ID: 949944105

View in Genome Browser
Species Human (GRCh38)
Location 3:9176703-9176725
Sequence CTGTAAAAGCAGAAGCAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 1, 2: 37, 3: 79, 4: 436}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949944101_949944105 18 Left 949944101 3:9176662-9176684 CCAATCATGGTGGAAGTCAAAGT 0: 1
1: 15
2: 125
3: 301
4: 842
Right 949944105 3:9176703-9176725 CTGTAAAAGCAGAAGCAAGTGGG 0: 1
1: 1
2: 37
3: 79
4: 436

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949944105 Original CRISPR CTGTAAAAGCAGAAGCAAGT GGG Intronic
900225244 1:1529915-1529937 CTGGAAAAGCAAAACCAGGTTGG + Intronic
902246114 1:15121829-15121851 TGGTAAAAGCAGGAGCAAGAAGG - Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
904057302 1:27679912-27679934 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
904796700 1:33061707-33061729 CTCAGAAAGCTGAAGCAAGTTGG + Intronic
906241776 1:44246623-44246645 CTGAAAAAGTAGAAGCTACTTGG + Intronic
906833088 1:49054933-49054955 CTTTAAAAGCTGAAGCACTTTGG - Intronic
906977550 1:50591783-50591805 CTGTTAGTGCAGAAGAAAGTCGG - Intronic
907522397 1:55032700-55032722 CTGTAAAATCGAAAGCAAGCTGG - Intergenic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908450814 1:64252602-64252624 CAGGAAAAGCAGAGGCAACTAGG + Intronic
908775761 1:67638419-67638441 CTGTAGAAGAAGCAGCAAGCAGG + Intergenic
908787360 1:67748471-67748493 CTTTAAAAGAAGTAGCAAGAAGG + Intronic
908932197 1:69331016-69331038 CTGTAAAATAAAAAACAAGTTGG + Intergenic
909129258 1:71714514-71714536 CTGTACAATGAAAAGCAAGTTGG + Intronic
909162017 1:72164035-72164057 AAGTAAAAGCAGAAACAAGAAGG + Intronic
909220719 1:72957705-72957727 TTGGAAAAGTAGAAGAAAGTAGG - Intergenic
909376861 1:74950949-74950971 CTGTAAAATCAAAAGAAAGTTGG - Intergenic
910715628 1:90226157-90226179 CTGTAAAGTCAAAAGCAAGTTGG - Intergenic
911069285 1:93819449-93819471 AGTTAAAAGCAAAAGCAAGTGGG - Intronic
911235218 1:95404772-95404794 CTGTAAAATCAAAAACAAGTTGG - Intergenic
911762044 1:101627543-101627565 TGGTGAAAGCAGAAGCAAGGGGG - Intergenic
911985387 1:104616272-104616294 CTTTAAAATCAAAAGCAAGTTGG + Intergenic
912728198 1:112077619-112077641 GTGTGAAAGCAGCAGCACGTTGG + Intergenic
912861444 1:113217404-113217426 CTGCAGAAGCAGAAGAAAGCTGG - Intergenic
913124770 1:115775321-115775343 TTGAAAAAGAAGAAGAAAGTTGG - Intergenic
913396277 1:118375966-118375988 CTGTAAAATCAAAAGCAAATTGG + Intergenic
914492840 1:148162833-148162855 CTCCAGAAGCAGAATCAAGTGGG + Intergenic
914898733 1:151699640-151699662 CTGTAAAAGCAAAAGGCTGTAGG - Intergenic
915710839 1:157896710-157896732 CTGTAAAATCAAAAGCAATCTGG + Intronic
916778488 1:167996007-167996029 CTGTATAAGTAGAACAAAGTAGG + Intronic
917381599 1:174416101-174416123 CTGTCACAGCAGAAGTGAGTTGG - Intronic
917420396 1:174857126-174857148 CTGTAAAAGCAGACGACAGTGGG - Intronic
918188459 1:182148444-182148466 CAGTAATAGGAGAAGGAAGTAGG - Intergenic
919242803 1:194936426-194936448 CTGCAAAATCAAAAGCAAGTTGG - Intergenic
919371840 1:196738420-196738442 CTGTAAAATCAAAAGCAAGTTGG + Intronic
919685707 1:200481816-200481838 GACTAAAAGCAGAAGCGAGTAGG + Intergenic
919842569 1:201619826-201619848 CTGGAGAAGCAGAGGCAAGCTGG + Intergenic
920056534 1:203196919-203196941 CTGTGAAGGCAGAAGCAAGCCGG - Intergenic
922190560 1:223315101-223315123 CTGTAAGACTAGAAGCAAGATGG - Intronic
923188706 1:231598940-231598962 CGGTGAAAGCAGGAGCAAGTTGG + Intronic
923766597 1:236897953-236897975 CTGTAAAAACAGAAAAAAGCAGG - Exonic
924686220 1:246293507-246293529 CTGCAAAAGTGGAAGCACGTGGG - Intronic
1063276751 10:4577553-4577575 ATTTTAAAGCAGAAGAAAGTTGG + Intergenic
1063639117 10:7813558-7813580 CTGAAAGAGCAGATGCAAGATGG + Intergenic
1067656166 10:48193243-48193265 CTGTAAAAGCAGAAAGCAGAAGG - Intronic
1068439522 10:57032888-57032910 CTGTAAAATCAAAAGCAAGATGG - Intergenic
1068871755 10:61952685-61952707 CTGTAGAAGCAGCAGCTACTTGG + Intronic
1070637727 10:78142549-78142571 CTGTAAAACCAAAAGCAAGTTGG - Intergenic
1071942111 10:90601496-90601518 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1073387721 10:103141024-103141046 CAGCAAAAGCAAAAACAAGTGGG - Intronic
1073619894 10:105035894-105035916 CTATAAAAGCAGAACAACGTAGG - Intronic
1073890444 10:108095471-108095493 CTTTAAAAGCATAAGGAAATTGG - Intergenic
1074089577 10:110236393-110236415 TTGAAAAAGAAGAACCAAGTCGG - Intronic
1074196682 10:111194384-111194406 CCGCAAAAACAGAAGCAAATGGG - Intergenic
1074787519 10:116854105-116854127 GTGGAAAAGCAGAAGCCATTTGG - Intronic
1077603512 11:3591186-3591208 TTGTAAAAGAAGAACAAAGTTGG - Intergenic
1078007022 11:7539824-7539846 CCCCAAAAGCAGAAGCAAGCTGG + Intronic
1079519890 11:21314016-21314038 TGGCAAAAGCAGGAGCAAGTGGG - Intronic
1079777406 11:24549571-24549593 TTATACAAGCGGAAGCAAGTAGG + Intronic
1080182427 11:29441516-29441538 CGGTGAAAGCAGAAGCAAACAGG + Intergenic
1080192680 11:29570544-29570566 CTGTAAAATCAAAAACAAGTTGG + Intergenic
1080864386 11:36180453-36180475 CTGTACATGTAGAAGTAAGTAGG + Intronic
1080946228 11:36978466-36978488 CTGTAAAATAAAAAGCAAGTTGG + Intergenic
1081181761 11:39992660-39992682 CTGTAAAATCAAAAACAAGTTGG - Intergenic
1081322597 11:41709418-41709440 CTGTAAAAAGAGAAGCAAAGGGG - Intergenic
1081625569 11:44653340-44653362 CTGGAAAAGCAGTGGCAAGGAGG - Intergenic
1081923925 11:46806877-46806899 GTGTAAAAGCTAAAGCAAGAAGG - Intronic
1082183974 11:49156794-49156816 CTCTAAAAGGATAAGCAAATTGG - Exonic
1082934246 11:58639896-58639918 CTGTAACAGATGAAGGAAGTGGG - Intergenic
1083049394 11:59763414-59763436 CTGGAGAAGCAAAAGCAGGTAGG + Intronic
1083086264 11:60149453-60149475 TTGAAAAAGAAGAAGAAAGTGGG - Intergenic
1083725704 11:64626966-64626988 CTCTAAACGCAGAAACCAGTTGG - Intronic
1083880049 11:65543883-65543905 CTGCATGAGCAGAAGAAAGTGGG - Intronic
1084291156 11:68168991-68169013 CTGTAAAGGCAGAAACAATTTGG + Intronic
1084813359 11:71629468-71629490 TTGTAAAAGAAGAACAAAGTTGG + Intergenic
1085236595 11:75020192-75020214 CTGTAAAATTAAAAGCAGGTTGG - Intergenic
1085621637 11:78042125-78042147 CTGTGACACCAGAAGCAAGATGG - Intronic
1085986518 11:81794062-81794084 CGGTGAAAGCAGGAGCAAGAGGG - Intergenic
1086150074 11:83599369-83599391 CTGGATAAGCAAAAGCAAGGAGG - Intronic
1086403816 11:86483210-86483232 ATGTAAAGGTAGAAACAAGTGGG + Intronic
1086514681 11:87598089-87598111 CTGTAAAACCAGACTCAAGTGGG + Intergenic
1086682381 11:89688575-89688597 CTCTAAAAGGATAAGCAAATTGG + Intergenic
1086722020 11:90132895-90132917 CTGAAAAAGCTGAAGTTAGTTGG + Intronic
1087226345 11:95604682-95604704 ATATAAAAGTAGAGGCAAGTGGG - Intergenic
1087255197 11:95945450-95945472 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1087467649 11:98529562-98529584 CTGGAAAAGCACAAACTAGTGGG + Intergenic
1088511425 11:110579702-110579724 CTGGAACACCAGAAGCATGTGGG + Exonic
1088639731 11:111859930-111859952 TTGTATAAGCTGAATCAAGTTGG - Intronic
1089028709 11:115299701-115299723 CTTAAGAAGCAGAAGCAAGACGG + Intronic
1089205671 11:116760507-116760529 CTATAAACGCAGAAGCTACTTGG + Intronic
1089405250 11:118192264-118192286 CTGTGAAATCAAAAGCAAGCTGG - Intergenic
1091081724 11:132675990-132676012 TTGTAAAAGGAGAAAAAAGTTGG + Intronic
1091166459 11:133480396-133480418 CAGAAAAAGCAGAAGGCAGTGGG - Intronic
1091751392 12:3023253-3023275 TAGTAAAGGCAGAAGGAAGTGGG + Intronic
1092058540 12:5527048-5527070 TTGTAAAAGCAAAACCAATTAGG - Intergenic
1092735946 12:11583042-11583064 GTGTAAAAGCAGCAGCAAGATGG - Intergenic
1093184636 12:16005896-16005918 CTGTAAGAGCATAAGCATGCAGG + Intronic
1093478852 12:19584023-19584045 CTGTAAAATCAAAAACAAATTGG - Intronic
1093839664 12:23881533-23881555 ATATAAAAGCCGATGCAAGTGGG - Intronic
1095394323 12:41744731-41744753 CTATTAAAGAAGAAGAAAGTAGG + Intergenic
1097663005 12:62451200-62451222 CTGTAAAAGAAGAACCACATGGG + Intergenic
1098414465 12:70216916-70216938 ATGTAAAAGCAAAAGGAAATGGG + Intergenic
1098624516 12:72646655-72646677 ATGGAAAAGCAGAAGAAAGCAGG + Intronic
1098628267 12:72699316-72699338 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1098655669 12:73026755-73026777 CTGTTTAAGCAGAAGCATTTAGG + Intergenic
1099635292 12:85204754-85204776 CTGTAAAATCAAAAGCAAGCTGG - Intronic
1099642039 12:85302353-85302375 CTGTTAAAGCATCAGCGAGTTGG + Intergenic
1099801305 12:87460289-87460311 CTGTAAAATCAAAATCAAGTTGG + Intergenic
1100205585 12:92345623-92345645 CTGTAACATCAAAAGCAAGCTGG - Intergenic
1100427600 12:94501733-94501755 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1101405487 12:104425037-104425059 GTGTAAATGAAGAAGCAATTGGG - Intergenic
1103357870 12:120335104-120335126 CTGTAAAATAAGAAACAAGTTGG + Intergenic
1104205519 12:126634819-126634841 CTGTAAGAGCAGAGGCCAGCTGG - Intergenic
1106718876 13:32418919-32418941 CTGTAAAATCAAAAGCAAGTTGG - Intronic
1106850558 13:33786016-33786038 TTGAAAAAGAAGAATCAAGTTGG + Intergenic
1107330809 13:39297141-39297163 CTGTAAAATCAAAAACAATTTGG - Intergenic
1108097090 13:46914009-46914031 CCACATAAGCAGAAGCAAGTTGG + Intergenic
1108250021 13:48556005-48556027 GTGCAAAAGCAGAAGCCATTAGG - Intergenic
1109870103 13:68322604-68322626 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1110022394 13:70491220-70491242 TTGTAAAGTCAAAAGCAAGTTGG - Intergenic
1110280724 13:73691160-73691182 CTGTATATGCAGCAGCCAGTGGG - Exonic
1110440648 13:75521759-75521781 CTGTAAAATCAAAAACAAGTTGG - Intergenic
1111036086 13:82676730-82676752 CTGTAAAGTCAAAAGCAAGTTGG + Intergenic
1111294552 13:86261995-86262017 TTGAAAAAGAAGAACCAAGTTGG - Intergenic
1112076243 13:95916250-95916272 CAGGAAAAACAGAAGCAACTAGG + Intronic
1112824974 13:103381827-103381849 CTGTAAAATTAAAAGCAAGTTGG + Intergenic
1115073467 14:29356701-29356723 CTGTAATTGCACAAGCAATTAGG - Intergenic
1115271907 14:31561988-31562010 CTGTAAAAGCAAAAACAATCTGG - Intronic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1117409629 14:55439421-55439443 CTGTCAAAGCAGAAACCCGTGGG + Intronic
1118046413 14:61975961-61975983 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1118088765 14:62448641-62448663 CTGGCAAAGCAGAAGCAAACAGG - Intergenic
1118221026 14:63854094-63854116 GTGTACAAGCACCAGCAAGTCGG + Intronic
1118298502 14:64592561-64592583 TTGAAAAAGAAGAACCAAGTTGG + Intergenic
1118575437 14:67237751-67237773 CTGTAAAACCAGGAGTAAGGTGG - Intergenic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1118669479 14:68107520-68107542 CTTTTAAAGAAGAAGAAAGTTGG + Intronic
1118896100 14:69946905-69946927 TGGCAAAAGCAGAAGCAAGAGGG - Intronic
1120579538 14:86228793-86228815 CTGGAAGAGCAGAACAAAGTTGG - Intergenic
1121961256 14:98262367-98262389 TGGCAAAAGCAGAAGCAAGAGGG + Intergenic
1122443433 14:101750470-101750492 CTATGAAAACAGAAACAAGTGGG - Intergenic
1123173595 14:106397487-106397509 ATGTAAACGCAGAAGCATGAGGG + Intergenic
1124232271 15:27955845-27955867 ATGAAAAAGAAGAGGCAAGTGGG - Intronic
1124664515 15:31581018-31581040 CTGTAAAATCAATAGCAAGTTGG + Intronic
1126265767 15:46751928-46751950 CTGTACAAGCATAAGCAATATGG + Intergenic
1127051115 15:55085129-55085151 CTGTAAAACCAAAAGCAAGTTGG - Intergenic
1127585702 15:60376050-60376072 CTGTAAAGGCTGAAGCAGGGAGG + Intronic
1127988099 15:64090711-64090733 TTGCAAAAGGGGAAGCAAGTAGG + Intronic
1129320097 15:74769953-74769975 AAGTGAAAGCAGAAGCAAGGGGG - Intergenic
1129375907 15:75131458-75131480 CTGTAAAACCAGAAGTGAGATGG + Intergenic
1129966828 15:79743450-79743472 CTGTTAGAACAGAGGCAAGTGGG - Intergenic
1130010198 15:80146439-80146461 CTGTAAAACTAGAAGAAAATGGG + Intergenic
1130541850 15:84826253-84826275 CTGTGGAAGCAGAAGCAAACAGG - Intronic
1133365717 16:5207503-5207525 TTGTAAAAGAAGAACAAAGTTGG + Intergenic
1133863935 16:9624009-9624031 CTGTATCAGCTGAAGCCAGTGGG - Intergenic
1134862667 16:17574637-17574659 CTTAAAAGGCAGAAGCCAGTTGG - Intergenic
1135124193 16:19793743-19793765 TTGAAAAAGAAGAACCAAGTTGG + Intronic
1135231196 16:20709666-20709688 CTGTATAAGGATAAGGAAGTGGG - Intronic
1136014900 16:27390317-27390339 CTGAAAAAGCAGAACAAATTTGG + Intergenic
1136398005 16:30003509-30003531 CTGTGAAGACAGAAGCAGGTTGG + Intronic
1136674693 16:31892576-31892598 CTGTAAAATCAAAAGCAAGTTGG + Intronic
1136710051 16:32229448-32229470 CTGTAAAACTAAGAGCAAGTTGG - Intergenic
1136757858 16:32699963-32699985 CTGTAAAACTAAGAGCAAGTTGG + Intergenic
1136810248 16:33170412-33170434 CTGTAAAACTAAGAGCAAGTTGG - Intergenic
1136816724 16:33280492-33280514 CTGTAAAACTAAGAGCAAGTTGG - Intronic
1137665779 16:50248153-50248175 CCCTAAATGCAGAATCAAGTGGG + Intronic
1138401887 16:56752703-56752725 TTTAAAAAGCAGAAGAAAGTTGG + Intronic
1139242062 16:65403208-65403230 CTGTAACTGGAGAAGCAATTTGG - Intergenic
1139282820 16:65784804-65784826 CTGTAAAGGCAGAAGCAGAGTGG + Intergenic
1139738112 16:69010553-69010575 CTGTGACAGCAGAGGCAAGGTGG - Intronic
1141191585 16:81828913-81828935 CTGTAAAATCAGAATGCAGTTGG - Intronic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1142384556 16:89754944-89754966 CTGAAAAAGAAGAACCAAGTTGG + Intronic
1203060008 16_KI270728v1_random:960312-960334 CTGTAAAACTAAGAGCAAGTTGG + Intergenic
1143747797 17:9006125-9006147 CTGGAAAAGTGGAAGAAAGTGGG + Intergenic
1144281815 17:13734039-13734061 CTGTAAAAGCAGCTGGGAGTGGG + Intergenic
1146655507 17:34632441-34632463 CTGTAAAAGCATTTGCATGTTGG + Intronic
1147138761 17:38449984-38450006 CTGGAGGAGTAGAAGCAAGTAGG - Intronic
1147685383 17:42283913-42283935 CTGTCCAAGCAGAGGCAAGGTGG + Intergenic
1148566857 17:48638014-48638036 CTGTAGAGGCAGAATAAAGTCGG + Intergenic
1148681624 17:49477367-49477389 CTGTATAAGCTGACACAAGTAGG - Intergenic
1149101312 17:52909832-52909854 CTATAAAATCTGAAGCAAGTTGG - Intergenic
1149110583 17:53023812-53023834 CAGTAAAGTCAGAAGCAAATGGG - Intergenic
1151520517 17:74625904-74625926 TTATAAAAGCAGAACCAAGAAGG - Intergenic
1151791083 17:76306432-76306454 AAGAAAAAGCAGAAGCAACTAGG - Intronic
1153434516 18:5055062-5055084 AGGTCAAAGCAGAAGAAAGTAGG + Intergenic
1153440924 18:5118117-5118139 CTGTAAAATAAAAAACAAGTTGG - Intergenic
1155413427 18:25571007-25571029 CTTTAAAATCAAAAGCAAGTTGG - Intergenic
1155773437 18:29728080-29728102 CTGTAAAATAAAAAACAAGTTGG - Intergenic
1157469129 18:47974670-47974692 CAGCAACAGCAGAAGCAAGAAGG + Intergenic
1157601961 18:48898682-48898704 CTGAAAAAGAAGAACAAAGTAGG + Intergenic
1158020508 18:52836419-52836441 TTGCAAAATCAAAAGCAAGTTGG + Intronic
1158260907 18:55604812-55604834 CTGGAAAAGTCGTAGCAAGTAGG - Intronic
1158822726 18:61179519-61179541 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1159199692 18:65167912-65167934 CTGGGAAAACGGAAGCAAGTTGG + Intergenic
1159671035 18:71221093-71221115 AAGTAACAGGAGAAGCAAGTGGG + Intergenic
1160109850 18:76015928-76015950 CTGTAAAAGCAAATGAAAGCAGG + Intergenic
1160611799 18:80094411-80094433 TGGCAAAAGCAGAAGCAAGTGGG - Intronic
1160669862 19:356338-356360 GTGAAAAAACAGGAGCAAGTTGG + Intergenic
1160737243 19:668982-669004 CTATAAAAGGACATGCAAGTAGG + Intergenic
1163420814 19:17212728-17212750 CTGTCAGAGCAGAAGCCACTAGG + Exonic
1164121304 19:22267753-22267775 CTCTACAAGCAGAAGAGAGTGGG + Intergenic
1164178632 19:22800448-22800470 CGCTACAAGCAGAAGAAAGTGGG - Intergenic
1164624270 19:29715765-29715787 TTGCAAAAGGAGAAGCAGGTTGG + Intronic
1164912741 19:32025921-32025943 ATGGCAAAGCAGAAGCAAGTTGG - Intergenic
1164985768 19:32647430-32647452 CTTTTAAAGCGGAAGCAGGTAGG + Intronic
1165391923 19:35543769-35543791 CTGTAAAAGCAGCAGCCAAGGGG + Exonic
1168341455 19:55625580-55625602 CTATAAAAGAAGAAGAAAGGAGG - Intergenic
1168395155 19:56041152-56041174 CTCTCAAAGCAGAAGGCAGTGGG + Intronic
1168608318 19:57777601-57777623 ATGTAACAGCAGAAGCAACAAGG - Intronic
925498663 2:4480609-4480631 TAGTAAAAGCAGGAGCAAGAGGG + Intergenic
926002155 2:9342213-9342235 CTGAAAAAGAAGAACAAAGTTGG + Intronic
926624838 2:15082554-15082576 ATGTAAGAGCATAACCAAGTAGG - Intergenic
926819029 2:16832713-16832735 CTGTAAAATAAAAAGCAAGTTGG - Intergenic
927162352 2:20278456-20278478 ATCTAAAAGCAAAAGCAATTTGG + Intronic
928246719 2:29636072-29636094 CTGAAAAAGAAGAATAAAGTGGG + Intronic
928832271 2:35501383-35501405 CTGTAAATGCCAAAGCAGGTAGG - Intergenic
929208418 2:39325184-39325206 CTGTAAAAGGGAAAGCAAATGGG - Intronic
930177935 2:48319103-48319125 CTGTAAAAACACTAGCAAGAAGG - Intronic
930336953 2:50060392-50060414 CTATAAAATCAAAAGCAAGGTGG - Intronic
930379056 2:50604297-50604319 CTGTTGAATCAGAAGCAAGGGGG + Intronic
930542566 2:52725137-52725159 TTCTCATAGCAGAAGCAAGTGGG - Intergenic
931046811 2:58363076-58363098 CAGCAAAAGCAGCAGCAATTGGG - Intergenic
931155605 2:59625172-59625194 CTGTAAAAGAAACAGAAAGTTGG - Intergenic
931163791 2:59723254-59723276 CTGGAAAAGGAGGAGGAAGTAGG + Intergenic
931197301 2:60064587-60064609 CTGTATACTCAGAAGCCAGTAGG + Intergenic
931330059 2:61271560-61271582 CTTTAAAAGGAGAAGAAAGGAGG + Intronic
931533322 2:63242683-63242705 CTGTAAAAGCAAAAGCCATTTGG - Intronic
932417275 2:71581055-71581077 CTGGAAAAGCAGGCGTAAGTAGG + Intronic
932904312 2:75733338-75733360 CTATAAAATCAAAAGCAAGTTGG + Intergenic
933085160 2:78046391-78046413 CTGTAAAAGCAGCTGGGAGTGGG + Intergenic
933170431 2:79118933-79118955 TTGTAAAAGCAGAAAAAATTTGG + Intergenic
933390758 2:81663673-81663695 CTGTGAAAGCAGAAACAAGGGGG + Intergenic
934011931 2:87829980-87830002 CTGTAAAATCGAAAGCAAGCTGG + Intergenic
934960585 2:98668986-98669008 CTGTAAAATCAAAAGCAAGCTGG - Intronic
935084851 2:99835150-99835172 CGGGAAAAGGAGAAGCAAGAGGG - Intronic
935260172 2:101348239-101348261 TTGTAAAAGCAGAATAAGGTAGG - Exonic
936096706 2:109535809-109535831 CTGTCAAGGCAGAAGACAGTGGG + Intergenic
936246378 2:110831633-110831655 CTGAAAAAGAAGAATAAAGTAGG + Intronic
936294089 2:111252090-111252112 CTGGAGAAGCAGAATCAACTGGG - Intergenic
936384432 2:112016100-112016122 CTGAAAAAGTAGAACAAAGTAGG - Intronic
936415884 2:112311114-112311136 CTTTAAGAGCACAAACAAGTAGG - Intronic
936717288 2:115202511-115202533 CTCGAAAAGTAGAGGCAAGTAGG - Intronic
937200287 2:120199057-120199079 CTGTAAAGGCAGCACAAAGTCGG + Intergenic
937211330 2:120273690-120273712 CTGTAAGACCAGAGGCAAGATGG + Intronic
937697230 2:124821328-124821350 GTGTAAAAGAAAATGCAAGTAGG - Intronic
937800706 2:126077503-126077525 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
938060464 2:128250673-128250695 CTGTCAAGGGAGAAGCAACTTGG + Intronic
938652533 2:133398767-133398789 GTGTGAAAGCAGAACCAAGTGGG + Intronic
939061184 2:137423130-137423152 CTTCAAAAACAAAAGCAAGTAGG + Intronic
939667195 2:144966089-144966111 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
939795900 2:146643625-146643647 CCTTAGAAGCAGAAGAAAGTGGG + Intergenic
939817799 2:146917552-146917574 GAGTAAAAGCAAAAGCAAGAAGG + Intergenic
940533020 2:154904346-154904368 CTGTAAAGTCAAAAGTAAGTTGG + Intergenic
940670584 2:156662187-156662209 CAGAAAAAGCAGAAACTAGTAGG - Intergenic
940676586 2:156730938-156730960 CTTTTAAATCGGAAGCAAGTAGG + Intergenic
940790682 2:158027247-158027269 CTGTAAAATCAAAAGCAAGCTGG + Intronic
940827349 2:158427867-158427889 CTGAAAAAAAAGAAGGAAGTGGG + Intronic
941565517 2:167100937-167100959 CACTAAAAGCAAAAGAAAGTCGG - Intronic
941729890 2:168905825-168905847 CTTTGAAAGAAGAAGTAAGTGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
943372200 2:187028881-187028903 CTGCAAAATAAGAAGCAAGTTGG - Intergenic
943491406 2:188559551-188559573 CTGTAAAATCAAAAGCAAGTGGG - Intronic
943664428 2:190593917-190593939 CTGTTAACTCAGAAGCCAGTGGG + Intergenic
943814006 2:192228206-192228228 TTGTAAAAACAGAAGAAATTTGG + Intergenic
944368518 2:198953917-198953939 CTGTCAAAGCAGAAGTGACTTGG - Intergenic
945457182 2:210063761-210063783 CTGTAAAATCAAAAGCAGGTTGG - Intronic
945774283 2:214085170-214085192 ATATAAAAGCAAAAGAAAGTAGG + Intronic
945817009 2:214617321-214617343 CTGTAAAACCATAAGCAATTAGG + Intergenic
946096848 2:217281838-217281860 CTGCAAATGCATAAGCAAGTGGG - Intergenic
946436068 2:219655431-219655453 TTGTAAAAGGAGAATAAAGTGGG + Intergenic
946536968 2:220641193-220641215 CAGAAACAGCAGAAGCAAGAAGG + Intergenic
946732153 2:222720282-222720304 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
947376055 2:229496034-229496056 CTGTAAGAACAGGAGCAAGAAGG - Intronic
948331829 2:237174144-237174166 TTGAAAAAGCAGAAGAAAGCTGG - Intergenic
948478460 2:238236260-238236282 CTTTAAAAGTAGAAGTAAGGAGG + Intergenic
1169255923 20:4098643-4098665 TTGTAAAAGAAGAATAAAGTTGG + Intergenic
1169518205 20:6341375-6341397 CAGTTTAAGCAGAAACAAGTTGG + Intergenic
1169891421 20:10456675-10456697 CTGAAAAAGAAGAATCAAATTGG - Intronic
1170207974 20:13820018-13820040 CTATAAAAGCAGAGACTAGTTGG - Exonic
1170574825 20:17654311-17654333 CTGTACAAGAAGAAGCATTTAGG - Intronic
1171494244 20:25544070-25544092 TTGAAAAAGAAGAACCAAGTTGG - Intronic
1172610869 20:36251588-36251610 CTGTCAAAGCAGAGGCATCTCGG - Intronic
1173382093 20:42554841-42554863 ATGTAAAAGGTGAGGCAAGTTGG + Intronic
1174708666 20:52682838-52682860 CTGAAAAAGCAGTTGCAGGTGGG + Intergenic
1175671940 20:60910806-60910828 CTGTATAAAAAGAAGAAAGTTGG - Intergenic
1176727582 21:10453224-10453246 ATGTAATGGCATAAGCAAGTAGG + Intergenic
1176933231 21:14838909-14838931 CTGTAAGACCAGAAGGAAGGTGG + Intergenic
1177107629 21:16979572-16979594 TTTTATAAGCAGAAGCAAGAGGG + Intergenic
1177421883 21:20870094-20870116 CTGTTCAAACAGAAGCAAGGAGG - Intergenic
1177881592 21:26701839-26701861 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1178056820 21:28808317-28808339 TTGGAAAAGAAGAAGAAAGTTGG - Intergenic
1178375892 21:32067323-32067345 CTGGAAGAACAGAGGCAAGTAGG - Intergenic
1180118696 21:45730174-45730196 CAGTAAAAGCAGTACCAAGAGGG - Intronic
1180286812 22:10753807-10753829 ATGTAATGGCATAAGCAAGTAGG - Intergenic
1181145119 22:20840320-20840342 GTGGAAAAGAAGAAGCAAGGAGG + Intronic
1181939892 22:26467311-26467333 CTATAATAGCAGAACCAAGTAGG - Intronic
1182182450 22:28363904-28363926 CTGTAAAATCAAAAGCAAGTTGG - Intronic
1182629762 22:31676218-31676240 CTGTAATAGCAGCAGCACCTGGG - Intergenic
1182634543 22:31714472-31714494 CTGTAGAAGCAGCAGTAACTGGG + Exonic
1183174427 22:36212499-36212521 CTGTAAGTGCAGCAGCAAGGAGG - Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185230835 22:49680506-49680528 CTAAAAAAGAAGAAGGAAGTTGG - Intergenic
1185282931 22:49983425-49983447 CAGTAAAAGCTGAAGCGAGGGGG + Intergenic
949918034 3:8980326-8980348 ATGTCAAAGCAAAGGCAAGTTGG - Intergenic
949944105 3:9176703-9176725 CTGTAAAAGCAGAAGCAAGTGGG + Intronic
952019798 3:29004340-29004362 TTGAAAAAGAAGAACCAAGTTGG - Intergenic
952119741 3:30228021-30228043 CTATAAAAGCAGAAGAAAGTAGG - Intergenic
952627508 3:35424763-35424785 CAGCAAAAGCAGCAGCAATTGGG + Intergenic
953363820 3:42324846-42324868 CTGGAGAAGCATAAGCAAGTGGG - Intergenic
953764385 3:45725127-45725149 TTGCAAAAGGAGAAGGAAGTTGG - Intronic
954367974 3:50156123-50156145 CTGTAAAAGCAAACCCAAGGTGG - Intronic
954513691 3:51151824-51151846 CTCTATAAGCAGAAGACAGTGGG - Intronic
954957409 3:54533838-54533860 GTGTAAATGTTGAAGCAAGTGGG + Intronic
955692379 3:61603392-61603414 AAGGCAAAGCAGAAGCAAGTGGG - Intronic
956835461 3:73092777-73092799 CTCCAAAAGCAGATGGAAGTTGG - Intergenic
956940201 3:74151427-74151449 CTGGAAAAGGAGAACAAAGTTGG + Intergenic
956983050 3:74662637-74662659 CTGTAAAAGCAGAATCTAGGTGG - Intergenic
957074367 3:75590211-75590233 TTGTAAAAGAAGAACAAAGTTGG - Intergenic
957374395 3:79337087-79337109 CTGTAAAATCAAAAGCAAGCTGG - Intronic
957687907 3:83526850-83526872 GTGTAAAGGAAGAAGCATGTGGG - Intergenic
958160761 3:89814847-89814869 CTCTAAAATCAAAAGCAAGTAGG + Intergenic
959203930 3:103281758-103281780 CTCTACAAGCAGAAGAGAGTGGG + Intergenic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
959598083 3:108149328-108149350 CAGCAAAAGCAGGAGCAAGGAGG - Intergenic
960564314 3:119117756-119117778 CTGTAAAATCAAAGGCAAGTTGG + Intronic
960919297 3:122730318-122730340 CTGTAATAGAAGAAGCCAGAAGG - Exonic
961793108 3:129390650-129390672 CTGGAAAATCAGAAAAAAGTGGG - Intergenic
963258682 3:143171917-143171939 CTGTATAAGCAGAAAAAATTGGG + Intergenic
963897117 3:150698822-150698844 CAGTACAAACAGAAGAAAGTTGG - Exonic
964139820 3:153384835-153384857 CAGAAAAAACAGAAGCAAGCAGG + Intergenic
964411685 3:156404449-156404471 CTGCATAAGCTGAAACAAGTGGG - Intronic
964454394 3:156845767-156845789 CTGAAAAAGAAGAATAAAGTGGG - Intronic
964508633 3:157425643-157425665 CTGTAAAATCAAAAGCAAGTTGG - Intronic
964892264 3:161551437-161551459 CTGTAGAACCAGTAGCCAGTGGG + Intergenic
965123327 3:164592009-164592031 CTGTTAAAGCTGAAACATGTTGG + Intergenic
966452496 3:180078059-180078081 CTGTAAAATCAAAAACAAGTTGG + Intergenic
967302405 3:188027971-188027993 CTGAAAAAGAAGAATAAAGTTGG + Intergenic
967709820 3:192693465-192693487 CTGTAAAAGAAAAACAAAGTTGG + Intronic
969121833 4:4916588-4916610 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
969698695 4:8752769-8752791 TTGTAAAAGGAGAACAAAGTTGG + Intergenic
969736017 4:8990874-8990896 TTGTAAAAGAAGAACAAAGTTGG + Intergenic
969795224 4:9522333-9522355 TTGTAAAAGAAGAACAAAGTTGG + Intergenic
970058003 4:11996915-11996937 CTGTAAATGGACATGCAAGTAGG - Intergenic
970061615 4:12039980-12040002 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
970483099 4:16497539-16497561 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
970712803 4:18883515-18883537 GTATAAAAGTAAAAGCAAGTTGG + Intergenic
970721746 4:18996761-18996783 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
970723969 4:19021020-19021042 CTGTAAAAGCAAAAGTGAGATGG - Intergenic
970990950 4:22212494-22212516 CTGAAAAAGCTGGAGGAAGTGGG - Intergenic
971222217 4:24718734-24718756 CAGTTGAAGCAGAAGCAAGAGGG + Intergenic
971277820 4:25214979-25215001 CAGTAAAATCAAAAGCAAGTTGG + Intronic
971561442 4:28083886-28083908 CTATAAAAACAAAAGCAACTTGG + Intergenic
971681406 4:29706129-29706151 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
972137445 4:35909165-35909187 CTGTAAGATCAAAAGCAAGTTGG - Intergenic
972323614 4:37994663-37994685 CTTTAAAAGCAGCAGCAACAAGG - Intronic
972890826 4:43554111-43554133 CTATAAACTCAAAAGCAAGTTGG - Intergenic
972900550 4:43677014-43677036 CTGTAAAATGAGAATCATGTTGG + Intergenic
972990093 4:44814182-44814204 CTGGAAAAGCCAAAACAAGTAGG - Intergenic
973074508 4:45905430-45905452 CAGTAAAATCAGAAGCAAAAAGG + Intergenic
973597125 4:52503676-52503698 CTCTACAAGCAGAAGAGAGTGGG - Intergenic
974333495 4:60509640-60509662 CAGTGAAAGCAGTAGTAAGTGGG + Intergenic
975239792 4:72043719-72043741 CTATAAAATGAAAAGCAAGTTGG - Intronic
976357843 4:84140861-84140883 CTGGAAAAGAAGAACAAAGTTGG + Intergenic
976895160 4:90100398-90100420 CTGTGAAATTAGAAGCAAGATGG + Intergenic
977664129 4:99625581-99625603 CTTTAAAACCAAAAGCATGTGGG - Intergenic
978215027 4:106189873-106189895 CTGAAACAGCTGAAGGAAGTTGG - Intronic
978251546 4:106637159-106637181 CTGTAAAATCAAAAACTAGTTGG - Intergenic
979091906 4:116493770-116493792 GTGGAAAAGCATAACCAAGTTGG + Intergenic
979823112 4:125198633-125198655 CAGCAAAAGAAGAAGGAAGTGGG - Intergenic
979966983 4:127087208-127087230 CTGTAAAATCAGAAGCAAGTTGG - Intergenic
980308965 4:131101632-131101654 CTGTAAAATTAAAAGCAAGTTGG - Intergenic
981236881 4:142427654-142427676 CTGAAGCAGCAGAAGCAATTAGG - Intronic
981611350 4:146597128-146597150 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
982833498 4:160092636-160092658 ATGCAAAAGCAGAAGCAAAGGGG + Intergenic
982904203 4:161048051-161048073 CTGTAAAATTAAAAGCAAGTAGG + Intergenic
983366950 4:166803476-166803498 CTCAAAAAGCAGGAGCAACTAGG + Intronic
983524025 4:168742007-168742029 CTGGAAAGTCAGAAACAAGTGGG - Intronic
983582144 4:169319500-169319522 CTCTACAAGCAGAAGAGAGTGGG + Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983718579 4:170816742-170816764 CTATAAAATCAAAAGCAAATTGG - Intergenic
983889587 4:173016649-173016671 CTGTAAAATCAAATGCAAGTTGG - Intronic
984061752 4:174997282-174997304 CTGTCAAAGCAAAAGCAGATTGG - Intergenic
984248998 4:177309650-177309672 CTGTAAAAGCAGAAGAAATTGGG - Intergenic
984447358 4:179853649-179853671 CTTCAAAGGCAGAAGCAGGTAGG + Intergenic
985220411 4:187697601-187697623 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
985914345 5:2906266-2906288 GTTTAAAAGCAGAAGCAACATGG - Intergenic
986113839 5:4750068-4750090 CTATAAAAGCAAAAGCAAGCTGG + Intergenic
986134549 5:4963008-4963030 CCGAAAAAGAAGAAGAAAGTTGG + Intergenic
986233806 5:5889101-5889123 CTTTAAAAGCAGAAGACAGGAGG - Intergenic
986924515 5:12730956-12730978 ATGTAAAATCAAAACCAAGTTGG + Intergenic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
987901248 5:24014648-24014670 CAGGAAAAGCAGAAGCAGTTCGG - Intronic
988400543 5:30754810-30754832 CTGTAAAATCAAAAGCCAGCTGG - Intergenic
988426758 5:31073768-31073790 CTTTAAAATCAAAAGCAAGCTGG + Intergenic
988671312 5:33385021-33385043 CTGTAAAATCAAACACAAGTTGG + Intergenic
988717501 5:33842638-33842660 CTGGAAAAACAGAGGAAAGTGGG + Intronic
989536172 5:42566081-42566103 CTTTAAAATCAGAAACTAGTAGG + Intronic
990054573 5:51556121-51556143 TTGTAAAAACAGAATAAAGTGGG + Intergenic
990335507 5:54768447-54768469 CTGTCACAGCAGCTGCAAGTGGG - Intergenic
990802440 5:59620045-59620067 CTGAAAAGGCAGAAGCAGGTGGG + Intronic
991184769 5:63794397-63794419 CTGTAAAATCAAAAGCAAACTGG + Intergenic
991536016 5:67669860-67669882 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
992640443 5:78764260-78764282 CTGTGAAAGCAGGAGCCAGGTGG - Intronic
993226013 5:85167814-85167836 CTGTAAAATTGAAAGCAAGTTGG - Intergenic
993416538 5:87639895-87639917 CTGTAAAGCTAGAAGCAAGATGG + Intergenic
993967087 5:94371896-94371918 CTGTAAAATCAAAAGCAAGTTGG + Intronic
995165438 5:109034503-109034525 TTGTGAAAGCAGAAGCCAATAGG - Intronic
995310663 5:110707071-110707093 TTGTAAAAGTGGAAGCAAGATGG + Intronic
995331631 5:110953596-110953618 GTGTAAAAGACAAAGCAAGTTGG - Intergenic
996071578 5:119137320-119137342 CTGTAAAATCAAAAGCAAGTTGG - Intronic
996257702 5:121426087-121426109 CTGTAAAATCAAAAGCAACTTGG + Intergenic
998039114 5:138940405-138940427 TTGAAAAAGAAGAACCAAGTTGG - Intergenic
998679883 5:144455236-144455258 ATGTGGAAGCAGAAGGAAGTTGG - Intronic
999349348 5:150853096-150853118 CTGTAAAAGCAGTATGAAGAGGG - Intronic
1000250525 5:159490453-159490475 GTGTAGAGGGAGAAGCAAGTAGG + Intergenic
1000575979 5:162975788-162975810 CCTTATAAGCAGAAGCAAGGTGG - Intergenic
1002017917 5:176340556-176340578 GGGGAAAAGCAGAAGCAGGTAGG + Intronic
1002373691 5:178773896-178773918 CCATAAGAGCAGAAACAAGTTGG + Intergenic
1002655405 5:180742534-180742556 CTGCTAAACCAGAAGCAGGTCGG - Intergenic
1002713840 5:181212763-181212785 CTGTAAGAGCAGATGAAATTCGG - Intergenic
1003229946 6:4243037-4243059 CTATAAAATCAAAAGCAAATTGG + Intergenic
1004204493 6:13579144-13579166 CTGGAAAAGCAGATACATGTTGG + Intronic
1004749876 6:18551363-18551385 CTGTAAAAGGAAAAGTAATTGGG + Intergenic
1005065050 6:21809561-21809583 CTGTAAAAGCAAATACAAGTGGG - Intergenic
1006034974 6:31204235-31204257 CTGTAAAAGCAGCAGCCAAATGG - Intergenic
1006677558 6:35775402-35775424 CTTCAAAAGCAGAAGCAGGCTGG + Intergenic
1008153941 6:47990198-47990220 CTGAAAAATCAAAAGCAAGCTGG - Intronic
1008756222 6:54797854-54797876 CTGTAAAATCAAAAGCAAGCTGG - Intergenic
1009051636 6:58283173-58283195 CTGTGAAAGCAGATGTAAATGGG + Intergenic
1009324765 6:62337309-62337331 CTTTAAAAGCAGAAACTAGATGG + Intergenic
1009890283 6:69672356-69672378 TTGTAACAGCAGATGCAAGAAGG - Intergenic
1010598676 6:77797315-77797337 CTATAAAAACAGAAACAAGTGGG + Intronic
1011590893 6:88969752-88969774 CTATAAACGGACAAGCAAGTAGG - Intergenic
1012281183 6:97329462-97329484 TTGTAAAATCAAAAGTAAGTCGG - Intergenic
1012356617 6:98322112-98322134 GTGTAAAAGCAGAACCTATTGGG - Intergenic
1013146903 6:107403086-107403108 CTATAAAGTCAAAAGCAAGTTGG + Intronic
1013688172 6:112609854-112609876 CTGTTAAATCAAAAGCAAGTTGG - Intergenic
1014861324 6:126470930-126470952 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1015585591 6:134772824-134772846 TAGCAAAAGCAGAAGCAAGATGG - Intergenic
1015899128 6:138046824-138046846 CTGTAAAATCAAAAGCTACTTGG + Intergenic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1017935335 6:159000066-159000088 CTGGAAGAGCAGGAGCACGTGGG - Exonic
1018051818 6:160015895-160015917 CAGCAAAAGCAGGAGCAAGACGG - Intronic
1019854183 7:3587572-3587594 CTGAAAAAGCGGAGGAAAGTTGG - Intronic
1019866786 7:3719343-3719365 CTGAAAAAGAAGAAAAAAGTAGG + Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1021055291 7:16040074-16040096 CTGTAATAGCATAAGTAACTTGG + Intergenic
1021664476 7:22962292-22962314 CTCTAAAAGCACATACAAGTGGG + Intronic
1022347931 7:29535662-29535684 TTGAAAAAGAAGAATCAAGTGGG - Intergenic
1022862606 7:34383449-34383471 CTATAAAATCAAAAGCAAGTTGG - Intergenic
1023570816 7:41569617-41569639 CTCTAGAAGCAGAAGCAAGAAGG + Intergenic
1023752289 7:43384256-43384278 CTGGAAATGCAGAAGAAGGTAGG + Intronic
1024706460 7:51966453-51966475 CTGTAAAAACAGAATCTATTTGG + Intergenic
1026154321 7:67813873-67813895 AGGTAGAAGCAGGAGCAAGTCGG + Intergenic
1026429541 7:70330567-70330589 TTGTAAAAGGAGAAAAAAGTTGG - Intronic
1027785466 7:82574237-82574259 CTGTAAAATCAAAAGCAAATTGG + Intergenic
1028266250 7:88729930-88729952 CAGTAAAAGCAGTAGTAAGAGGG - Intergenic
1029076419 7:97938348-97938370 TTGTAAAAGAAGAACAAAGTTGG - Intergenic
1030209379 7:106981246-106981268 CAGCAAAAGCAGGAGCAAGAGGG - Intergenic
1030381266 7:108814058-108814080 CTGTAAAATCAAAAACAAGTTGG - Intergenic
1030919031 7:115356861-115356883 CAGGAGAAGCAGAAGCAAGTTGG + Intergenic
1031362768 7:120866903-120866925 CGGTGAAAGCAGGAGCAAGGAGG - Intergenic
1031626034 7:123994186-123994208 CTTCAAAAGCAGGAGCCAGTTGG - Intergenic
1032389204 7:131544785-131544807 CTGGAAAAGCACATGCAAGCTGG + Intronic
1032675017 7:134121851-134121873 CTGAAAGAGGAGAAGGAAGTGGG - Intergenic
1032774098 7:135091744-135091766 CAGTATGAGCAGAAGCAAGGAGG - Intronic
1033837662 7:145335300-145335322 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1033871847 7:145763219-145763241 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1033905103 7:146192857-146192879 CTGTAAAAGTGAAAACAAGTTGG + Intronic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1036106396 8:5845573-5845595 CTGCAAAATCAAAAGCAAGTTGG + Intergenic
1036831630 8:12025152-12025174 TTGTAAAAGAAGAACAAAGTTGG - Intergenic
1037717847 8:21414830-21414852 ATGTAAAAGCAGCATCAAGAAGG - Intergenic
1039671429 8:39604611-39604633 TGGCAAAAGCAGAAGCAAGGAGG - Intronic
1040761113 8:50845186-50845208 ATATAAAAGCTGAAGCAAGCAGG - Intergenic
1040884079 8:52240464-52240486 CTGTTAAACCAGAAGAAAGAAGG - Intronic
1040885441 8:52258218-52258240 CTGGAAAAGAAGAACAAAGTTGG - Intronic
1041193056 8:55372905-55372927 CTGTCAGAGCAGATGCAAGGGGG + Intronic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1042055227 8:64757380-64757402 GTATAAAAGCATAAGCATGTTGG - Intronic
1043433219 8:80214359-80214381 TTGAAAAAGAAGAACCAAGTTGG + Intronic
1043823539 8:84897819-84897841 CTGTGAAACCAGAAACCAGTAGG - Intronic
1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG + Intergenic
1044210302 8:89542396-89542418 GTGTAAAAGCAAGTGCAAGTGGG - Intergenic
1044260959 8:90120253-90120275 TTTTAAAAGCAAAAGCAAGAGGG - Intergenic
1044495224 8:92869815-92869837 CTTTTAAAGTAGAAACAAGTGGG + Intergenic
1044590036 8:93905397-93905419 CTGCAAAAGCAGCATCATGTAGG + Intronic
1045204707 8:100026145-100026167 CTATAAAAGCAGGAGCAAAGGGG + Intronic
1045292236 8:100843502-100843524 CACTTAAAGAAGAAGCAAGTTGG + Intergenic
1046264480 8:111813721-111813743 TTGTAAAATCAAAAGCAAGTTGG + Intergenic
1046703140 8:117423527-117423549 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1047403703 8:124567624-124567646 CTGGAAAAGCACAAGAAAGAAGG - Intronic
1048160320 8:132014585-132014607 ATGAAAAAGCAGAGGCAAGGTGG + Intergenic
1048506661 8:135027765-135027787 CTGTACAAGAAGAATGAAGTGGG - Intergenic
1048537619 8:135312312-135312334 CTGTAAAATTAAAAGCAAGTTGG + Intergenic
1048602189 8:135930236-135930258 CTATAAAAGGACATGCAAGTAGG - Intergenic
1048806637 8:138247083-138247105 CTGCAAAATCAAAAGCAAGTTGG - Intronic
1049389920 8:142362448-142362470 CTGTTACAGCAGCAGAAAGTGGG - Intronic
1050061706 9:1716317-1716339 CTGAAAGAACAGAAGCAATTAGG + Intergenic
1051990296 9:23144981-23145003 CTGTAAAATCAAAAACAAGTTGG + Intergenic
1052081925 9:24216838-24216860 CTGGAAAAAAAGAAGGAAGTTGG - Intergenic
1052141143 9:24986088-24986110 TTGTATAAGCATAGGCAAGTTGG + Intergenic
1052767869 9:32660086-32660108 CTGTGAAATCAAAAGCAGGTTGG + Intergenic
1053564444 9:39233714-39233736 TTGCAAAGGCAGAAGCAAGATGG + Intronic
1053830226 9:42071616-42071638 TTGCAAAGGCAGAAGCAAGATGG + Intronic
1054132706 9:61385322-61385344 TTGCAAAGGCAGAAGCAAGATGG - Intergenic
1054600333 9:67115839-67115861 TTGCAAAGGCAGAAGCAAGATGG - Intergenic
1054922174 9:70553731-70553753 CTGTAAGAGCAGCAGCATCTCGG + Intronic
1055205997 9:73731199-73731221 CTGGAAAAGTACAAGCAAGTGGG + Intergenic
1055403869 9:75953592-75953614 CTGTGAAAGCAAAAACAATTTGG + Intronic
1058784724 9:108375762-108375784 CTGTAAAAGCAGTAACAATAAGG + Intergenic
1059460120 9:114424292-114424314 CTGGAAATGCTGAAGCCAGTTGG + Intronic
1059737755 9:117119339-117119361 CTGCAAACTCAGAAGCAATTGGG - Intronic
1060284903 9:122241848-122241870 CTGTAGCAGCAAAAGCAAATTGG - Exonic
1060603488 9:124894174-124894196 CAGTAAAAGCAGGTGCATGTGGG - Intronic
1061984402 9:134121550-134121572 ATGGGAAAGCAGAAGCAAGGTGG + Intergenic
1062168891 9:135123244-135123266 CTGTCCAAGCACAATCAAGTGGG + Intergenic
1062203757 9:135323381-135323403 TTGAAAAAGAAGAAGAAAGTAGG + Intergenic
1062324204 9:136004598-136004620 CTGTAACAGCAGAATCAGGCCGG + Intergenic
1186493916 X:9996905-9996927 TTCTAAAAGCAGGAGCAGGTTGG + Intergenic
1186979457 X:14943590-14943612 CTATAAAAGGAAAAGTAAGTTGG + Intergenic
1187082716 X:16007933-16007955 CTGTAAAAGTAAAACCATGTTGG + Intergenic
1187129229 X:16485540-16485562 CTGAAAAAGAAGAACAAAGTTGG + Intergenic
1188629315 X:32332592-32332614 CTGTGAAAGCAGCAGCAAAGGGG + Intronic
1188713921 X:33437315-33437337 CAGTAAAAGCAGTACTAAGTGGG + Intergenic
1189107597 X:38253732-38253754 CTGAAAAAGCTGAAGAAACTTGG - Intronic
1189637102 X:43023057-43023079 CTGTAAAATCAAAAGAAAGTTGG + Intergenic
1191598374 X:62973776-62973798 CTGTAAAATCAAAAGCAACTTGG + Intergenic
1191701923 X:64051855-64051877 CTGTGAAAGAAGAATAAAGTTGG + Intergenic
1191713133 X:64174156-64174178 CAGCATCAGCAGAAGCAAGTTGG - Intergenic
1193236539 X:79114030-79114052 CTGTAAAATCAAAAGCAAGCTGG + Intergenic
1193285942 X:79714611-79714633 CTGTAAAATCAAAAACAAGTTGG - Intergenic
1193303427 X:79920497-79920519 CTCTAAAAACAGAAACAAGTCGG - Intergenic
1193455113 X:81722315-81722337 CTGAAAAAGAAGAATAAAGTTGG + Intergenic
1193543130 X:82795480-82795502 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1193632865 X:83911295-83911317 GTGTTAAAGCAGAAGGACGTTGG - Intergenic
1193887853 X:87005983-87006005 CTGTAAAACTGAAAGCAAGTTGG + Intergenic
1194092807 X:89599865-89599887 CTGTGAAAGCAGCCACAAGTGGG - Intergenic
1195242327 X:102964814-102964836 CAGTAAAAGCAGAATAGAGTTGG - Intergenic
1195879246 X:109575480-109575502 TTGTAAAATCAAAAACAAGTAGG - Intergenic
1196664742 X:118304613-118304635 CCGTAAAATCAAAAGCAAGTTGG + Intergenic
1196863909 X:120053007-120053029 ATGTAAAATCAGAAACAAGCAGG - Intergenic
1196879190 X:120183323-120183345 ATGTAAAATCAGAAACAAGCAGG + Intergenic
1197076989 X:122364426-122364448 CTGGAAAAGCAGGGGCAATTAGG - Intergenic
1197360833 X:125501473-125501495 CAGCAAAAGCAGTAGCAAGAGGG - Intergenic
1197423191 X:126263793-126263815 ATGTAAAAGCTGCAGCAATTTGG - Intergenic
1199132553 X:144208569-144208591 CTGTAAAATCGAAAGCAAGCTGG - Intergenic
1199177961 X:144814220-144814242 CAGCAAAAGCAGTAGAAAGTGGG + Intergenic
1199687374 X:150276325-150276347 ATGTAAAAGCAAAATCAATTAGG + Intergenic
1199934020 X:152553609-152553631 CTCTAAAGGCAGGAGCCAGTGGG + Intergenic
1202087240 Y:21151845-21151867 TTGTAAGAGAAGAAGCAGGTAGG + Intergenic