 Y:19101207-19101229 AAACACTGCTCGGCATTTACTGG - Intergenic