ID: 949942125

View in Genome Browser
Species Human (GRCh38)
Location 3:9163244-9163266
Sequence GCATCAGCGCCCACTCTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 46}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949942115_949942125 20 Left 949942115 3:9163201-9163223 CCACATGAGAGGAGCCAGTCTGT 0: 1
1: 0
2: 2
3: 24
4: 781
Right 949942125 3:9163244-9163266 GCATCAGCGCCCACTCTCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 46
949942118_949942125 6 Left 949942118 3:9163215-9163237 CCAGTCTGTCCGGGCCAAACCCA 0: 1
1: 0
2: 0
3: 11
4: 147
Right 949942125 3:9163244-9163266 GCATCAGCGCCCACTCTCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 46
949942121_949942125 -8 Left 949942121 3:9163229-9163251 CCAAACCCAACACAGGCATCAGC 0: 1
1: 0
2: 2
3: 16
4: 201
Right 949942125 3:9163244-9163266 GCATCAGCGCCCACTCTCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 46
949942120_949942125 -3 Left 949942120 3:9163224-9163246 CCGGGCCAAACCCAACACAGGCA 0: 1
1: 0
2: 2
3: 23
4: 193
Right 949942125 3:9163244-9163266 GCATCAGCGCCCACTCTCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949942125 Original CRISPR GCATCAGCGCCCACTCTCGT GGG Intronic
903838678 1:26222783-26222805 TCATCAGCTTCCACTCTGGTTGG + Intergenic
904420146 1:30385938-30385960 CCATCAGAGCCCAGTCTCCTGGG - Intergenic
1074454913 10:113588385-113588407 ACCTCAGAGCCCACTCTCCTTGG + Exonic
1075376092 10:121978857-121978879 GCCTCAGCGCCCACTCTGGCCGG - Intergenic
1076374405 10:129973414-129973436 GGATGAGCGCACACTCCCGTGGG + Intergenic
1083484392 11:62974336-62974358 GCATCTGAGGCCACTCTGGTGGG + Intronic
1083748274 11:64746784-64746806 CCATCCGCGTCCACTCTCTTGGG + Exonic
1100985415 12:100198568-100198590 GCATCCCTGCCCACTCTCGGAGG + Intergenic
1135775791 16:25257018-25257040 GCATCAGAGCCCATTCTGGAAGG - Exonic
1140279822 16:73544306-73544328 GCATCAGAGCACAGTCTCTTTGG + Intergenic
1144961248 17:19045354-19045376 GCTTCATCGCCCACTCTCCCAGG + Intronic
1144973913 17:19129170-19129192 GCTTCATCGCCCACTCTCCCAGG - Intronic
1146398527 17:32486869-32486891 GCCTCAGCGCCCTCCCTCGCGGG - Exonic
1152862295 17:82703423-82703445 GCACCAGCGCCCACCCCCGACGG + Intergenic
1154092555 18:11378907-11378929 GCATCCTCTCCCACTCTTGTCGG - Intergenic
1160932953 19:1579243-1579265 GCAGCAGCCCCCACCCTCGCAGG + Intronic
1163723762 19:18910964-18910986 GCCTCACCTCCGACTCTCGTGGG + Exonic
926437736 2:12854552-12854574 GCCTCGGCGCCCACTCTGGCCGG - Intergenic
932494296 2:72138851-72138873 GGATCAGCTCCCACTCTGGAGGG - Intronic
935561801 2:104567538-104567560 GCAGCAGCACCCACTCTCAGGGG - Intergenic
948846491 2:240685197-240685219 GCAGGAGGGTCCACTCTCGTGGG + Intergenic
948847371 2:240689536-240689558 GCAGGAGGGTCCACTCTCGTGGG - Intergenic
1171332172 20:24350110-24350132 GCATCAGCCCATACTCTCATCGG + Intergenic
1171389838 20:24794367-24794389 GCCTCAGGGCCCACACTCCTTGG - Intergenic
1173482758 20:43416290-43416312 GCATCAGCAGCCACCCGCGTGGG - Intergenic
1174564677 20:51456449-51456471 GCTCCAGCGCCCAATCTCTTAGG + Intronic
1175400580 20:58697898-58697920 GCTTCAGAGCCCACACTCGAAGG - Intronic
1175501768 20:59455914-59455936 GCAACAGCACCCTCTCTGGTCGG + Intergenic
1177207204 21:18023547-18023569 GCATCTGGGTCCACTCTTGTTGG + Intronic
1181643212 22:24215673-24215695 CCATCATCACCGACTCTCGTGGG - Intergenic
949942125 3:9163244-9163266 GCATCAGCGCCCACTCTCGTGGG + Intronic
953820468 3:46203719-46203741 GAAACAGCTTCCACTCTCGTAGG + Exonic
967782681 3:193457105-193457127 GCATCAGTTCCCATTCTCATCGG - Exonic
969095487 4:4729396-4729418 GCACCAGCGCCCACCCAGGTTGG - Intergenic
973289161 4:48453383-48453405 GCAACATCCCCCACTCTGGTGGG + Intergenic
984734404 4:183097674-183097696 GCATCTGCGGCCAATCTCGAAGG - Intergenic
997228304 5:132226051-132226073 GCCTCAGCGCCCAGTCTCTCTGG - Intronic
1007456817 6:41984626-41984648 GCATGAGCCACCACTCTCGGCGG + Intronic
1018175841 6:161178602-161178624 GCTTCAGCTCACACTCGCGTGGG + Intronic
1019998555 7:4741054-4741076 GCATCATCCCCCTCTCTCCTGGG - Intronic
1020112488 7:5455430-5455452 GCATCAAGGAGCACTCTCGTGGG + Intronic
1026975528 7:74495502-74495524 GCATCAACGGCCCCTCTCTTCGG + Intronic
1037616771 8:20526293-20526315 GCTGCAGAGCCCACTCTCCTTGG + Intergenic
1045098336 8:98821366-98821388 GCACCAGGGACCAGTCTCGTGGG - Intronic
1059404478 9:114091628-114091650 GCATCAGCTCCAAGTCTGGTTGG - Exonic
1062462067 9:136666238-136666260 GCCTCTGCGCCCTCCCTCGTGGG + Intronic
1189348259 X:40258738-40258760 CCATCAGCACCAACTCTCTTGGG - Intergenic
1195675328 X:107503275-107503297 GAATCAGGGCCCACTCTTGGAGG + Intergenic