ID: 949941202

View in Genome Browser
Species Human (GRCh38)
Location 3:9156192-9156214
Sequence CTTATCATCAGAAGTGAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949941201_949941202 22 Left 949941201 3:9156147-9156169 CCTCAGTATACAGGCTTTGAAGT 0: 1
1: 0
2: 3
3: 36
4: 128
Right 949941202 3:9156192-9156214 CTTATCATCAGAAGTGAGTTTGG 0: 1
1: 1
2: 0
3: 3
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949941202 Original CRISPR CTTATCATCAGAAGTGAGTT TGG Intronic
901949802 1:12734543-12734565 TTTATCATCAGATCTCAGTTGGG + Intergenic
904605320 1:31694956-31694978 CTTGTCATCTGCAGTGTGTTCGG - Intronic
905501458 1:38442489-38442511 CTAATTATCAGAATTGAGTATGG + Intergenic
907648604 1:56270350-56270372 CTTGTCATCAGACATGATTTTGG + Intergenic
907766696 1:57420113-57420135 CTTATCATCAACAGGGAGTGGGG - Intronic
908551700 1:65214877-65214899 CACTTCATCAGAAGTGAGCTGGG - Intronic
909173167 1:72320279-72320301 ACTATCATCAGAAGTTAATTTGG + Intergenic
912269294 1:108192901-108192923 CTTCTGATCAGACGTGAGTGAGG - Intronic
920571089 1:207018432-207018454 CTTTCTCTCAGAAGTGAGTTGGG + Intronic
921439805 1:215172538-215172560 CTTATAAGCAGAAGGGAATTTGG - Intronic
924078911 1:240371809-240371831 CTTATCTTCAGAGGAGACTTAGG - Intronic
1062953135 10:1520520-1520542 GTTATCATCAGATGTCAGATGGG - Intronic
1066568377 10:36745140-36745162 CTTTTCATCAAAATTAAGTTTGG + Intergenic
1067276936 10:44844477-44844499 CTCATCATCAGCAGAGAGTATGG - Intergenic
1074540902 10:114364544-114364566 CTTATAAGAAGAAGAGAGTTTGG - Intronic
1074822967 10:117195244-117195266 CTTGTCACCAGCAGTGAGCTGGG - Intergenic
1075047967 10:119160881-119160903 CTAATTTTCAGAAGTGGGTTGGG - Intronic
1077746428 11:4911940-4911962 CTTATAAGCAGAAGTTAGTTGGG - Intronic
1078120826 11:8507222-8507244 CTTATCAAGAGCAGTGAGCTAGG - Intronic
1079653331 11:22958579-22958601 CTTATAATATGAAGAGAGTTGGG - Intergenic
1080287584 11:30633657-30633679 CTTATGACCAGAATTGAGGTAGG - Intergenic
1085304133 11:75475679-75475701 CTCATCTTCAGCTGTGAGTTTGG + Intronic
1085482939 11:76837776-76837798 GTTTTCATCAGAACTGGGTTGGG - Intergenic
1085708116 11:78804994-78805016 CTTAACATGAGATGAGAGTTCGG + Intronic
1085773849 11:79348077-79348099 CTTATCAAAAGAAGTGAGAGGGG - Intronic
1086742479 11:90384756-90384778 GCTATAATCAGAAGTAAGTTTGG - Intergenic
1089513914 11:119019269-119019291 CTTCTCATTAGAAGTGAGGCGGG - Exonic
1091097131 11:132834661-132834683 CTTATAAGAAGAAGGGAGTTTGG - Intronic
1091432261 12:446354-446376 CTGATCCTCAAAAGTGAATTTGG + Intergenic
1093148036 12:15590004-15590026 ATCATCATCAAAAGTGAATTGGG - Intronic
1095514889 12:42994815-42994837 GTGATCATGAGAAGTGAGGTGGG + Intergenic
1098934353 12:76461187-76461209 CTGTTCATTAGAAGTGATTTAGG - Intronic
1098990318 12:77058612-77058634 CTTATCAGCAGGGGTGAGTGTGG + Intronic
1099347480 12:81520752-81520774 CTTACCAACAGAAGTGTGTGGGG - Intronic
1099418806 12:82426815-82426837 TTTATCACCAGAAATCAGTTGGG + Intronic
1100085782 12:90908735-90908757 CTTACTTTCAGAAGTGAGTGTGG + Intronic
1103133372 12:118487481-118487503 TTTTTCATCAGAAGTGAGGGTGG + Intergenic
1104538457 12:129640613-129640635 GTTATGACCAGAAGTGAGATGGG - Intronic
1106293662 13:28390275-28390297 CATTCCATCAGAAGTGAGGTAGG + Intronic
1111179832 13:84650034-84650056 GTTATCATAGGAAGTGACTTTGG + Intergenic
1111576139 13:90155828-90155850 CCTCTCATAAGCAGTGAGTTGGG + Intergenic
1112188708 13:97153933-97153955 CTCATCATTGGAAGAGAGTTTGG - Intergenic
1112990578 13:105508900-105508922 CTTAGGAAAAGAAGTGAGTTTGG - Intergenic
1113090464 13:106612699-106612721 CTCTTCATCAGAAGCAAGTTAGG - Intergenic
1113898644 13:113783425-113783447 CTTTTCATCAGGAGTGAGGGTGG + Intronic
1117518649 14:56528205-56528227 CTTATCATCAGAAGTGACTTTGG - Intronic
1120811697 14:88810255-88810277 CTGATAATAACAAGTGAGTTAGG + Intergenic
1121482788 14:94291528-94291550 CTGAACACCAGAACTGAGTTTGG - Intronic
1125048786 15:35273512-35273534 CTTATCAACTGCACTGAGTTTGG - Intronic
1126576979 15:50206916-50206938 ATCATCATTAGCAGTGAGTTGGG + Intronic
1137070790 16:35903117-35903139 CTTATTAGCAGAAGAGAGTGGGG - Intergenic
1138860862 16:60754885-60754907 TCTATCATCAGAAATTAGTTGGG - Intergenic
1144360682 17:14488887-14488909 CAAATCATCAGTAGTCAGTTGGG - Intergenic
1146713505 17:35063488-35063510 CCTGTCTTCAGAAGTGAGTCAGG - Intronic
1149557389 17:57583844-57583866 CCCATCCTCAGAATTGAGTTAGG - Intronic
1152246855 17:79189215-79189237 CTGATCATCACAAGTTAGGTAGG + Intronic
1152790831 17:82278554-82278576 CTTCCCATCAGAAGTGAGGAAGG + Intergenic
1153497925 18:5718776-5718798 CTTCTAATCAGAAATGAGGTAGG + Intergenic
1154094501 18:11399366-11399388 CTTCTCTCCAGAAGTGTGTTTGG - Intergenic
1154125050 18:11684568-11684590 CTTATAAACAGCACTGAGTTGGG + Intergenic
1154946109 18:21162945-21162967 CTTCTCATCACAAGTGACCTAGG + Intergenic
1155404393 18:25472055-25472077 CCTATCATTAGAAGAGATTTTGG + Intergenic
1156095012 18:33519451-33519473 CATATCATCAAAAATGAGTCTGG - Intergenic
1157184457 18:45526583-45526605 CTTCTGATAAGAAGTGATTTTGG + Intronic
1157771756 18:50354391-50354413 TTTATCATCAGAAGCTAGGTCGG + Intergenic
1158861050 18:61592751-61592773 CCTATCAACATAACTGAGTTTGG - Intergenic
1163233539 19:16018882-16018904 CTCATCCTCTGAGGTGAGTTTGG - Intergenic
1165209849 19:34225646-34225668 CTTATCATCTAATGTGAGTGTGG - Intronic
1165341731 19:35217202-35217224 CTGATCAGCAGCAGTGAATTGGG - Intergenic
1165422862 19:35731041-35731063 CTTTTCATGGGAAGTGAGGTGGG + Intronic
1168214029 19:54912157-54912179 CTTATCATCAGCAGACACTTGGG + Exonic
927005250 2:18841959-18841981 CTTATCTTCAGAAGTCTGCTGGG + Intergenic
928081158 2:28313500-28313522 TTTTTCCTCAGAAGTGACTTTGG - Intronic
930768946 2:55112743-55112765 TGTATCATCAAAAGAGAGTTGGG + Intergenic
932964962 2:76462333-76462355 TTTCTCATCAGAAGAAAGTTGGG + Intergenic
934055998 2:88252405-88252427 CTTCAGAGCAGAAGTGAGTTTGG + Intergenic
937265204 2:120611049-120611071 CTTTTCATCAAAAGTGAGGCAGG + Intergenic
942464475 2:176192973-176192995 CCTATCATTTGAAGGGAGTTAGG + Intergenic
947024663 2:225723477-225723499 CTCATCATCAGAAGTGGTTAAGG + Intergenic
948185504 2:236018508-236018530 ATTATCATCCGCTGTGAGTTGGG + Intronic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1170430326 20:16269814-16269836 CTTATCATGACAGGTGATTTAGG - Intergenic
1172214800 20:33227609-33227631 CTGATCAGCAGAAGTCAGCTGGG - Exonic
1176877199 21:14143429-14143451 TATATCAACAGAAGAGAGTTGGG - Intronic
1177576168 21:22959223-22959245 CTGGGCATCAGAACTGAGTTTGG + Intergenic
1178479801 21:32969853-32969875 CTTGTCATCAGATGTTAGCTGGG - Intergenic
1179316760 21:40250726-40250748 CTTCTCATTAGCAGTGAGGTTGG - Intronic
1183790148 22:40060844-40060866 CTTTTTATCAGGAGTTAGTTTGG + Intronic
949941202 3:9156192-9156214 CTTATCATCAGAAGTGAGTTTGG + Intronic
950318499 3:12027109-12027131 CTCATCATCAGAGGTGAATGTGG + Intronic
951023745 3:17808770-17808792 ATAATCATCAGTAGTGATTTAGG + Intronic
951090569 3:18568726-18568748 CTTTTCCTCAAAAGGGAGTTTGG - Intergenic
956028511 3:65010324-65010346 GAAATCATCAGAAATGAGTTTGG - Intergenic
957238942 3:77632802-77632824 ACTAGCATCAGAAGAGAGTTTGG - Intronic
959701473 3:109303027-109303049 CTTATATTGAGAAATGAGTTTGG - Intronic
960540698 3:118858909-118858931 CTTTCCATCAGAAGAAAGTTAGG + Intergenic
961957607 3:130820103-130820125 TTTTTCATCAAAAGTAAGTTAGG - Intergenic
962143395 3:132814305-132814327 CTAATGTTCAGAAGTCAGTTTGG + Intergenic
964155386 3:153579034-153579056 CTTCTCTGCAGAGGTGAGTTAGG - Intergenic
965411852 3:168341873-168341895 CTTAGCATTAGAGGTGGGTTTGG + Intergenic
965741807 3:171883311-171883333 CTAATCTTCAGGAGAGAGTTTGG + Intronic
965782285 3:172298775-172298797 ATTATCATGTGAGGTGAGTTAGG + Exonic
967510560 3:190306272-190306294 CTTATCTTCTGCAGTGAGTATGG - Exonic
968859871 4:3159033-3159055 CTTCTCAGCTGAAGTGCGTTTGG + Intronic
972076320 4:35093314-35093336 CTTATCATCAGAAATTCATTTGG + Intergenic
972177114 4:36421312-36421334 TTTATGCTCAGAAGTAAGTTTGG + Intergenic
975958536 4:79872706-79872728 CTTTTCTTCAGAGGTGAGTAAGG - Intergenic
976580728 4:86732877-86732899 CTAGTCAGTAGAAGTGAGTTAGG + Intronic
979741882 4:124161275-124161297 CTGACCATCAGAAGTGAGCGAGG + Intergenic
981899628 4:149847574-149847596 TTTATTATAAGGAGTGAGTTAGG - Intergenic
982375615 4:154687630-154687652 CTTATCATCAGAAATACTTTTGG - Intronic
984457957 4:179995181-179995203 CTGATCTCCAGAAGTGAGTTAGG + Intergenic
984508103 4:180645360-180645382 TTTATCATCAAAAGTCAATTGGG + Intergenic
984644588 4:182205817-182205839 TTCCTCATCAGATGTGAGTTGGG - Intronic
984904528 4:184614465-184614487 CATAGCTTCAGAAGAGAGTTTGG + Intergenic
986081785 5:4402157-4402179 CTTGTCATTAGAGCTGAGTTAGG - Intergenic
988101121 5:26680251-26680273 CATAGCTTCAGAAGAGAGTTTGG + Intergenic
988124785 5:27015941-27015963 GTCATCATCAGAACTGACTTAGG + Intronic
991256573 5:64621085-64621107 CTAATCATCAGAAGCAAGGTGGG - Intergenic
992232125 5:74673666-74673688 CTTGAATTCAGAAGTGAGTTAGG + Intronic
992446012 5:76834270-76834292 CCAATCAACAGCAGTGAGTTGGG + Exonic
994836610 5:104863129-104863151 ATTTTCATCAGTAATGAGTTTGG + Intergenic
995809395 5:116087290-116087312 CTTTTCAGCAGAAGTAATTTTGG + Intronic
997440267 5:133904378-133904400 CTTATTATCTGTAGTCAGTTTGG - Intergenic
999779428 5:154837083-154837105 CTTTTGATCAGAAGTGGGATAGG - Intronic
1000800576 5:165721040-165721062 CTTATGATGCTAAGTGAGTTCGG - Intergenic
1014572302 6:123024760-123024782 TTTAACATCAGAAGTATGTTGGG + Intronic
1015757923 6:136626804-136626826 CTTATGATGATAAGTGAGGTGGG - Intronic
1018303977 6:162434788-162434810 GTATTCATCATAAGTGAGTTTGG + Intronic
1018591762 6:165433656-165433678 CTTATCATAAGAAATGAAATTGG + Intronic
1020932203 7:14412214-14412236 TTTATCACCAGAAGTTAGTATGG - Intronic
1024787024 7:52919606-52919628 CTAATCATCAGAATTGAAATTGG - Intergenic
1028392093 7:90328384-90328406 CTTATAATCACAAATGAATTAGG + Intergenic
1028605554 7:92651537-92651559 ATAAAGATCAGAAGTGAGTTAGG + Intronic
1028741113 7:94276962-94276984 CTTATCATCAGTATTGCCTTGGG + Intergenic
1032918170 7:136514612-136514634 TTTATCATCAGAAAAGACTTAGG + Intergenic
1035568482 8:657698-657720 CTTTTCATCAGGAGTGAGGGTGG + Intronic
1040800937 8:51339147-51339169 ATTGTAATAAGAAGTGAGTTAGG - Intronic
1042609907 8:70587096-70587118 CTTACCTTTTGAAGTGAGTTGGG - Exonic
1047104392 8:121717451-121717473 GTTATAATTATAAGTGAGTTTGG + Intergenic
1048871003 8:138798681-138798703 CTTGTCATCAGAAATGATTGAGG - Intronic
1049984990 9:941957-941979 CTTATATCCAGAAGTGAGCTTGG + Intronic
1052476013 9:28960017-28960039 ATTTTCAGCATAAGTGAGTTAGG + Intergenic
1052871194 9:33508726-33508748 CTTATCAACAGAAACAAGTTGGG + Intergenic
1055984498 9:82042820-82042842 CTTATCATCAGTAGTGTATAAGG + Intergenic
1057465073 9:95306070-95306092 CTGATCAACAAAAATGAGTTTGG + Intronic
1061492240 9:130952013-130952035 CTTATGTTTAAAAGTGAGTTTGG - Intergenic
1185830501 X:3297841-3297863 ATTATCATCAGTATTGAATTTGG + Intergenic
1186680850 X:11871974-11871996 CTGATCACCAAAAATGAGTTAGG - Intergenic
1189117701 X:38359819-38359841 CTTATCATCAGAACTTGGTCAGG + Intronic
1191955259 X:66637122-66637144 GTTATCCACAGAAGTGAGATGGG + Intronic
1192022826 X:67412414-67412436 CTTATCATCATAAGTCATTCGGG - Intergenic
1192487261 X:71539263-71539285 ATCATCATGAGAAGTGACTTCGG - Intronic
1192573109 X:72222321-72222343 CTTTTCATCAGGAGTGAGGGTGG - Intronic
1192923822 X:75735144-75735166 CTTATCATCAGCAATCATTTTGG + Intergenic
1194448240 X:94012432-94012454 CTTATCTTCAGAAGTGTACTGGG + Intergenic
1195419814 X:104662096-104662118 CTTAGTAACAGATGTGAGTTAGG + Intronic
1196153358 X:112399625-112399647 ATTATCTTTAAAAGTGAGTTAGG + Intergenic
1196709443 X:118747417-118747439 CTTATCTTGTGAAGTGAGTAAGG + Intronic
1200139504 X:153892110-153892132 CTTTTCATCAGAAGTGAGCCAGG - Intronic
1201247421 Y:12019045-12019067 ATTATCATCAGTATTGAATTTGG - Intergenic
1202044618 Y:20725938-20725960 CTTATAATCAGAAATCATTTGGG + Intergenic