ID: 949941906

View in Genome Browser
Species Human (GRCh38)
Location 3:9161563-9161585
Sequence CAGCATTTATTGAGTGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 206}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949941906_949941908 6 Left 949941906 3:9161563-9161585 CCTTGGGCACTCAATAAATGCTG 0: 1
1: 0
2: 3
3: 46
4: 206
Right 949941908 3:9161592-9161614 GTCCTTTCTGCAGCTCCAGGAGG 0: 1
1: 1
2: 3
3: 26
4: 270
949941906_949941910 14 Left 949941906 3:9161563-9161585 CCTTGGGCACTCAATAAATGCTG 0: 1
1: 0
2: 3
3: 46
4: 206
Right 949941910 3:9161600-9161622 TGCAGCTCCAGGAGGTTTCTCGG 0: 1
1: 0
2: 1
3: 19
4: 257
949941906_949941907 3 Left 949941906 3:9161563-9161585 CCTTGGGCACTCAATAAATGCTG 0: 1
1: 0
2: 3
3: 46
4: 206
Right 949941907 3:9161589-9161611 TGAGTCCTTTCTGCAGCTCCAGG 0: 1
1: 0
2: 3
3: 25
4: 305
949941906_949941912 22 Left 949941906 3:9161563-9161585 CCTTGGGCACTCAATAAATGCTG 0: 1
1: 0
2: 3
3: 46
4: 206
Right 949941912 3:9161608-9161630 CAGGAGGTTTCTCGGAAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 151
949941906_949941913 23 Left 949941906 3:9161563-9161585 CCTTGGGCACTCAATAAATGCTG 0: 1
1: 0
2: 3
3: 46
4: 206
Right 949941913 3:9161609-9161631 AGGAGGTTTCTCGGAAACCAGGG 0: 1
1: 0
2: 1
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949941906 Original CRISPR CAGCATTTATTGAGTGCCCA AGG (reversed) Intronic
902080506 1:13817522-13817544 CTGCATTCATTGTGTCCCCAAGG + Intronic
902405735 1:16182362-16182384 AAGCATTTATTGAGCACCCATGG + Intergenic
902515699 1:16988329-16988351 CAGTATTGAGTGCGTGCCCATGG - Exonic
902803251 1:18844501-18844523 CAGCATTTTTTGGGAGGCCAAGG + Intronic
904609620 1:31718199-31718221 GAGCATTTATTGAGAGCCTGTGG - Intergenic
904780990 1:32947694-32947716 TTGCATTTAGTGAGTTCCCAAGG - Intronic
906293833 1:44636891-44636913 CAGAATTGGTTGGGTGCCCAGGG + Intronic
906965433 1:50451933-50451955 CAGCTTTTGTTTGGTGCCCAGGG - Intronic
910125973 1:83842906-83842928 TAACATTTATTGAGTGCCCTCGG - Intergenic
910532334 1:88251770-88251792 CAGCATTTATTGAGAACCTATGG - Intergenic
911817547 1:102372495-102372517 TAGCACTTATTGAGCCCCCATGG - Intergenic
911889838 1:103354180-103354202 CAGCACTTACTGAGAGGCCAAGG - Intergenic
912336055 1:108863947-108863969 CAGCATTTATTGTATCTCCAGGG + Intronic
912735979 1:112149827-112149849 CAGCTGGCATTGAGTGCCCATGG - Intergenic
913199080 1:116481834-116481856 CAACATTTATTGTGTGCTCACGG - Intergenic
913976800 1:143465455-143465477 TAACATTTATTGAGCGCCTACGG + Intergenic
914071202 1:144291082-144291104 TAACATTTATTGAGCGCCTACGG + Intergenic
914107953 1:144675273-144675295 TAACATTTATTGAGCGCCTACGG - Intergenic
915913196 1:159926909-159926931 GAACATTTATTGAGTGCTTACGG - Intergenic
917601285 1:176576914-176576936 CTGCATTTATTCAGTTCCCCGGG + Intronic
921019746 1:211225014-211225036 CAGATTTTATTCAGGGCCCAGGG - Intergenic
921819385 1:219599893-219599915 CATCATTTATTCAGTACCCAAGG - Intergenic
1063303218 10:4872659-4872681 CAATATGTATTGAGTACCCAGGG + Intergenic
1063506946 10:6608148-6608170 AAGCATTTCTTGAGTTTCCAGGG - Intergenic
1063815547 10:9767484-9767506 CACCATATATTGAGCGGCCAAGG + Intergenic
1064300255 10:14116988-14117010 CATCACTGATTGAGGGCCCAGGG + Intronic
1067904196 10:50273673-50273695 CAGCATTGAATGAATGCACAGGG + Intergenic
1068896121 10:62203701-62203723 GAACATTTATTGAGTGTCTAGGG + Intronic
1069843676 10:71355879-71355901 CAGCATTTCCTGAGTTTCCAAGG - Intronic
1069857507 10:71449581-71449603 CAGCATTTATTGACTGTTCAAGG + Intronic
1071952630 10:90722615-90722637 CAGCATTTATTGAGTACAACTGG + Intergenic
1074310206 10:112315788-112315810 CACCATTTGTTGAGTGCCTGTGG - Intergenic
1074869518 10:117565770-117565792 TAGCATTTATTGAGCACCTATGG - Intergenic
1074869700 10:117567065-117567087 TAGCATTTATTGAGCTCCTATGG - Intergenic
1077630695 11:3809140-3809162 CCACATTTACTGAGTGCCTACGG - Intronic
1081253537 11:40864614-40864636 CTGCTCTTATTGTGTGCCCATGG + Intronic
1082987103 11:59178480-59178502 TAGCAGTTAATGAGTGCTCAGGG + Intronic
1084116562 11:67046002-67046024 TAGCAGTTATTGAGTGCCACTGG + Intronic
1085202702 11:74711317-74711339 CAGCATTTAATGAGGGTTCATGG + Intronic
1085374803 11:76049954-76049976 CACTATTAATTTAGTGCCCATGG - Intronic
1088226264 11:107623475-107623497 TAACATTTATTGAGTGCCCGTGG - Intronic
1088463431 11:110107774-110107796 CAGCACTTATTGAGAGGCCAAGG - Intronic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1089693638 11:120202380-120202402 CAGCAGTAATTGAGTCCCCTCGG + Intergenic
1089922641 11:122224784-122224806 CAGCATGTCTGGAGTGCCCAAGG + Intergenic
1090250506 11:125247577-125247599 AAGCATTTATTGAGTGCAAAAGG - Intronic
1090978263 11:131694330-131694352 CAACATTTATTCAGTCTCCACGG + Intronic
1093985537 12:25528317-25528339 TAACATTTATTGAGTGACCTTGG - Intronic
1095331916 12:40976502-40976524 AAGGATTTATTGAGAGCGCATGG + Intronic
1096057876 12:48669950-48669972 CAGCACTTTTTGGGAGCCCAAGG + Intronic
1097088880 12:56489242-56489264 TAGCTATTATTGAGTGCCCATGG + Intergenic
1097428364 12:59473679-59473701 CAGATTTTGTTGAGGGCCCAGGG - Intergenic
1101064196 12:101002404-101002426 CAGCTTTTAATGATTCCCCAGGG + Intronic
1101876987 12:108602663-108602685 AAGCATTTATGGAGCACCCATGG - Intergenic
1106355803 13:28981959-28981981 CAGCCTTTCTTGAATGCCCTAGG + Intronic
1108959104 13:56200971-56200993 CAGGATTGCTTGTGTGCCCAAGG - Intergenic
1114733157 14:25016123-25016145 TAGCATTTATTGAGCGTGCATGG - Intronic
1116550836 14:46235670-46235692 AGGCATTTTTTGATTGCCCACGG + Intergenic
1119382081 14:74235634-74235656 CACAATGTATTGAGTCCCCAGGG + Intergenic
1119800679 14:77442298-77442320 CATCATTCATTGAGTGACCTTGG - Intronic
1121043793 14:90773582-90773604 GAGCATTTATTGAGCGCTGATGG - Intronic
1124072318 15:26407117-26407139 AAGCATTTTTAGAGTTCCCAGGG - Intergenic
1125186917 15:36941315-36941337 CAGGGATTCTTGAGTGCCCATGG - Intronic
1127431386 15:58912727-58912749 AAGCATTGATTTAGTACCCATGG - Intronic
1128064835 15:64758134-64758156 AAGCATTTAAAGAGTGCACAGGG + Intronic
1128208296 15:65871864-65871886 TACCATTTATTGAGTCCTCATGG - Intronic
1128459044 15:67852506-67852528 GAGCATTTATTGAGTGCCTCAGG - Intergenic
1128639318 15:69324504-69324526 CATCATTTACTGTGTGCCCTTGG - Intronic
1128792071 15:70440842-70440864 AAGCAGGTATTGAGAGCCCAGGG + Intergenic
1128922953 15:71628925-71628947 TAATATTTATTGAGTGCCTATGG + Intronic
1131526948 15:93160103-93160125 CTGCATTGATTGAATGCCCAGGG - Intergenic
1132146888 15:99434571-99434593 AAACATTTATCGAGTGCCTATGG - Intergenic
1132984799 16:2759716-2759738 TAATATTTATTGAGCGCCCACGG + Intronic
1133601370 16:7343143-7343165 TAACATTTATTAAGCGCCCACGG - Intronic
1133682823 16:8136526-8136548 AAAGATTTATTGAGTGCCTATGG - Intergenic
1133898938 16:9955052-9955074 AAGGATTTATTGACTGCCCATGG - Intronic
1135467442 16:22699331-22699353 AAGCATTTATTGAGCACCAATGG - Intergenic
1135511174 16:23084824-23084846 CAGCATTTCTTGGTTGCTCAGGG - Intronic
1135680029 16:24448433-24448455 AAGCATTTGTTGAATGCCCTGGG + Intergenic
1135776189 16:25258697-25258719 CAGCCTTCATTCAGTGGCCATGG + Intergenic
1137474259 16:48793234-48793256 CAGCATTCTTTGAGTGCTTATGG + Intergenic
1137845215 16:51680962-51680984 CTGCATGTATTGAGTGGCCATGG + Intergenic
1138698955 16:58842776-58842798 AAGTACTTATTGAGTGCCTAGGG + Intergenic
1140841968 16:78848247-78848269 CAGCACTGATTGGGAGCCCACGG - Intronic
1143109780 17:4546500-4546522 CTGCCTTTCTTGAGTGTCCAAGG - Intronic
1144998644 17:19288272-19288294 CTGTATTTATTGAGTTCCCATGG + Intronic
1146358725 17:32157272-32157294 CTGCATTTATTAAGTGCCATGGG + Intronic
1147898995 17:43771573-43771595 TAACATTTATTGAGTGCACATGG - Intronic
1149852618 17:60048906-60048928 AAGCATTTATTGGGTGCCTAAGG + Intronic
1151092686 17:71460879-71460901 AAGCATTTATTGAGCTCCCGGGG + Intergenic
1151391229 17:73787945-73787967 AAGCATTAATTGAGTACCCAGGG + Intergenic
1151644195 17:75418694-75418716 CAGCATGTTTTGTGTGCCGAAGG + Intergenic
1152512687 17:80801217-80801239 AAGCATTTACTGAGCCCCCATGG + Intronic
1152724743 17:81939658-81939680 CAGCATTTATTTCCTGCTCAAGG + Exonic
1153225039 18:2893486-2893508 AAACATTTGTTGAGTGCCTAAGG - Intronic
1153269451 18:3305519-3305541 CTGCATTTATTCAGGGCCTAGGG + Intergenic
1155446046 18:25913845-25913867 CAGCATTTATGGAGCACACAGGG - Intergenic
1157790531 18:50527349-50527371 CATCATTTTTTAAGTGCCCAAGG + Intergenic
1160482521 18:79255167-79255189 CGGCATGTATTGAGTGCCACAGG + Intronic
1162490686 19:10989572-10989594 CTGCAGTGATTGAGTGCCCATGG - Intronic
1162533863 19:11251941-11251963 AAACATTTATTGAGTGCTTAGGG - Intronic
1165662464 19:37593824-37593846 CATCATTTATGGGGTGCCTAAGG + Intronic
1167568813 19:50274120-50274142 CGGCATTTATTGAGGGCTCAGGG - Intronic
926056447 2:9776829-9776851 CAGCATTTATTAAGTACCTATGG - Intergenic
926757979 2:16251324-16251346 CAGCAATTAGAAAGTGCCCAGGG - Intergenic
928693480 2:33824660-33824682 AAGCTCTGATTGAGTGCCCAGGG + Intergenic
929045442 2:37784674-37784696 CAGCATTTATGGAGGCTCCAAGG - Intergenic
930109578 2:47667173-47667195 AAGCATTTCTTGAGTACCCAGGG + Intergenic
930132255 2:47864210-47864232 AAGCATTTATTAAGTACTCACGG + Intronic
930550679 2:52830990-52831012 AAGCATTTATCCAGTACCCAGGG - Intergenic
932377823 2:71253777-71253799 CAGCAAATATGGTGTGCCCATGG - Intergenic
932777348 2:74536187-74536209 AAGCATATATTGTCTGCCCAGGG + Intronic
932815898 2:74861449-74861471 TAGCATTTAATGAGCACCCATGG + Intronic
933887393 2:86731458-86731480 TAACATTTATTGAGTGCTGAAGG - Intronic
933891526 2:86775867-86775889 CAGCATTTATGGAGTTTCTAGGG - Exonic
933922782 2:87065255-87065277 TAACATTTATTGAGTGCTGAAGG + Intergenic
934291804 2:91700659-91700681 TAACATTTATTGAGCGCCTACGG + Intergenic
934608973 2:95720582-95720604 GAACATTCATTCAGTGCCCAGGG - Intergenic
935360717 2:102244407-102244429 AAGCATTTATTTATTGGCCATGG - Intergenic
936542284 2:113362107-113362129 GAACATTCATTCAGTGCCCAGGG - Intergenic
936818846 2:116493512-116493534 CATCATTTACTGTGTGGCCATGG + Intergenic
936849806 2:116882024-116882046 CAGGATTTATTAGGTGCCCTTGG + Intergenic
937506456 2:122543061-122543083 AAACATTTATTGAATGCCTATGG + Intergenic
939567678 2:143803845-143803867 TTGCATTTATTGAGTGCCAGTGG + Intergenic
940772739 2:157856547-157856569 AAGTATTTATTGAGTGCCTGTGG + Intronic
944437554 2:199706415-199706437 GAGCATTAACAGAGTGCCCAAGG - Intergenic
945552928 2:211243326-211243348 CAACATATATTGAATGCCAAAGG + Intergenic
946085958 2:217171709-217171731 CAGCAATTAATGAGCTCCCAAGG - Intergenic
946347447 2:219122509-219122531 CAGCATTTATTGAATACCACTGG - Intronic
1169190704 20:3657601-3657623 CAGCATTTATGGACTGTCCCAGG - Intergenic
1169694822 20:8375633-8375655 CAGCATGTATTGAGTGCTTAGGG + Intronic
1173018336 20:39246755-39246777 CAGCAAAGACTGAGTGCCCAAGG - Intergenic
1173370299 20:42429009-42429031 CATCATTTATTGAGTGCCTTTGG + Intronic
1175187060 20:57185818-57185840 TAGCATTTATTGAGTACTTAGGG - Intronic
1175187064 20:57185863-57185885 TAGCATTTATTGAGTACTTAGGG - Intronic
1175187076 20:57185998-57186020 TAGCATTTATTGAGTACTTAGGG - Intronic
1175267656 20:57712184-57712206 TACCATTTATTGAGTGCTGATGG + Intergenic
1178519092 21:33272287-33272309 CAACATTTATTAAGTACACAGGG - Intronic
1178684617 21:34701490-34701512 CTACCTTTATTGGGTGCCCAGGG + Intronic
1180154464 21:45971324-45971346 CAGTACTCAGTGAGTGCCCAGGG - Intergenic
1181610856 22:24010950-24010972 CATCATTTAGTGACTGCTCAGGG + Intergenic
1183660012 22:39214074-39214096 CAACATGAAGTGAGTGCCCATGG + Intergenic
949649422 3:6138623-6138645 CATCATTAATATAGTGCCCATGG - Intergenic
949941906 3:9161563-9161585 CAGCATTTATTGAGTGCCCAAGG - Intronic
949945478 3:9186439-9186461 AAGCATTTATTGAGCGTCCCAGG - Intronic
951776119 3:26312255-26312277 GACCATCCATTGAGTGCCCAAGG + Intergenic
952542437 3:34380420-34380442 AAGCATTTATTATGAGCCCAAGG - Intergenic
953905531 3:46866609-46866631 CAGCATTTATTGAATGCCTGTGG - Intronic
954190892 3:48959836-48959858 CAGCATATAATGAGTGTCAAAGG - Intronic
958578365 3:95983411-95983433 CACCATTAAATGAGTGCCAAAGG - Intergenic
960617363 3:119608102-119608124 AAGCATTTATTGAGTACCTATGG - Intronic
962437179 3:135377873-135377895 CAACATTTATTCAGTGTTCATGG + Intergenic
964277115 3:155020544-155020566 CGGCTTTTATAGAGTGCCAAAGG + Intergenic
964660182 3:159112093-159112115 GAGGATTTATTGAGTGCCTATGG - Intronic
965121077 3:164558515-164558537 CAGCATTTATTTATTGCCTCTGG + Intergenic
967484350 3:190013001-190013023 CAGTCCTTATTGAGAGCCCAAGG - Intronic
967867134 3:194199296-194199318 TAACATTTATTGAGTGTCTATGG - Intergenic
969071464 4:4542442-4542464 CAGCATTTATTGCATCCCGAGGG - Intergenic
970074962 4:12207682-12207704 ATGCATTTATTGAATGCCTAGGG - Intergenic
970172858 4:13306500-13306522 CAGCTTTTGTTGGGAGCCCACGG + Intergenic
970663997 4:18316367-18316389 TAGCATCTAGTGAGTGGCCAAGG + Intergenic
973327400 4:48877598-48877620 CAGTATCTCTTGTGTGCCCATGG - Intergenic
973766480 4:54167858-54167880 CAGCATTTTTTGGGAGGCCAAGG - Intronic
974095003 4:57353236-57353258 CTGCATTCAATGTGTGCCCAAGG - Intergenic
974768216 4:66376397-66376419 AAGTATTTATTGAGTTCCAATGG + Intergenic
976420477 4:84837830-84837852 AAACATTTATTGAGTGTCCAGGG + Intronic
977572257 4:98640869-98640891 CAGCATTCACTGAGTGCTCAGGG + Intronic
977574572 4:98662623-98662645 CAGCATTTATTGAGTTGTGAAGG - Intergenic
977722146 4:100251659-100251681 CAACATTTATTGAGTGCCTTAGG - Intergenic
979962194 4:127034456-127034478 CAGCATTTAGAGAGTCCCTAAGG + Intergenic
981121436 4:141055947-141055969 CAGCATTTATTAAATACCTATGG + Intronic
984331339 4:178323845-178323867 CAGCATGTATTGATTGCTCATGG + Intergenic
986631147 5:9775344-9775366 CAGCATTTCTGGACTGCCCTGGG - Intergenic
986762143 5:10889878-10889900 CAGCATTCCTTCAGTGCTCATGG + Intergenic
987684885 5:21184002-21184024 CAGCATTTATGTATTGCACAAGG - Intergenic
988357835 5:30200422-30200444 CAGATTTTATTCAGGGCCCAGGG - Intergenic
989263091 5:39441203-39441225 CAGCATTGTTTGGATGCCCAAGG - Intronic
989539001 5:42597116-42597138 TAGCATTTTTCTAGTGCCCATGG + Intronic
990533402 5:56696074-56696096 AAACATTTATCGAGTGCCCTTGG - Intergenic
992325517 5:75655862-75655884 CAGCATTTATTGTCATCCCAAGG - Intronic
994196064 5:96924273-96924295 CACCATTTATGGAGGGCCCCTGG - Intronic
995522730 5:113026404-113026426 CAGCAATTATGTAGTGCCCTGGG + Intronic
996673423 5:126147247-126147269 CAGTATTTACTGAGTGCTTATGG - Intergenic
996716705 5:126594171-126594193 CAGCATTTCTCCATTGCCCAGGG - Intronic
998104000 5:139456894-139456916 CAGGACTTGTTGAGTGCCCAGGG - Intronic
998267761 5:140678923-140678945 CAGAATCTATTGAGTACTCACGG - Intronic
999634246 5:153603548-153603570 CAGTATTTATTGAGTGCCTAAGG + Intronic
999683115 5:154078224-154078246 CAGCATTTATTGAGTTCATATGG - Intronic
999689278 5:154132790-154132812 CAGCATTGATTGAGTGAGGAAGG + Intronic
999708489 5:154295291-154295313 CAGCATTTATTGAACACCTATGG + Intronic
1000258274 5:159561266-159561288 CAGCCTTTAGTGACTGCCCTCGG - Intergenic
1003145906 6:3510625-3510647 CACCATTCATAGAGTGCTCACGG + Intergenic
1003181281 6:3794032-3794054 CAGCATTTATTCACAGGCCAAGG + Intergenic
1003392803 6:5727986-5728008 TAGCATCCATTAAGTGCCCACGG - Intronic
1004520970 6:16360167-16360189 CAGCAGATATTGAGAACCCATGG - Intronic
1004532763 6:16469092-16469114 AAGCATTTATTGGGTGCCCACGG - Intronic
1005008392 6:21312645-21312667 CAACATTTGTTAAGTGCCCTTGG - Intergenic
1006851100 6:37099271-37099293 CAGCAGTAAATGAGTGCCTATGG - Intergenic
1008966134 6:57314564-57314586 AAGTATTTATTGAGGGCCCATGG + Intergenic
1009566267 6:65314701-65314723 CATCATTTATTCAGTACCCAAGG + Intronic
1012374988 6:98551199-98551221 AAGGATTTATTGAGTGCCACGGG + Intergenic
1016783000 6:147980574-147980596 TAGCATTTCTTGAGTGACTAAGG + Intergenic
1017903071 6:158734832-158734854 TACCATTTATTGAAAGCCCAAGG + Intronic
1018430082 6:163715247-163715269 CTGCATTTATCGAGTGCAGAAGG + Intergenic
1020150599 7:5679093-5679115 TACCATTTATTGAGTGCTTATGG + Intronic
1023808069 7:43889083-43889105 CAGCAATTAGTGAGTCCACATGG + Intronic
1023998419 7:45175969-45175991 CAGCACTTGCTCAGTGCCCAGGG + Intronic
1026463904 7:70637449-70637471 AAGCACTTATTGACTGCCCATGG - Intronic
1027430988 7:78112695-78112717 CAATATTTACTGAGTGCCCCAGG + Intronic
1028099497 7:86802052-86802074 TAGCATTTATTGATTGCCACTGG + Intronic
1033985989 7:147226232-147226254 CATCTTTTATTGAGGGCCTATGG - Intronic
1034051584 7:147989700-147989722 CTGCATTTTCTGAGTCCCCAGGG + Intronic
1035319946 7:158022338-158022360 CATCCTTTAATGAGGGCCCAAGG + Intronic
1036477626 8:9107931-9107953 CAGCACTTTTTGAGAGGCCAAGG - Intronic
1039040362 8:33402092-33402114 CAGCAATTACTGAGTGCCTTAGG - Intronic
1039958924 8:42229709-42229731 CAGCATTTACAGATTGCACATGG + Intergenic
1041247149 8:55899524-55899546 GAACATTTATTGAGTGCACACGG + Intronic
1041635188 8:60134695-60134717 TGGTATTTATTGAATGCCCACGG + Intergenic
1041667941 8:60464132-60464154 AAGCATTTATTGAGTGCCCTGGG + Intergenic
1043061024 8:75503239-75503261 GAGCATTTAGTAATTGCCCAAGG - Intronic
1045844693 8:106620122-106620144 AAGCACTTATTAAGTGCCTATGG - Intronic
1046062183 8:109152680-109152702 CAGCATTTTTCGAGTACCCTAGG - Intergenic
1046551855 8:115728163-115728185 CAGAATTTATTAAGTGAGCAAGG - Intronic
1046625066 8:116568090-116568112 AAGCATTGATTGAGTGCCTATGG + Intergenic
1046928305 8:119817077-119817099 AAGCATTTACTAAGTGGCCATGG + Intronic
1047311727 8:123697814-123697836 GAGCATTTGTTGAGGCCCCATGG - Intronic
1047449057 8:124946355-124946377 TAGCATTTTTTCATTGCCCATGG + Intergenic
1048200443 8:132369699-132369721 CACCATTTGCTGAGTGCTCATGG - Intronic
1048645888 8:136418625-136418647 AAGCCTTTATTGAGTGAACAGGG - Intergenic
1048876705 8:138842272-138842294 GAGCATTTACTGTGTGCCAAAGG - Intronic
1050379773 9:5015780-5015802 AAACATTTACTGAGTGCCTATGG + Intronic
1050930278 9:11313368-11313390 CAGAATTCATCCAGTGCCCAAGG - Intergenic
1051383660 9:16483937-16483959 CAGGATTTATTAAGTACCCATGG - Intronic
1052713694 9:32089266-32089288 CTGCATTTATTAAGTTCCCTAGG - Intergenic
1052792294 9:32886889-32886911 CAGCACTTATTGGGTGCCTGTGG + Intergenic
1053293939 9:36899916-36899938 CAGCATTAAATGAAAGCCCAAGG - Intronic
1054978973 9:71181917-71181939 CTGCATTTATTGAGTGGCCCAGG - Intronic
1056548811 9:87634938-87634960 CAGCATTTATTGAGCACTAAGGG + Intronic
1059337472 9:113578269-113578291 TATCGTTTATTGAGTGCTCATGG + Intronic
1059354412 9:113687848-113687870 GAGCGTTTATGGAGAGCCCAGGG - Intergenic
1059682666 9:116601369-116601391 AAATATTTATTGAGTGCCCATGG + Intronic
1060792383 9:126495237-126495259 TAGCATTTATTCAGTGGCCAGGG + Intronic
1061485923 9:130920516-130920538 AAGCATTTAGAGAGTGCCGAGGG + Intronic
1061860725 9:133467459-133467481 GAGCATTTATTTAGTGCCTGTGG + Intronic
1062475351 9:136724024-136724046 CAGCTTTTATGTAATGCCCAGGG + Exonic
1186543807 X:10427745-10427767 CATCATTTATAAAGTGGCCATGG - Intergenic
1187188108 X:17007182-17007204 CAGGATTTATGGTGAGCCCATGG + Intronic
1193212672 X:78826114-78826136 TAGAATTTTTTGCGTGCCCAGGG + Intergenic
1195776937 X:108416766-108416788 CTGCATTTTTTAAGTGCCTATGG + Intronic
1196651564 X:118173411-118173433 CAGCTTTGTTTGAGAGCCCATGG + Intergenic
1197846193 X:130805637-130805659 CAGCATGTATTGAGTGTCTATGG - Intronic
1198427535 X:136535080-136535102 CAGCATGTCTTGAGGGCCCACGG + Intronic
1199403899 X:147433090-147433112 GAGCATTTATTGCATGTCCAGGG - Intergenic
1200880784 Y:8209592-8209614 CAGATTTTGTTCAGTGCCCAGGG + Intergenic
1202089862 Y:21178202-21178224 CAGATTTTGTTGAGGGCCCAGGG + Intergenic
1202147180 Y:21810585-21810607 CTGCTTTTATTTAGTGCCCCTGG - Intergenic