ID: 949943573

View in Genome Browser
Species Human (GRCh38)
Location 3:9172999-9173021
Sequence AGGCAAACAGGAGAGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 572
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 535}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949943573 Original CRISPR AGGCAAACAGGAGAGGTGGT GGG Intronic
900857800 1:5200008-5200030 AAGCAAAGAGGAGAGGTTGTGGG + Intergenic
902150806 1:14441819-14441841 AAGCAAAAAGGAGAGTTGGGAGG + Intergenic
902548263 1:17204036-17204058 AGGGTAACAGGGAAGGTGGTGGG - Intergenic
903761668 1:25702831-25702853 AGGGAAGCAGGAGAGTTGGGTGG + Intronic
905258272 1:36699722-36699744 AGGCAAAGAAGAGAGGTGTTGGG - Intergenic
905466065 1:38154341-38154363 AGGCAAAAAGGAGAGGGTGGGGG - Intergenic
905551517 1:38844467-38844489 GAAGAAACAGGAGAGGTGGTCGG + Intronic
906209918 1:44007061-44007083 AGGCAAACTGGAGCTGGGGTTGG - Intronic
906417867 1:45635817-45635839 GGGCAAACGGCAGAGGAGGTGGG - Intronic
906694772 1:47816560-47816582 AGGCAAAGGGGAGAGATGATGGG - Intronic
907303590 1:53502375-53502397 AGGGAAAGAGGAGAGGGGGGAGG + Intergenic
907303618 1:53502455-53502477 AGGGAAAGAGGAGAGGGGGGAGG + Intergenic
907303652 1:53502554-53502576 AGGGAAAGAGGAGAGGGGGGAGG + Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907980380 1:59474507-59474529 ACTCAAACAGGAGAAGTGGCAGG - Intronic
908472080 1:64454002-64454024 AGGCTAACATGAGGGGTGGGTGG + Intergenic
908622453 1:65999377-65999399 TGGAGAACAGGAGAGGAGGTTGG - Intronic
908782248 1:67701052-67701074 AGGCAAGCAGGATAGGAGGGCGG + Intergenic
908810751 1:67979721-67979743 AGCCAAAGATGAGAGGGGGTGGG - Intergenic
909923687 1:81413149-81413171 AGGCAAACGGCTGAGGTGGGTGG - Intronic
910066198 1:83154209-83154231 AGCAAAACAAAAGAGGTGGTAGG - Intergenic
911240693 1:95462613-95462635 AGGCAGACAGGGGATCTGGTAGG + Intergenic
912510513 1:110186725-110186747 ATACAAACAGGAGAGGAGATGGG + Intronic
914844642 1:151275390-151275412 CTGCAACAAGGAGAGGTGGTGGG + Intergenic
915866786 1:159509580-159509602 AGACATATAGGAGAGGTAGTGGG - Intergenic
917021735 1:170595887-170595909 AGGCAAACAGAAAGGATGGTAGG + Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918533883 1:185552862-185552884 AAGCAAAAAGAAGGGGTGGTAGG - Intergenic
919021722 1:192114638-192114660 AAGCAAACAAGAGAGGGAGTGGG + Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922226065 1:223646794-223646816 AGGCAGAGAGCAGAGCTGGTAGG + Intronic
922721215 1:227901223-227901245 AGGTAACCAGGAGGGCTGGTGGG - Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923248724 1:232159905-232159927 AGTCAAATAGGAGGGGGGGTGGG + Intergenic
923291551 1:232551131-232551153 AAGCAAACAGTAGGGCTGGTGGG + Intronic
923521878 1:234741214-234741236 AGTCAAACTGGGCAGGTGGTAGG + Intergenic
1063123839 10:3123524-3123546 AGGCACACAGGAGGGCAGGTGGG - Intronic
1063429453 10:5976810-5976832 AGGAAACCAGCAGAGGCGGTCGG - Intronic
1063447339 10:6127638-6127660 TGGGAAACAGAAGAGGAGGTGGG + Intergenic
1064245089 10:13661765-13661787 AGGCAGACATGGGAGGTGGAGGG + Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1066426096 10:35308973-35308995 AGGAAAACAGGGAAGGTGGGTGG + Intronic
1067539044 10:47138362-47138384 AGAGACACAGGAGAGGTGATGGG - Intergenic
1067575804 10:47407561-47407583 GGGCCAATTGGAGAGGTGGTGGG + Intergenic
1068558670 10:58487127-58487149 AGGCTAACAGTGGGGGTGGTGGG - Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1070189352 10:74097471-74097493 AGACTAAAAGTAGAGGTGGTAGG - Intronic
1070351706 10:75598984-75599006 TGGCAAAGAGGAGAGGAGGTGGG + Intronic
1070365073 10:75728938-75728960 AGGCACAGAGGAGAGAAGGTGGG - Intronic
1070704222 10:78625933-78625955 AGGCAAACAGGTGAGGAGCGAGG - Intergenic
1070771906 10:79087499-79087521 ATGTAGACAGGAGAGGTGGCTGG - Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071819294 10:89264150-89264172 TGGCAAGCAGGGGGGGTGGTAGG + Intronic
1072187215 10:93051461-93051483 AGGCAAAAAAGTGAGGTGGCTGG + Intronic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1073453046 10:103620590-103620612 CTGCAAACAGCAGAGCTGGTCGG - Intronic
1073485452 10:103814977-103814999 AGGCCAACTGGGGAGGTGGGGGG + Intronic
1073515368 10:104071138-104071160 AGGGAAGCAGGAGAGGTGGGAGG + Intronic
1073592324 10:104769068-104769090 ATGAAAACAGGAGAGGTGGAAGG - Intronic
1075557636 10:123444921-123444943 AGGCAAAAAGGAGAGGGTGTGGG - Intergenic
1075623022 10:123941472-123941494 AGTCATACAGGAGTGGTGGTGGG - Intergenic
1076371013 10:129953692-129953714 AGGCCAACTGTAGGGGTGGTGGG - Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077524441 11:3056047-3056069 AGGCACACAGGTAGGGTGGTAGG + Intronic
1078611290 11:12821862-12821884 AGGCAGACAGCGGAGGAGGTAGG - Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079705570 11:23613176-23613198 AGGCAAAGAGGAAATGTGCTTGG + Intergenic
1080000758 11:27346416-27346438 AGGGAAACAGGAGGGGAGGGAGG + Intronic
1080669773 11:34365406-34365428 AAGCAAACAAGATAGGTTGTAGG + Intergenic
1081365972 11:42235501-42235523 AGGGAGACAGAATAGGTGGTAGG - Intergenic
1081676306 11:44972013-44972035 AGCCAAGCAGGAGATGGGGTGGG + Intergenic
1081789970 11:45775564-45775586 AGGCAAGCAGAAGAGGGGCTTGG - Intergenic
1083778506 11:64906296-64906318 AGGCTAGCAGGAGGGGTGGATGG + Intronic
1083791571 11:64989419-64989441 AGGCAAACAGGAGAGGGCTGGGG + Exonic
1083923637 11:65793433-65793455 AGGGAAACAGGCCAGGTGGGTGG - Intronic
1084296411 11:68215371-68215393 GGGCAGACAGGAGAAGTGCTTGG - Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085014927 11:73167693-73167715 AGGCCAAAAGGAGAGGGAGTGGG - Intergenic
1085067389 11:73509743-73509765 AGGCAAACTGAACAGGTGCTTGG + Intronic
1085169886 11:74440695-74440717 TGGCCAGCAGGAGAGGTGGTGGG - Intergenic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1087365083 11:97208578-97208600 AGGCAGCCAGGAGAGGAGGCGGG + Intergenic
1087890366 11:103531175-103531197 AAGAAAACAGGAGAGGATGTGGG + Intergenic
1088154238 11:106784155-106784177 AGGAAAGCAGCGGAGGTGGTGGG - Intronic
1088438088 11:109837674-109837696 AGGGAAACAGGAGGGTTGGGAGG - Intergenic
1088595045 11:111435140-111435162 AAGCAAACAGAAGATGTGTTTGG + Intronic
1088971198 11:114776025-114776047 AGACCCACAGGAGAGGTGTTTGG - Intergenic
1089641426 11:119849990-119850012 AGGCAAAGAGGAGAGGCTGCAGG + Intergenic
1090633367 11:128669954-128669976 TGGCCAACAGGAGATGTTGTTGG + Intergenic
1090663198 11:128895984-128896006 AGAGATGCAGGAGAGGTGGTTGG - Intronic
1090711138 11:129386862-129386884 AGGCAGACAGGAGTGGTGGCAGG - Intronic
1090968899 11:131622777-131622799 GGGCCAACAGGAGAGTTGCTGGG - Intronic
1091695050 12:2622789-2622811 CGGAACACAGGTGAGGTGGTGGG - Intronic
1091703570 12:2679417-2679439 AGGCAAGAAGGAGGGGTGGGTGG - Intronic
1092556296 12:9565755-9565777 AGGAAAACAGGAGAAATGGGGGG + Intergenic
1093003972 12:14032206-14032228 AGGCCAAGTGGAGAGGGGGTAGG - Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094515796 12:31124897-31124919 AGGAAAACAGGAGAAATGGGGGG - Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096518138 12:52169592-52169614 AGCCAATCAGGTGAGGTGGCTGG + Exonic
1096630899 12:52926155-52926177 GAGCGAGCAGGAGAGGTGGTGGG - Intronic
1097017039 12:55994454-55994476 AGGAAGGCAGAAGAGGTGGTAGG - Exonic
1097069709 12:56345993-56346015 AGGCAGAAAGGAGAGGCTGTGGG + Intronic
1097069837 12:56346773-56346795 AGGCAGAAAGGAGAGGCTGTGGG + Intronic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1099874541 12:88388936-88388958 AGGCAATCAGGAGAGTGGTTGGG + Intergenic
1100200822 12:92296263-92296285 AGACAAACAGGATAGGGGGCAGG - Intergenic
1101849559 12:108391260-108391282 ATGCACAGAGGAGAGGAGGTGGG + Intergenic
1101854763 12:108432956-108432978 AGGGCAACAGCAGAGGAGGTAGG + Intergenic
1101858901 12:108466681-108466703 AGGCACAGAAGAGAGCTGGTAGG - Intergenic
1102558135 12:113742417-113742439 ATCCAAGCAGGAGGGGTGGTGGG - Intergenic
1102635006 12:114315715-114315737 AGACCAATAGCAGAGGTGGTTGG - Intergenic
1103000497 12:117382090-117382112 AGGTAAAGAGCAGGGGTGGTGGG - Intronic
1103699054 12:122838781-122838803 AGGGAGGCAGGAGAGGAGGTCGG + Intronic
1104342817 12:127967225-127967247 AGGCAAACAGTGCAGGTTGTTGG + Intergenic
1104682524 12:130761468-130761490 AGGCACAGATGAGACGTGGTGGG - Intergenic
1104833313 12:131769877-131769899 CTGCAAACAGGAGAGGTGAGAGG - Intronic
1107070765 13:36266247-36266269 TGGCAAGCAGGGGAGGAGGTGGG + Intronic
1107331573 13:39306973-39306995 AGGCAAGCAAGAGAAGTGGGTGG - Intergenic
1107793495 13:44026570-44026592 AAGCCAACAGGAGAGGGGGAAGG + Intergenic
1108433185 13:50375511-50375533 AGGCAGACAGGAGTAGGGGTGGG - Intronic
1108471729 13:50773894-50773916 AGGCAGGCAGGAGCTGTGGTGGG + Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110951528 13:81498729-81498751 AGGCAAAAAGGAGAAATGGTTGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1112814065 13:103251672-103251694 AGGAAAAGGGGAGAGGTGGCAGG + Intergenic
1112887645 13:104193784-104193806 AGGCAAACAGTGGAAGTTGTTGG - Intergenic
1113892525 13:113743917-113743939 AGGCAGACAGGGGTGGGGGTGGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1115142552 14:30189916-30189938 AGGGAAACAGAAAAGATGGTAGG - Intronic
1115161060 14:30394747-30394769 TGGCAAACATGAGAGCTGGGAGG - Intergenic
1115895090 14:38077419-38077441 AGAAAAATAGGAAAGGTGGTTGG + Intergenic
1117162855 14:53006191-53006213 AGACAAATAGGACAGGAGGTGGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117766955 14:59093229-59093251 AGACAAACAGGAGAGATTCTTGG - Intergenic
1118635769 14:67747657-67747679 AGGGATACAGGGGAGGCGGTGGG - Exonic
1118731707 14:68671369-68671391 CAGCAAACTGGAGATGTGGTAGG - Intronic
1118775627 14:68972169-68972191 AGGCAAACAGAAGACTGGGTGGG - Intronic
1119044393 14:71305078-71305100 AGGAAAACTTGAGAGATGGTTGG - Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119636626 14:76278572-76278594 AGGAAAACATGAGCAGTGGTGGG + Intergenic
1119853627 14:77883688-77883710 AGGGACACTGGGGAGGTGGTGGG + Intronic
1119856272 14:77903580-77903602 ATGGAAACAGGACAAGTGGTAGG + Intronic
1120642636 14:87033497-87033519 AGGCATGCAGGAGTGGTGCTGGG + Intergenic
1121415993 14:93779709-93779731 AGGAAGACAGGAGAAGCGGTTGG - Intronic
1121543753 14:94748486-94748508 AGGAAAACAGGGGAGGTGCCCGG + Intergenic
1122731407 14:103801468-103801490 AGGCAAACAGGAAGGGTACTTGG - Intronic
1123068117 14:105628273-105628295 AGGCAAACAGGAGAGGGGAGGGG - Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123790172 15:23711821-23711843 AGGCAAGGAGGAGTGGTGGAAGG + Intergenic
1124018454 15:25898387-25898409 AGGCAAAGAGCAGGAGTGGTGGG + Intergenic
1125030925 15:35075292-35075314 AGGAAAGCAAGAGAGATGGTTGG - Intergenic
1126482444 15:49140964-49140986 AAGAAAACAGCAGAGGTGGATGG + Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127136019 15:55924430-55924452 TGGCAATCAGAAGAGGTGCTTGG + Intronic
1127242305 15:57129919-57129941 AGGCAAAAAGGAGGGGTTGTTGG - Intronic
1127566471 15:60194114-60194136 AGGAGAACAAGAGAGGTGATGGG - Intergenic
1127881752 15:63164223-63164245 AGGCAAGCAGGACAAGTGCTAGG - Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132166823 15:99601593-99601615 AGACAAACAGGAGGGGAGGTAGG - Intronic
1133130543 16:3673816-3673838 AGGAAACCAGGGGAGGTGGAGGG + Intronic
1133295862 16:4751968-4751990 AGACACACAGGAGAGGGGTTGGG + Exonic
1133507004 16:6422216-6422238 AAAAAAAAAGGAGAGGTGGTCGG - Intronic
1133737494 16:8627067-8627089 AGGCAAGCAACAGAGGTGGCTGG - Intronic
1134134411 16:11669382-11669404 AGGCACGCGGGAGAGGAGGTAGG + Intronic
1135286468 16:21197774-21197796 AGTGAAACAGGGGAGGAGGTTGG - Exonic
1135981765 16:27153335-27153357 AGGCAACCAGAAGATGTGCTGGG - Intergenic
1136178509 16:28535038-28535060 GGGCAAACAGGAAGTGTGGTTGG - Intronic
1137792363 16:51185623-51185645 AGGGAAACAGAGGAGGGGGTGGG + Intergenic
1138179128 16:54930624-54930646 AGGCAAAGAGGAGGGGTGAGAGG + Intergenic
1138893998 16:61180877-61180899 AGGGAAACAGGAGAGGTCGGGGG - Intergenic
1139962031 16:70723697-70723719 AGGCAACCAGCAGGGCTGGTAGG - Intronic
1140559010 16:75955677-75955699 AGCAAAACTCGAGAGGTGGTGGG + Intergenic
1140604078 16:76513205-76513227 AGGTGAACAGGTGTGGTGGTGGG + Intronic
1140632417 16:76870152-76870174 AGGAAAACAGGACTGGAGGTGGG - Intergenic
1140661262 16:77192922-77192944 GGGCAACCAGGAGAGTTAGTAGG + Intronic
1141157584 16:81608003-81608025 AGGCACACAGGTGAGTTGTTAGG + Intronic
1141294742 16:82757153-82757175 AGACAAACAGGAGAGTAGATAGG - Intronic
1141472450 16:84248329-84248351 AGGGACACAGGAGCGGGGGTTGG + Intergenic
1141599306 16:85115572-85115594 GGGCACACAGGAGAGGGGGTGGG - Intergenic
1141981096 16:87550929-87550951 GGGCTAACAGGAGAGGTGCGCGG - Intergenic
1142778081 17:2157435-2157457 AGAGGAACAGGAGAGGTAGTTGG - Intronic
1142792640 17:2279947-2279969 AGGCAAGCATGAGAGGCCGTGGG - Intronic
1143028719 17:3955541-3955563 AGGCGAACAGGAAAGGCGGGGGG + Intronic
1143480290 17:7224226-7224248 AGGCAAACAGCTGAGGCGGTAGG + Exonic
1146163439 17:30571769-30571791 AGGCACACAGGAGAAGGGCTGGG + Intergenic
1146172546 17:30645019-30645041 AGGCAAAGAGTATAGATGGTGGG + Intergenic
1146346000 17:32061028-32061050 AGGCAAAGAGTATAGATGGTGGG + Intergenic
1146451619 17:32979117-32979139 AAGCAAATAGGTGAGGGGGTGGG + Intronic
1147816896 17:43216802-43216824 AAGCAATCAGGAAAGCTGGTGGG - Intronic
1148213906 17:45824206-45824228 TGGCACACAGTAGAGGAGGTGGG + Intronic
1148486652 17:47995257-47995279 TGGCAGTCAGGAGAGGGGGTGGG - Intergenic
1148688788 17:49514903-49514925 AGGCAAGGAGGGGAGGTGATAGG - Exonic
1148997762 17:51726084-51726106 AGGCAAACAGGGCAGGAGGATGG + Intronic
1149162350 17:53709523-53709545 AGGGCAAAAAGAGAGGTGGTAGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150637033 17:66920325-66920347 AGGCCAGCAGGAGAGGAGGCTGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151408649 17:73906170-73906192 GGACAAGCAGGGGAGGTGGTAGG + Intergenic
1151830503 17:76546490-76546512 GGGCAAACAGTACAGGTGGTGGG + Intronic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155294643 18:24373999-24374021 AGGCAAACATGGGTGGAGGTGGG + Intronic
1156267470 18:35501585-35501607 AGGCAAGCTGGAGAGATGGCAGG - Intergenic
1156656449 18:39294139-39294161 AGGCAAAGTGGAGGGGTGGCTGG + Intergenic
1156777942 18:40816425-40816447 TGTGAAACAGGAGAGGTAGTGGG + Intergenic
1157223087 18:45840887-45840909 AGGGACACAGGACAGGTTGTGGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158868607 18:61662195-61662217 AGGCCAACAGGAGTGGTTGGTGG - Intergenic
1159577720 18:70200282-70200304 AGGAAATAAGGAGAGGTGGGTGG + Intronic
1161518353 19:4709810-4709832 GGGCCAACAGGAGGGGTGGGAGG + Intronic
1162989887 19:14295061-14295083 AGGCAAAGAGTATAGATGGTGGG - Intergenic
1163205672 19:15800843-15800865 AAGAAAACAGCAGAGGAGGTTGG + Intergenic
1164270288 19:23666689-23666711 AGCCAGGCAGGAGAGGAGGTAGG + Intronic
1164808747 19:31139562-31139584 ATGCTAACAGGCAAGGTGGTGGG - Intergenic
1165181268 19:33973036-33973058 GGACAAACAGGAGAGGGGGAGGG - Intergenic
1165755075 19:38288272-38288294 AGGCAGACAGGAGGGTGGGTGGG - Intronic
1166741529 19:45117617-45117639 AGGCACACAGAAGACCTGGTGGG - Intronic
1166741933 19:45119769-45119791 CTGCACACATGAGAGGTGGTGGG + Intronic
1167708229 19:51094400-51094422 AGGGAAAAAGGAGAGGGGGCAGG - Intergenic
1167738644 19:51311608-51311630 GGCCAATCAGGAGAGGTGGGGGG - Intergenic
1168096341 19:54117371-54117393 AGGCATACAGGAGTGGTGCTGGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925034271 2:673835-673857 AGGCTAACACAGGAGGTGGTGGG + Intronic
925245350 2:2377701-2377723 AGGGAAACAGAAGGGGTGGGAGG + Intergenic
925770016 2:7273131-7273153 AGGGAAACAGGGGAGGAGGGAGG + Intergenic
926349657 2:11983416-11983438 AGGCAAATGGGAGATGAGGTGGG + Intergenic
927155407 2:20218341-20218363 AGGCCACCAGCAGAGGTGGGAGG + Intronic
928872138 2:35992542-35992564 AAGCAAATAGGACAGCTGGTGGG + Intergenic
928912767 2:36439520-36439542 GGACAAACAGGAGATGAGGTTGG - Intronic
929379273 2:41331175-41331197 AGGGAAAAAGGGGAGGTGGTAGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929559245 2:42945475-42945497 AGGCTGACAGGAGAGTTGCTTGG - Intergenic
929721442 2:44372812-44372834 AGGGAAACTGAAGAGGAGGTTGG + Exonic
929955184 2:46452601-46452623 AGGCAAACTGAGGAGGAGGTGGG - Intronic
930360482 2:50371914-50371936 ATGATAACATGAGAGGTGGTTGG - Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931635936 2:64340803-64340825 ATTCAAACAGGAGTGGGGGTGGG + Intergenic
931683256 2:64770055-64770077 AGGCAGGCAGAAGAGGTGGCAGG - Intergenic
932090121 2:68799059-68799081 AGGCAGAAAGGACAGATGGTGGG + Intronic
932485792 2:72083665-72083687 AGGCCAAGAGGAGCAGTGGTGGG + Intergenic
932560509 2:72863351-72863373 CAGCAAACAGGAGACGTGGCTGG + Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
934331761 2:92074886-92074908 AGGCAAAAAGGAGCGGGAGTGGG - Intergenic
934778480 2:96953942-96953964 AGGGAAAAAGGAAAGGGGGTGGG + Intronic
937382368 2:121391352-121391374 TGGCAAACAGGAAAGTTGGGAGG + Intronic
937986786 2:127641566-127641588 AGGTCATCAGGGGAGGTGGTGGG + Intronic
937989486 2:127654347-127654369 TAGCACACAGGAGAGGTGGCAGG + Intronic
938035702 2:128033142-128033164 TGGCAAATGGCAGAGGTGGTGGG + Intergenic
938557884 2:132442181-132442203 TGGAAAGCAGGAGAGGTAGTTGG + Intronic
938671252 2:133588738-133588760 AGGGATACAGGTGATGTGGTTGG + Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940074771 2:149729130-149729152 GGGCAGAGAGGAGAGGTGGCAGG + Intergenic
940247185 2:151632385-151632407 ATGAAAACAGGACAGGTGTTGGG + Intronic
940570856 2:155431284-155431306 AGTTAAACAGGCGTGGTGGTGGG - Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941606036 2:167597591-167597613 GGGGAAACAGGTGATGTGGTAGG - Intergenic
941638799 2:167965099-167965121 AAACAAAGAGGAGAGGTAGTGGG + Intronic
942167416 2:173255327-173255349 AGACAAGCGGGAGAGGTGGCAGG - Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943385375 2:187197866-187197888 AGTCAAACAGGAGAGGTCAATGG + Intergenic
944177069 2:196842449-196842471 AAGCAAACAAGAGAAGTGGATGG - Intronic
945683501 2:212940797-212940819 AAGCAAATGGGAGAAGTGGTAGG + Intergenic
945706574 2:213241838-213241860 AGGCAAACAGGTCAGATGGGGGG - Intergenic
945991097 2:216395978-216396000 AATAAAACAGGAGAGGAGGTTGG + Intergenic
946315278 2:218907280-218907302 AGGGAAACAGGAGAAGGGTTTGG + Intergenic
946409099 2:219507628-219507650 GGGCAAACATGAGAGATGGCTGG - Intergenic
946996327 2:225396317-225396339 ATGCAAAGAAGAGAGATGGTTGG + Intergenic
948454607 2:238099002-238099024 GGGGAAGCAGGAGGGGTGGTGGG - Exonic
948897576 2:240934497-240934519 GGGCAGACAGGAGAGGGGGCGGG - Intronic
1168876766 20:1177262-1177284 AGTCCAGCAGGAGAGGTCGTGGG + Intronic
1169921409 20:10737992-10738014 AGGCAAAAAGGAGATGGGGGTGG - Intergenic
1171238425 20:23546411-23546433 GAGCAGACAGGGGAGGTGGTGGG + Intergenic
1171243241 20:23588016-23588038 GAGCAGACAGGGGAGGTGGTGGG - Intergenic
1171409937 20:24939559-24939581 AGGCCAACAGGAGAGATGAATGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172003894 20:31803804-31803826 TGGCAGAGAGGAGAAGTGGTTGG + Intergenic
1172097585 20:32467851-32467873 AGGCACACAGGGGAGGGGGCCGG + Intronic
1172487451 20:35306916-35306938 AGTCACACAGTAGAGGTGGAAGG + Intronic
1172662993 20:36580116-36580138 AGAGAAACAGGAGAGCTTGTGGG - Intronic
1172781662 20:37440101-37440123 AAGCAAACAGCAGAGGTGGCAGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173595469 20:44256257-44256279 AGGCAACCAGATGAGGTGTTTGG + Intronic
1175709360 20:61206753-61206775 AGGGAAACAGGCCAGGTGGTCGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178263484 21:31121074-31121096 GGGCACACAGGAGAGGTTGTAGG + Intronic
1178332760 21:31713732-31713754 GGGCAAACCGGAGCGGGGGTGGG + Intronic
1178358923 21:31932216-31932238 AGGCAGACAGGAGCAGTGCTGGG - Intronic
1178377174 21:32076471-32076493 AGGCCACCAGGAGAGGGGCTTGG + Intergenic
1178721802 21:35017022-35017044 AGGCAAAAATGGGAGGGGGTGGG + Intronic
1178794646 21:35732694-35732716 ATTCACACTGGAGAGGTGGTCGG - Intronic
1178839403 21:36126711-36126733 AGGCATAGAGAAGAGGAGGTGGG + Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179582553 21:42352591-42352613 AAGCAGAGAGGAGAGGTGGGTGG - Intergenic
1181557225 22:23678067-23678089 AGGGAAACAGCAGAGGGGCTGGG - Intergenic
1181615509 22:24051630-24051652 AGGCAGACAGGGGTGGAGGTAGG - Intronic
1181697155 22:24599493-24599515 AGGGAAACAGCAGAGGGGCTGGG + Intronic
1182285580 22:29245116-29245138 AGGCTAACTGGAGAGGTAGCAGG - Intronic
1182557570 22:31137494-31137516 AGATAAAGAGGAGTGGTGGTGGG + Intronic
1183076867 22:35432828-35432850 AGGCACTCAGGAGAGCTGGGAGG + Intergenic
1183544288 22:38447440-38447462 GGCCATACAGGGGAGGTGGTGGG - Intronic
1183654753 22:39177948-39177970 AGGCAGACAGGACAGGCGGGTGG - Intergenic
1184350027 22:43937368-43937390 AGGCAACCATGACAGGTGGTTGG + Intronic
949592387 3:5508001-5508023 AGGAAAACAGGAGAGGGTGTGGG + Intergenic
949736209 3:7174676-7174698 TGGCAAATAGGAGAGGAGATAGG + Intronic
949943573 3:9172999-9173021 AGGCAAACAGGAGAGGTGGTGGG + Intronic
950631837 3:14287139-14287161 AGGCCAGCAGGAGAGGAGGGAGG + Intergenic
950662960 3:14478001-14478023 TGGGGAACAGGGGAGGTGGTGGG - Intronic
951238642 3:20264790-20264812 AGGCAGAGAGGAGAAGTGGCTGG + Intergenic
951327255 3:21317892-21317914 ATGCAAACAGAAGAAGTGGCTGG - Intergenic
951825456 3:26863542-26863564 AGGGAAACTGGAGCCGTGGTGGG + Intergenic
954153869 3:48674123-48674145 AGGCAAAGAATAGAGCTGGTGGG + Exonic
954255251 3:49400716-49400738 AGCCAAAAAGGTGAGGTGGGGGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955911117 3:63861460-63861482 ATGCAAAGAGGACAGGTGGGAGG - Intronic
956073923 3:65484615-65484637 AGGCAATCAGGACAAGTGCTTGG - Intronic
956984042 3:74675852-74675874 AGGAAAACAGGAGTTGTGATTGG - Intergenic
959028203 3:101266767-101266789 AGGCATGCAGGAGGGGTGCTGGG - Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960935224 3:122895596-122895618 ATGGAGACAGGAGGGGTGGTAGG - Intergenic
960973966 3:123157843-123157865 AGGCAGACAGGACCTGTGGTGGG + Intronic
962716561 3:138131155-138131177 AGGCAAACAGAAGAGGCAGCTGG + Exonic
962941210 3:140126218-140126240 ATGAAGACAGGAGAGGTGATGGG + Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963358988 3:144246157-144246179 AGGCAAACAGCTCAGTTGGTTGG - Intergenic
965973654 3:174594249-174594271 AAGCAAACTGGTGAAGTGGTTGG + Intronic
966209098 3:177434373-177434395 AAGGAAGCAGGTGAGGTGGTTGG - Intergenic
967341602 3:188404926-188404948 AGGCTGACTGGAGAGGTGATTGG + Intronic
968093435 3:195911654-195911676 AGGGAAACTGGAGAGATGGGGGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969208172 4:5664799-5664821 AGGACAAAAGGGGAGGTGGTGGG - Intronic
969370437 4:6727878-6727900 AGGCAAGGAGGAGAGGGGGAGGG - Intergenic
969646353 4:8431750-8431772 AGATAAACAAGAGAGGGGGTGGG - Intronic
970107637 4:12603008-12603030 ACGAAAACAGGAGAGGGGGCCGG + Intergenic
972031168 4:34460046-34460068 AGGCAAACAGGAGACAAGGTAGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974441534 4:61924602-61924624 AAGGAAACAGTAGAGGTGGGAGG - Intronic
974744802 4:66058041-66058063 AAGCAAAAAGGAGAGGTGTTGGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975370733 4:73584053-73584075 AGGGAAACAGGACAATTGGTAGG + Intronic
975675828 4:76826453-76826475 AGGAAAAAAGGAGAGCTGGTGGG + Intergenic
975813144 4:78190530-78190552 AGGAAAAGAGGATAGGTGGGTGG - Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978866467 4:113518609-113518631 AAGCAAACAGGAGAGGTCAGAGG - Intronic
979149996 4:117299619-117299641 AGACAAACTGGATGGGTGGTGGG - Intergenic
979295037 4:119022438-119022460 AGCCACACAGGAGAAGTGGGAGG - Intronic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
982789562 4:159575124-159575146 AGGGAAACAGGAAGTGTGGTTGG + Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983165279 4:164468765-164468787 AAGCAAACTGGAGAGGTTGGAGG + Intergenic
983660519 4:170126752-170126774 AGGAAAACATGAGTGGTGGAAGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984139992 4:175993119-175993141 AGGGAAACAGGAAAGGAGGGAGG - Intronic
984352174 4:178609497-178609519 AGACAGACTGGAGAGGTGGAAGG + Intergenic
984719195 4:182954350-182954372 AGGCAAACAGGACTGCTGCTTGG + Intergenic
985136304 4:186789070-186789092 GGGAAAACAGGAGATGAGGTAGG + Intergenic
986216022 5:5719962-5719984 AGGCACAGAGGAGAGGCCGTGGG - Intergenic
986394146 5:7311763-7311785 TGCCAAACAGGAGAGGAGATGGG + Intergenic
987572710 5:19685833-19685855 ATGGAAGCAGGAGAGGTGGCTGG + Intronic
987872589 5:23640261-23640283 AGGAAAACAGGGGAGATGGCAGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988163647 5:27553359-27553381 AGTCAAAAAGGAGAGTTGGGAGG + Intergenic
988246669 5:28692610-28692632 AGGAAAAAAGTAGAGGTGGATGG + Intergenic
988390858 5:30628326-30628348 AGGCAATCAGGACAGGTGAGGGG + Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988904323 5:35770713-35770735 AGCCACAGAGGAGAGGTGGAGGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990818873 5:59815185-59815207 AGGGGAACAGGAGAGCTGATGGG + Intronic
991344077 5:65644438-65644460 AGGCAAAGAGGAAAGGGGTTGGG - Intronic
991920663 5:71653529-71653551 AGGCAAACTGGAGAGGAGAGGGG + Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992665893 5:79008719-79008741 AGGGAAACAGGAAAGGTGGGGGG + Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994673940 5:102797807-102797829 AAGCATACAGGAAAGGTGGAAGG - Intronic
995023564 5:107393897-107393919 GGGGAAACAGAAGAAGTGGTGGG + Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995841992 5:116451262-116451284 AGCCACAAAGGAGAAGTGGTGGG + Intronic
995952953 5:117738913-117738935 AGTGAGACAGGAGAGGTGGCTGG + Intergenic
996407247 5:123117601-123117623 AACCAAACAGGAAAGGTGATGGG - Intronic
996485645 5:124030619-124030641 AGGTAGACAGAAGAGATGGTGGG + Intergenic
997466171 5:134089550-134089572 AGGCACTGAGGAGAGGTGGGGGG + Intergenic
997703000 5:135917936-135917958 AGTCAAAGAGGAGAGGAGGAGGG + Intergenic
997905223 5:137809603-137809625 AGGCAAACAGCAGTGATGGCTGG + Intergenic
997951133 5:138243421-138243443 AGGGAAAAAGAAGAGGTGGTGGG - Intergenic
998166247 5:139846053-139846075 ACCCAAACAGCTGAGGTGGTTGG - Intergenic
998290662 5:140911034-140911056 AAGCAAACAGGGGTGGTGGGGGG + Intronic
998378761 5:141709071-141709093 AACCAAACAGGTGAGGTGATGGG - Intergenic
998804717 5:145907076-145907098 AGGCATAGAGGACAGGGGGTAGG + Intergenic
1000202341 5:159023882-159023904 GGGCAAACAGGAGGAGTGGAAGG + Intronic
1001438296 5:171718175-171718197 AGGCAAACAGGAGGTGGGGGAGG - Intergenic
1002189250 5:177470235-177470257 AGGGCAGCAGGACAGGTGGTGGG - Intronic
1003250076 6:4420080-4420102 AGGCTGGCAGGAGGGGTGGTGGG + Intergenic
1004206857 6:13599209-13599231 AGGAAAAGAGGAGAGGGGGAAGG - Intronic
1004449956 6:15736211-15736233 AGGCAAGTAGCAGAGGTGGGTGG + Intergenic
1004895717 6:20145887-20145909 TGGGGAACAGGAGATGTGGTAGG - Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005855181 6:29855529-29855551 AGGCAAACATGGTATGTGGTTGG + Intergenic
1006338715 6:33433982-33434004 AGGCCAACTGGAGAGATGGCCGG - Intronic
1006569242 6:34987035-34987057 AGGCAAAAAGGAGAGCAGGAGGG - Intronic
1006591516 6:35161345-35161367 TGGAAAAGAGGAGAGGTGGCTGG + Intergenic
1006996237 6:38263990-38264012 AGGTAAAGAGCAGGGGTGGTGGG + Intronic
1007509633 6:42365110-42365132 GGGCAGACAGGAGAGGAGGCTGG + Intronic
1007794606 6:44337524-44337546 AGGCCAACAGGACAGGAGCTAGG + Intronic
1007880808 6:45164493-45164515 AGGTAGACAGGAGAGGTGTTAGG + Intronic
1007956153 6:45919492-45919514 AAGAAGAAAGGAGAGGTGGTGGG - Intronic
1008274417 6:49526592-49526614 AGGGAAGCAGGAGATGAGGTTGG - Exonic
1008381275 6:50841993-50842015 AGGTAAACAGGGCAGGTGATTGG - Intronic
1008462554 6:51792530-51792552 AGGAAAACAAGAGAAATGGTTGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008970585 6:57362939-57362961 AGGGAAACCGGGGTGGTGGTGGG + Intronic
1009039900 6:58163669-58163691 ATGCAAACAGAAGAGGGGGCAGG - Intergenic
1009159554 6:60264764-60264786 AGGGAAACTGGGGTGGTGGTGGG + Intergenic
1009498477 6:64380864-64380886 AAGCAGCCAGGAGTGGTGGTGGG + Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009647185 6:66420532-66420554 AGGCGAAGGGGAGAGGTGGCAGG + Intergenic
1010183016 6:73110055-73110077 AGGCTGTCTGGAGAGGTGGTGGG - Intronic
1011403384 6:86989232-86989254 AGGCAAAAAGGAGAGCTGCTTGG - Intronic
1011746167 6:90409855-90409877 AGGAACACAGGAGAGCTGTTTGG + Intergenic
1011934127 6:92753953-92753975 AAGCAAACAATAGAGGTGTTTGG + Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015622595 6:135147449-135147471 TGGGGAACAGGAGAGCTGGTAGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1016485610 6:144534899-144534921 AGTAAAACAGCAGAGGTGGGAGG + Intronic
1016890650 6:149003829-149003851 AGGCACACAGGTGGGGTGCTGGG - Intronic
1017171817 6:151463145-151463167 AGTCAGACAGAACAGGTGGTGGG + Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021354941 7:19642625-19642647 AGGGAGACAGGAGAGGGGGAAGG + Intergenic
1021449078 7:20764789-20764811 AGGAAAAGAGGAGAAGTGGAAGG + Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1021935630 7:25628526-25628548 AAGCAAAAAGGAGAGGAGGATGG - Intergenic
1022096907 7:27146888-27146910 GGGCAGAAAGGAGAGGGGGTTGG + Intronic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022694598 7:32691868-32691890 GAACAAACAGGAGAGGTGGGTGG + Intergenic
1023310378 7:38880443-38880465 AGGCATCCAGGAGAGGTTCTTGG - Intronic
1024641823 7:51335316-51335338 AGCCAAATAGGAGAGGTGAATGG + Intergenic
1025105525 7:56168834-56168856 AGTCATCCAGGAGAGGTGGTGGG - Intergenic
1026381069 7:69799875-69799897 AGGTAAAAAGGTGAGGGGGTTGG - Intronic
1027173656 7:75889812-75889834 AGGCAAATGGGAGAAGGGGTTGG - Intergenic
1027277912 7:76580570-76580592 AGCAAAACAAAAGAGGTGGTAGG + Intergenic
1027754578 7:82196109-82196131 AAGCAAAGAGGATAGTTGGTTGG - Intronic
1027940628 7:84674461-84674483 AGCCAAAAAGGGGAGGTGATTGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028209215 7:88052769-88052791 AGGCAAACAGGATAGCTGACCGG - Intronic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029082884 7:97988783-97988805 AGGCACAGAGGAGAGGAGGAGGG - Intronic
1029258550 7:99285924-99285946 AGCCAAATTGGACAGGTGGTAGG + Intergenic
1030072421 7:105709502-105709524 AGCCAGACAAAAGAGGTGGTTGG - Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031300091 7:120054239-120054261 AGGGAAACAGGAGAAGGGGCTGG + Intergenic
1031389826 7:121200510-121200532 AGGCAAAATGGAGAGGTTCTGGG + Intronic
1032719813 7:134541685-134541707 AGGCAAGAAGGAAAGGTGGCAGG - Intergenic
1032724708 7:134580146-134580168 AGGCAAGGAGGAGAGGTGGCAGG - Intergenic
1033418156 7:141182583-141182605 AGGGAAACAGAAGAGTTGATAGG + Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034429041 7:151031586-151031608 AGGCAGACAGGACTGGTTGTAGG - Intronic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034868213 7:154658636-154658658 AGGCAAAAGGGAGAGGGAGTGGG + Intronic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035096376 7:156359470-156359492 ATGGAACCAGGAGAGGTGGAAGG - Intergenic
1035625745 8:1069240-1069262 AGGGAAGTGGGAGAGGTGGTGGG + Intergenic
1035868713 8:3113198-3113220 AGGCAGACAGGTGAGGAGCTGGG - Intronic
1036085792 8:5611459-5611481 AGGCTAGAAGGAGAGGTGCTAGG + Intergenic
1036622219 8:10431782-10431804 AGCCAGACAGAGGAGGTGGTTGG - Intergenic
1037558354 8:20049062-20049084 AGGAAAACAGGAATGGGGGTGGG - Intergenic
1037573551 8:20179490-20179512 AGTCAAAGAGGACAGGTGATGGG + Intronic
1038046389 8:23768841-23768863 AGGGAAAGAGGGAAGGTGGTGGG - Intergenic
1038941745 8:32312805-32312827 AGGCAAACAGGAAGGATGGAAGG - Intronic
1039069229 8:33634593-33634615 AGGCAAAGAGGAGAGGGAGGGGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040291520 8:46127976-46127998 AGGCAGAAAGGAGAAGTGGCAGG - Intergenic
1041090592 8:54297747-54297769 AGGGAAGCAGCAGAGCTGGTGGG - Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042206265 8:66332809-66332831 AGGAAGACAGGAGAGGTTTTTGG - Intergenic
1042338866 8:67657973-67657995 AGGAAGGCAGGAGAGGAGGTTGG - Intronic
1042840297 8:73116809-73116831 AGGCAGAAAGGAGTTGTGGTGGG + Intronic
1043603544 8:81971329-81971351 TGGCAAACAGCAGTGGGGGTGGG + Intergenic
1043804497 8:84654572-84654594 AGGGAAAGAGCAGTGGTGGTAGG - Intronic
1045038818 8:98201206-98201228 AGGCAGAGAGGAGAAGTAGTTGG + Intronic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045716804 8:105056415-105056437 AGGCAGTCAAGAGAGCTGGTAGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046848752 8:118949154-118949176 AGGCAAGCAGGGAAGGAGGTAGG - Intronic
1047028704 8:120852583-120852605 GGGCAAACCAGAGAGTTGGTAGG - Intergenic
1048344422 8:133566091-133566113 AGACACACAGGGGAGGTGGGGGG - Intronic
1048351128 8:133617507-133617529 AGGTAAACAGGCAAGGTGGCAGG - Intergenic
1048565180 8:135588576-135588598 AAGGAAAGAGGAGAGGTGGCTGG - Intronic
1049001820 8:139831110-139831132 GGGCAAACAGGAGAGAGGGCTGG + Intronic
1050668593 9:7969731-7969753 AGGAAAAGAGCATAGGTGGTAGG + Intergenic
1050758429 9:9036743-9036765 GGACAAACAGGAGAGGAGGAAGG - Intronic
1050863757 9:10470800-10470822 AAGGAAACAGGAGTGGTGGAGGG + Intronic
1051053971 9:12961631-12961653 AAGCCTACAGGATAGGTGGTGGG + Intergenic
1052405076 9:28049449-28049471 AGGCAAAAAGGATAAGTGGCTGG + Intronic
1052972366 9:34384948-34384970 AGGGATGCAGGAGAGGTGGAGGG + Intronic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053354829 9:37436781-37436803 AGCCAAACAGTAGAGATGGAGGG + Exonic
1053420009 9:37971387-37971409 AGGGAAAGTGGAGAGGTGGGTGG - Intronic
1053537376 9:38938871-38938893 GAGCTCACAGGAGAGGTGGTGGG - Intergenic
1054628759 9:67425059-67425081 GAGCTCACAGGAGAGGTGGTGGG + Intergenic
1056418414 9:86400257-86400279 TGACAAACAAGAGAGGTTGTGGG - Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1058531446 9:105909314-105909336 AGGCAATCAAGAGAGTTGCTAGG + Intergenic
1058943441 9:109835157-109835179 AGGGAAAGAGGAGAGGGTGTAGG + Intronic
1058943446 9:109835177-109835199 AGGGAAAGAGGAGAGGGTGTAGG + Intronic
1059140820 9:111851657-111851679 AGGCAAAGGGGAGGGGTGGGGGG + Intergenic
1059389387 9:113989210-113989232 GAGCCAACAGGACAGGTGGTGGG + Intronic
1059652306 9:116326204-116326226 AGGCAAAGAGCAGGTGTGGTTGG - Intronic
1060157346 9:121328967-121328989 AGGCAAAGAGGCGAGGAGGATGG - Exonic
1060227012 9:121798644-121798666 TGGCTACCAGGAGAGGTGGGTGG + Intergenic
1060887784 9:127167820-127167842 AAGCCAAGAGGAGAGGTGGAGGG - Intronic
1061060882 9:128250084-128250106 AGGCAAAGAGGGAAGGAGGTGGG - Intronic
1062127095 9:134869756-134869778 AGGCTCACAGGAGAGGGTGTGGG + Intergenic
1062629280 9:137456494-137456516 AGACAAAAAGGAGCGGTGGCTGG + Intronic
1185727641 X:2435165-2435187 AGAGAAACAGGAGGGGTTGTTGG + Intronic
1186451860 X:9680569-9680591 AGGCAAGCAGGAGGGCTGGATGG - Intronic
1186644628 X:11493497-11493519 AAGCCAGCAGGAGTGGTGGTAGG + Intronic
1187276809 X:17823548-17823570 AGGTCAAGAGCAGAGGTGGTGGG + Intronic
1187522194 X:20023509-20023531 AGGCAACGAGGAGGAGTGGTAGG + Intronic
1188599530 X:31944624-31944646 AAACAAACAGGAGTGGTGGCGGG - Intronic
1188720987 X:33523391-33523413 TGAGAAACAGGAGAGGTGATGGG + Intergenic
1189700983 X:43716168-43716190 AAGTAAACAGGAAAGGTGGATGG + Intronic
1190029017 X:46953916-46953938 AGACAAACAGGAGAGGGAGGAGG - Intronic
1190809483 X:53869549-53869571 AAGCAAAGAGGGGTGGTGGTGGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193869501 X:86779774-86779796 AGGAAAACAGAAGATGAGGTTGG + Intronic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196061702 X:111414813-111414835 AAGCAAACAGGAAACGAGGTTGG + Intergenic
1196187550 X:112760913-112760935 AGGACAACAGGACAGGTGGGTGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197147840 X:123188633-123188655 AACCAGATAGGAGAGGTGGTTGG - Intronic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198512335 X:137365095-137365117 ACACAAACAGGGGAGGTGGAAGG - Intergenic
1198708721 X:139478047-139478069 AGGGAAAGAGAAGAGGTGGAAGG + Intergenic
1198845482 X:140905966-140905988 AGGCAACTAGGAGAGGTAGCAGG + Intergenic
1200049346 X:153420501-153420523 AGGCAGACAGGAGAGATGAAGGG - Intronic
1202262756 Y:22986755-22986777 AGGGAAATAGGTGAGGTTGTGGG + Intronic
1202336545 Y:23817880-23817902 AATTAAACAGGAGTGGTGGTGGG - Intergenic
1202415746 Y:24620496-24620518 AGGGAAATAGGTGAGGTTGTGGG + Intronic
1202455041 Y:25049590-25049612 AGGGAAATAGGTGAGGTTGTGGG - Intronic
1202534221 Y:25852191-25852213 AATTAAACAGGAGTGGTGGTGGG + Intergenic