ID: 949944744

View in Genome Browser
Species Human (GRCh38)
Location 3:9180967-9180989
Sequence ACAACAGATGTCTGGAGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949944738_949944744 18 Left 949944738 3:9180926-9180948 CCAGAAAGTCCAGCCCACTGGAT 0: 1
1: 0
2: 1
3: 16
4: 137
Right 949944744 3:9180967-9180989 ACAACAGATGTCTGGAGACACGG 0: 1
1: 0
2: 1
3: 24
4: 220
949944741_949944744 5 Left 949944741 3:9180939-9180961 CCCACTGGATAGGAGAAACTGTG 0: 1
1: 0
2: 0
3: 33
4: 306
Right 949944744 3:9180967-9180989 ACAACAGATGTCTGGAGACACGG 0: 1
1: 0
2: 1
3: 24
4: 220
949944740_949944744 9 Left 949944740 3:9180935-9180957 CCAGCCCACTGGATAGGAGAAAC 0: 1
1: 0
2: 2
3: 32
4: 144
Right 949944744 3:9180967-9180989 ACAACAGATGTCTGGAGACACGG 0: 1
1: 0
2: 1
3: 24
4: 220
949944742_949944744 4 Left 949944742 3:9180940-9180962 CCACTGGATAGGAGAAACTGTGT 0: 1
1: 0
2: 3
3: 26
4: 272
Right 949944744 3:9180967-9180989 ACAACAGATGTCTGGAGACACGG 0: 1
1: 0
2: 1
3: 24
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949944744 Original CRISPR ACAACAGATGTCTGGAGACA CGG Intronic
900333267 1:2147472-2147494 ACAACAGATGTGTGGATAGATGG - Intronic
900944112 1:5820047-5820069 ACACAAGGTGTGTGGAGACAGGG + Intergenic
901757532 1:11450470-11450492 ACAGCAAATGTCTTGAGACCCGG - Intergenic
902335694 1:15753363-15753385 ACAACAAATGACTGGAGACTTGG + Intergenic
904412879 1:30335684-30335706 AGATCTGATGTCTGGAGCCAGGG - Intergenic
905774506 1:40660005-40660027 AGAACAAATGTCAGGAGACCAGG + Intronic
906265058 1:44422355-44422377 ACAACAAAAGTCTGGACGCATGG + Intronic
912194789 1:107385148-107385170 ACAACTGATATCTGAACACAGGG - Intronic
914806599 1:150996526-150996548 ACAACAGATCTCAGGAAAGAAGG + Intronic
918147921 1:181774268-181774290 AAAAGAAATGTCTGGATACATGG + Intronic
918923459 1:190746952-190746974 ACAACAAATTTATGGAAACAAGG - Intergenic
919484739 1:198132479-198132501 GAGACAGATGTCAGGAGACAAGG - Intergenic
919730109 1:200908423-200908445 ACAAAAGATAACTGCAGACATGG + Intronic
919778107 1:201207047-201207069 AGAACAGATACCTGGAGGCAAGG + Exonic
922584756 1:226725260-226725282 AGCACAGGTGTCTGCAGACAAGG + Intronic
924286435 1:242492782-242492804 ACAACAGATGTCTGCAAACCAGG - Intronic
924310649 1:242739426-242739448 ATTACAGATGGCTGGAGGCATGG - Intergenic
924628492 1:245715371-245715393 AGCACAGCTGCCTGGAGACAGGG - Intergenic
1063438158 10:6051006-6051028 CAGACAGATGTCTGGAGAGACGG + Intronic
1068698410 10:59994201-59994223 ACAAGGGATCTCTGGAGAAATGG - Intergenic
1072599787 10:96914926-96914948 CCAACAGATGTCTGGATTTAAGG + Intronic
1072787093 10:98291206-98291228 ACATCAGTTTTCTGGAAACAAGG - Intergenic
1073935599 10:108627610-108627632 AAAGCATATCTCTGGAGACATGG + Intergenic
1073939925 10:108685096-108685118 AGGACAAGTGTCTGGAGACAGGG - Intergenic
1075313765 10:121435739-121435761 AAAACTTATGTCTGGAGACAGGG + Intergenic
1075408804 10:122212273-122212295 ACAAAAGATGACTGGAGAGAAGG - Intronic
1076803827 10:132845334-132845356 TCCAGAGATGTCTGCAGACATGG - Intronic
1081709096 11:45205561-45205583 GCCTCAGATGTCTGGAGTCAGGG + Intronic
1081848511 11:46258714-46258736 ACAGCAGAAGACTGGACACAAGG + Intergenic
1084609923 11:70195513-70195535 ACAGCTTATGCCTGGAGACATGG + Intergenic
1084872577 11:72108163-72108185 ACAAGGGATGTCTGGGGGCAAGG - Intronic
1085084611 11:73658559-73658581 AAAGCAGATGTGTGAAGACAAGG + Intronic
1088336094 11:108705569-108705591 ACATTAGATCACTGGAGACAGGG + Intronic
1088912961 11:114205945-114205967 AGACCACTTGTCTGGAGACAGGG - Intronic
1089927162 11:122270817-122270839 AAAAGAGACGTCTGGAGCCATGG - Intergenic
1090080434 11:123608939-123608961 ACCACAGAAGGCTGGAGAGAGGG - Intronic
1090382701 11:126338112-126338134 AGAACAGATGCTTGGGGACAGGG + Intronic
1090588030 11:128235457-128235479 ACACCAGATGTCAGGAGACTTGG - Intergenic
1090931743 11:131303908-131303930 ACAACACATGTCTGGATACCTGG + Intergenic
1090950337 11:131467417-131467439 AAAACCAATGTCTGGAGGCAGGG - Intronic
1093648255 12:21613757-21613779 ACCACAGATTTCTGGAGATCAGG + Intergenic
1093769329 12:23001068-23001090 ACAAAAGATGTCTGAGGAGAGGG + Intergenic
1094053591 12:26246259-26246281 ACAACAGAAGACTGGAGGAAGGG + Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1095653871 12:44646643-44646665 ACTACAGATGACTGAAGCCATGG + Intronic
1095817971 12:46445415-46445437 TGAACAGATGTGTGGAGAAAGGG + Intergenic
1096327551 12:50678098-50678120 AGTGCAGAGGTCTGGAGACATGG + Intronic
1096531184 12:52243862-52243884 ATAACAGATGCCTGGAGAGCAGG + Intronic
1098213718 12:68193727-68193749 ACAACACAGGCCAGGAGACAAGG + Intergenic
1099270949 12:80510354-80510376 AAAACAGTTGTCTGGTGTCACGG + Exonic
1099830867 12:87840827-87840849 ACAACTCATGTCTGGAGAAAGGG - Intergenic
1101535906 12:105616377-105616399 AAAACAGATGTCAGAAGCCAGGG - Intergenic
1102449540 12:113030457-113030479 AAAACTGATGTCTAGAGACTTGG + Intergenic
1102619835 12:114185450-114185472 ACATCAGCTTTCTGGAGGCAAGG + Intergenic
1104054186 12:125216802-125216824 TCCACAGATGTCTGGACCCAGGG + Intronic
1104136050 12:125939935-125939957 ACAAAATAGGTCTGGAGACTGGG - Intergenic
1104598629 12:130137558-130137580 GCAACAAATTTCTGGAGACCTGG - Intergenic
1107952495 13:45476383-45476405 ATTTCAGATGTCTGAAGACAAGG + Intronic
1109030580 13:57183326-57183348 ACAACAGATGCCTGGTGAATAGG - Intergenic
1110360121 13:74615198-74615220 ATAAGAGATGTATTGAGACATGG - Intergenic
1110757116 13:79188473-79188495 AGAGCAGGTGTCTGGAGTCAAGG + Intergenic
1116232261 14:42232537-42232559 GCAACAGATGTGTGAAGATATGG + Intergenic
1119151053 14:72359689-72359711 AGAACAAGTGGCTGGAGACAAGG + Intronic
1120496200 14:85239593-85239615 TCACCAGATGTATGGAGAAAAGG + Intergenic
1120590820 14:86371589-86371611 AAAAAAGATGTCTGGTGACATGG + Intergenic
1120905470 14:89617117-89617139 ATAACCGATGAGTGGAGACATGG - Intronic
1121660997 14:95635006-95635028 AGAATAGATGGCTGGGGACAAGG - Intergenic
1123004226 14:105313962-105313984 AGAACAAATGTCTGGGGCCAAGG - Exonic
1126259656 15:46673383-46673405 AGAACAGATGTCTGGCCACACGG - Intergenic
1127883863 15:63181983-63182005 ATAACAGATGTCCTGAGACCTGG - Intergenic
1128089292 15:64908386-64908408 ATAACAAAAGTCTGGAAACAGGG + Intronic
1128544614 15:68558683-68558705 ACCACATCTGTCTGGAGTCAAGG - Intergenic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1135054301 16:19218320-19218342 AAAACTGTTGTCTGGAGTCAGGG - Intronic
1137536624 16:49332126-49332148 GGAACAGGTATCTGGAGACATGG - Intergenic
1138336835 16:56260091-56260113 ACAGCTGATGTCAGGAGGCAGGG + Intronic
1140318407 16:73922402-73922424 AATACAGATTCCTGGAGACACGG + Intergenic
1142628336 17:1206737-1206759 ACAAAATATTTTTGGAGACATGG - Intronic
1143361418 17:6374728-6374750 AAAGCAGATGTTTGGAGACTGGG + Intergenic
1143809191 17:9456771-9456793 ACAAAAGATGTTTGGAAAGATGG - Intronic
1149256831 17:54836657-54836679 ACAACAGTTCTCAGGAGACCTGG + Intergenic
1150655543 17:67036893-67036915 AGAACAGATTTTGGGAGACAAGG - Intergenic
1151237596 17:72732704-72732726 ACACCAGATGCCTGGGGGCAAGG - Intronic
1155279750 18:24227503-24227525 TAAACAGATGTCTGAAAACATGG + Intronic
1157273618 18:46294809-46294831 GCAACAGAAATCTGGTGACAGGG - Intergenic
1157545388 18:48542897-48542919 CCAACAGGTTTCTGGCGACACGG + Intronic
1158924590 18:62241308-62241330 ACAACAGATCTCTTGAGCCCAGG + Intronic
1159006576 18:63018656-63018678 ACAAGAGAAGTCAGAAGACAAGG + Intergenic
1159116393 18:64117779-64117801 AAAACAAATGTGTGGAAACATGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1162845186 19:13386944-13386966 ACAAAAGAAGTCTGGAGGCCAGG - Intronic
1164315482 19:24084513-24084535 ACAGAAGATGTTTGGATACATGG - Intronic
1168127565 19:54294435-54294457 AGAACTCATGTCAGGAGACAGGG - Intergenic
1168361204 19:55742271-55742293 ACAATAAATTTCTTGAGACAAGG + Intergenic
925262363 2:2539823-2539845 ACAACATCTTTCTGGAGACTTGG - Intergenic
926530520 2:14039260-14039282 AGAGCAGAGGTCTTGAGACAAGG + Intergenic
926860624 2:17305077-17305099 AAAACAAATCTCTGGAGATAGGG - Intergenic
926863468 2:17333902-17333924 ACAACAGAATACTGGAGACTGGG - Intergenic
928453058 2:31395934-31395956 ACCACAGCTATCTGGTGACAAGG - Intronic
931569672 2:63655296-63655318 AAACCAGATGGCTGGAGAAAGGG - Intronic
931798606 2:65736344-65736366 CGAATAGATGTCTGGAGGCATGG + Intergenic
933297773 2:80509780-80509802 ATAACTAATGTGTGGAGACAAGG - Intronic
933770805 2:85742788-85742810 CAAACAGAGCTCTGGAGACATGG + Intergenic
936982926 2:118280383-118280405 TGAACAGATGAATGGAGACATGG - Intergenic
939176819 2:138758735-138758757 ACATCAGATTTCTCCAGACATGG - Intronic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
940215868 2:151303106-151303128 ACATCAGTTCTCTGGACACATGG + Intergenic
943785844 2:191877811-191877833 ACAAAAGATGTCTTTAGGCATGG - Intergenic
944560190 2:200928480-200928502 ATGACAGATGACTGGAGGCAAGG + Intronic
945043067 2:205758630-205758652 ACAACAGATGTTTTGGGTCAAGG + Intronic
946184864 2:217974852-217974874 ACTACAGATGCCCAGAGACAGGG - Intronic
946353948 2:219173179-219173201 AACACAGATTTCTAGAGACAAGG - Intronic
948744121 2:240073511-240073533 AAAACAGATGTTTGTAAACATGG - Intergenic
949021813 2:241744997-241745019 AGCAGAGATGTCAGGAGACACGG - Intronic
1169166746 20:3430645-3430667 AGAACAGTTCTCTGGAGAAAGGG - Intergenic
1170435016 20:16317750-16317772 AGAAGAGATGACGGGAGACAAGG + Intronic
1170446640 20:16434884-16434906 ACAGCAGATGTCTGGGGGCTGGG + Intronic
1170709663 20:18778944-18778966 GAAACACATGTCTGGAGTCAAGG - Intergenic
1171047518 20:21824668-21824690 AGAACAGATGTGTGGGGAGAAGG - Intergenic
1176277215 20:64279199-64279221 ACAACAGATCTCTGTGGACCAGG - Intronic
1177670004 21:24212668-24212690 GCTACAGATGTGTGGAGGCAGGG + Intergenic
1177675082 21:24286673-24286695 CAATCAGATGTCTTGAGACAAGG - Intergenic
1178559324 21:33623515-33623537 AAAACAGAAGTCTGCAGACAAGG + Intronic
1179623772 21:42635790-42635812 ACAACAGATGGATGGAGAGAAGG - Intergenic
1180932224 22:19599982-19600004 AGAACAGCTGTCTTCAGACAGGG - Intergenic
1181824956 22:25507609-25507631 TGAACAGAGGTATGGAGACATGG - Intergenic
1182438726 22:30348507-30348529 AAGACAGATGGCAGGAGACAGGG + Intronic
1183240424 22:36653673-36653695 GCCACAGGTGTCTGCAGACATGG + Intronic
1184826500 22:46956191-46956213 ACAGAAGATGTTTGGAGATAGGG + Intronic
1184943941 22:47787825-47787847 AACACAGATGCCAGGAGACAGGG + Intergenic
949208873 3:1474008-1474030 ACGACAGATATCTGGAAATAGGG - Intergenic
949222330 3:1650584-1650606 ACAACAGATGGCTGGAGAGGAGG - Intergenic
949944744 3:9180967-9180989 ACAACAGATGTCTGGAGACACGG + Intronic
950316078 3:12003554-12003576 CCAAGAGAAGACTGGAGACATGG - Intergenic
951033796 3:17910861-17910883 AAAACAAAGCTCTGGAGACAGGG - Intronic
951364403 3:21763155-21763177 TCAACAGGTCTCTGGAGAGAAGG - Intronic
952936503 3:38402629-38402651 CAAACAGAGGTCTGGAGACAAGG - Intronic
955991681 3:64634389-64634411 ACAATGGTTGTCTGGAGAGAGGG - Intronic
957240707 3:77657795-77657817 ACAACAGTTCTCTGGAAGCAAGG + Intergenic
957369932 3:79280488-79280510 ACTACAGCTGTTTGGAAACAGGG + Intronic
957636850 3:82797568-82797590 ACAATAGATGCCAGAAGACAGGG - Intergenic
959167927 3:102803771-102803793 ACAACAGATGTCTGGAAAACTGG + Intergenic
959470554 3:106744643-106744665 ATAACATCTGTCAGGAGACAGGG - Intergenic
960462895 3:117958809-117958831 GCAAGAGATGTGTGGAGATATGG - Intergenic
960941961 3:122940770-122940792 ACAGCAGAGGCCTGGAGCCAAGG - Intronic
962433574 3:135344219-135344241 ACAAATCATGTCTGGAGTCAAGG + Intergenic
963993131 3:151676588-151676610 AGAGCCGATGTCTCGAGACAGGG - Intergenic
964626168 3:158762122-158762144 TCAACATATGACTGGAGGCAAGG - Intronic
965720274 3:171653936-171653958 GGACCAGATGTCTGGAGACCTGG - Intronic
966075558 3:175933016-175933038 AAAACAGAAATCTGGAGAGATGG + Intergenic
966718798 3:183040299-183040321 AAAATATATGACTGGAGACATGG - Intronic
966758544 3:183393853-183393875 ACAACAGAGGGCAGGAAACAGGG + Intronic
968658905 4:1790905-1790927 AGAGCAGATGTCTGGAATCAAGG - Intergenic
969157693 4:5225955-5225977 AGAACAGAAGTCTGAAGAAACGG - Intronic
970033372 4:11703099-11703121 ACAACACAAGTCTTGAAACAAGG - Intergenic
976022999 4:80653333-80653355 ACAACAGAGGGATGGAGAAAAGG - Intronic
977791494 4:101109510-101109532 ACAACTGAGGTCTGAATACATGG + Intronic
979167523 4:117555010-117555032 CCAACAAATATCTGGAGAGATGG - Intergenic
982171720 4:152668458-152668480 ACGGCAGATGTCTTGAGGCAAGG - Intronic
985660340 5:1153852-1153874 ACAGCAGCTGTTTGAAGACAGGG + Intergenic
989299777 5:39877188-39877210 ACATGAGATGTCTTCAGACATGG - Intergenic
991295220 5:65073309-65073331 ACAACAGAAGTCTGGAGAGATGG + Intergenic
993032082 5:82716185-82716207 AGAAAAAATGTCTAGAGACAGGG + Intergenic
996153672 5:120071621-120071643 TTTACAGATGTCTGGAGCCAGGG + Intergenic
997712024 5:136013905-136013927 ACATCTGATGTTTGGATACAGGG - Intergenic
997874076 5:137532756-137532778 ACAACCTATGACTGGGGACAAGG - Intronic
998269606 5:140694763-140694785 AAAAGAGATCTGTGGAGACAAGG - Intronic
999684390 5:154089213-154089235 ACAACAGATGTCTGCTGCAAAGG - Intronic
999736512 5:154517333-154517355 ATAACAGGCGTCTGGAGATAAGG - Intergenic
999842295 5:155441255-155441277 AGAACACATGTTTGGAGAAAAGG + Intergenic
1001161627 5:169322112-169322134 AAAGCAGTTGTCTGGAGACTAGG - Intergenic
1002261252 5:177995372-177995394 AGAAAAGATGTCTGGAGCCGAGG + Intronic
1003492606 6:6636759-6636781 ACCATTGAAGTCTGGAGACAAGG - Intronic
1004781767 6:18916343-18916365 AAAAAAGATGTCTGTGGACAAGG - Intergenic
1005686325 6:28256233-28256255 GCAACATCTGTCTAGAGACAGGG + Intergenic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1008040932 6:46797474-46797496 AGAACAGATGTTTGGAGATACGG + Intronic
1008456752 6:51719886-51719908 ACAAAAGATTTATGGAGACATGG - Intronic
1008900332 6:56606983-56607005 TCAGCAGATGCCTGAAGACAAGG - Intronic
1010377924 6:75194690-75194712 TCAGCAAATGTCTGGTGACATGG + Intronic
1010561149 6:77352281-77352303 ACAAGAGATGTTTTGACACAGGG + Intergenic
1011276899 6:85641436-85641458 TGAACAGATCTCTGGAAACATGG - Exonic
1011538467 6:88403980-88404002 CCATAAGATGTCTGGAGTCAGGG + Intergenic
1013074642 6:106760659-106760681 ACAGCAGAAGGCTGTAGACAGGG + Intergenic
1013389268 6:109666805-109666827 AGAAGAGATGGCTGGACACAAGG - Intronic
1013880041 6:114886814-114886836 ACAAAATATGTCTGGACCCATGG - Intergenic
1015245525 6:131070261-131070283 AGAAGAGATCACTGGAGACAAGG + Intergenic
1016071515 6:139744794-139744816 TCATCAGATGTTTGTAGACAGGG - Intergenic
1016699378 6:147036715-147036737 ACTACAGATATCTGTAGACCCGG - Intergenic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1025826718 7:65016709-65016731 AAAAAAAATTTCTGGAGACAAGG + Intergenic
1028218633 7:88167131-88167153 ACATCAGAGGTCAGGAGTCATGG - Intronic
1029371196 7:100151873-100151895 AAAAAAAATGTGTGGAGACAGGG + Intronic
1029643180 7:101834019-101834041 ACAACAGAAGTCTGGGGATAAGG - Intronic
1032371500 7:131357803-131357825 ACAACAGTTCTATGGAGAAATGG - Intronic
1032800940 7:135316891-135316913 AGGCCAGATGTCTGGGGACAGGG - Intergenic
1033017073 7:137682166-137682188 GCAACTGATGTCAGAAGACAGGG + Intronic
1033069158 7:138186181-138186203 ATTACAGATGGATGGAGACATGG + Intergenic
1033613792 7:142991620-142991642 ACAACCTATTCCTGGAGACAAGG - Intergenic
1033859252 7:145605008-145605030 AAAACAAATTTGTGGAGACAGGG - Intergenic
1035529918 8:343038-343060 AGAGCAGAACTCTGGAGACAAGG - Intergenic
1037571964 8:20165428-20165450 ACAATAGATGTCTGGACTCCTGG + Intronic
1038716196 8:29993411-29993433 AGGACAGATTTCAGGAGACAGGG + Intergenic
1040559999 8:48515174-48515196 AAAACAGATGCGTGGAGAGAAGG - Intergenic
1041785554 8:61628971-61628993 ACACCAGAGGTCTGGGGGCAAGG - Intronic
1041872953 8:62655801-62655823 ACAACAGGTGTTTGCAAACATGG + Intronic
1042231049 8:66555062-66555084 ACAACACATTTCTGGAGATGTGG + Intergenic
1043508263 8:80924114-80924136 ACAACAGATTTCAGGAGAGGAGG + Intergenic
1044895260 8:96885095-96885117 AGATCAGAGTTCTGGAGACAGGG + Intronic
1047424823 8:124735655-124735677 ACAAAAGAGGTTAGGAGACATGG + Intergenic
1048383753 8:133892313-133892335 ACAACAGATGTCATGAAAGATGG - Intergenic
1048775054 8:137936312-137936334 ACAGCACATGACTGCAGACAGGG + Intergenic
1049796487 8:144499507-144499529 ACTACAGATGCCTGGAGCAAAGG - Intronic
1052271413 9:26631835-26631857 ACAATTGAAGGCTGGAGACAGGG + Intergenic
1053482719 9:38427866-38427888 CCACCAGAGGTCTGGAGAAAGGG - Intergenic
1055152967 9:73025208-73025230 TCCACAGTTGGCTGGAGACAGGG - Intronic
1056591850 9:87970698-87970720 ACAAGCAATGTCTGGAGAAAAGG + Intronic
1056810465 9:89760042-89760064 CCAACATATTTCTGGAGAAATGG + Intergenic
1057224309 9:93280746-93280768 ACAACATATGCCAGTAGACAAGG - Intronic
1058803929 9:108571750-108571772 ACAAAAAATGTCTGGGGGCAGGG + Intergenic
1059408101 9:114114637-114114659 ACCACAGATGTCTGTTGCCATGG - Intergenic
1059863417 9:118488761-118488783 ACAACAGTTTTATGGAGGCAAGG + Intergenic
1060668922 9:125451307-125451329 GAAACAGATGACTGGAGACGTGG - Intronic
1061841545 9:133361255-133361277 GCAGCAGATGTCATGAGACAAGG - Intergenic
1062032218 9:134366799-134366821 TCCACAGATGCCTGGGGACAAGG + Intronic
1062183732 9:135205169-135205191 ACATCAGAAGGCTGGAGACATGG + Intergenic
1185819800 X:3191410-3191432 CAAGCAGATGTGTGGAGACAAGG - Intergenic
1186512794 X:10143123-10143145 ACAACAGAGGTGGGGAGACACGG + Exonic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1189121980 X:38404802-38404824 TCAAGAGATTTCTGGGGACATGG + Intronic
1189266215 X:39718607-39718629 GAAACAGATGTCTGGGGAGAAGG + Intergenic
1189980532 X:46505956-46505978 GCAACAGCTGTCTGGGGATAGGG - Intronic
1193031859 X:76907253-76907275 ACTCCAAATGTCTGGAGATATGG - Intergenic
1193416973 X:81237510-81237532 TCAGCTGATGTCTGGACACAGGG + Intronic
1197359585 X:125483595-125483617 ACAAGAGATGTCTTTAGGCAGGG + Intergenic
1198971923 X:142291514-142291536 AAAAGAGATGTGGGGAGACAAGG - Intergenic
1200305599 X:155023300-155023322 ACTACAGAGGTCAGGAGAAAGGG - Intronic
1200373801 X:155757701-155757723 ACAAAAAATCTCTGGAGGCAAGG + Intergenic
1201280957 Y:12341406-12341428 AAAACAGAAGTGTGGAGACATGG - Intergenic
1201727038 Y:17165257-17165279 TCAAGAGATGTCTTGAGACTTGG + Intergenic