ID: 949948301

View in Genome Browser
Species Human (GRCh38)
Location 3:9207774-9207796
Sequence CAATTCTCCAAGAGGGCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949948294_949948301 28 Left 949948294 3:9207723-9207745 CCTTTGGGAAGGGGATGTGATCT 0: 1
1: 0
2: 3
3: 23
4: 202
Right 949948301 3:9207774-9207796 CAATTCTCCAAGAGGGCAGGCGG 0: 1
1: 0
2: 2
3: 18
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949948301 Original CRISPR CAATTCTCCAAGAGGGCAGG CGG Intronic
900985458 1:6070626-6070648 CATTTCCCAAAGAGAGCAGGAGG - Intronic
900991546 1:6100468-6100490 CAATGGTGCCAGAGGGCAGGTGG + Exonic
903575541 1:24337568-24337590 GAAGTCTCCTAGAGGGCAGTGGG - Intronic
904405548 1:30285946-30285968 CAATCCTCCAAGAGGCCAGGAGG + Intergenic
904458535 1:30661910-30661932 CAATCCTCCAAGAGGCCAGGAGG + Intergenic
905467591 1:38167031-38167053 GAATTCTCCATGAGGGAAGGTGG + Intergenic
906249775 1:44302027-44302049 CAATTCACTAAGAGAGCTGGAGG + Intronic
906783358 1:48592181-48592203 TAATTGTGCAAGGGGGCAGGAGG - Intronic
907484028 1:54764548-54764570 CAATTGGCGAAAAGGGCAGGAGG - Intergenic
907488386 1:54792862-54792884 CCCTTCTCCAGGAGGGGAGGGGG - Intronic
916638738 1:166703111-166703133 CCATTCTCCCAGTGTGCAGGTGG - Intergenic
918405730 1:184210095-184210117 CAATCCTCTTAGAGGGAAGGGGG - Intergenic
921257467 1:213355365-213355387 CGATTCTGCAAGGGGGCACGGGG - Intergenic
923588111 1:235294151-235294173 CAATTTTCCAGGTGGCCAGGTGG - Intronic
923683015 1:236134372-236134394 AAAATCTCCAAGAGTGCTGGAGG - Intergenic
1063239523 10:4153650-4153672 CATTTCTTCATGAGGGCAAGGGG + Intergenic
1063731368 10:8700693-8700715 CCCTTCTCATAGAGGGCAGGTGG - Intergenic
1064002403 10:11674576-11674598 CCATTCTTCCAGTGGGCAGGTGG - Intergenic
1064344574 10:14520291-14520313 CATTTCTCCAAGAGGAGAGTGGG - Exonic
1065733893 10:28733993-28734015 GAATTCTCCCTGAGGGCAGAAGG - Intergenic
1069548155 10:69343481-69343503 CAATTCTCAGAGAGAGAAGGAGG + Intronic
1070499226 10:77054762-77054784 CCATTCTTCAAGATGGCAGATGG + Intronic
1073953480 10:108839074-108839096 CCATTCTCCCAGTGTGCAGGTGG + Intergenic
1076082242 10:127592892-127592914 TAATTCTCCTAGTGGGCACGTGG + Intergenic
1076883376 10:133250203-133250225 CGGTTCTGCAAGAGGGAAGGAGG + Intergenic
1079151283 11:17901814-17901836 AAAGTCTTTAAGAGGGCAGGAGG - Intronic
1079612004 11:22444928-22444950 CAACTCTCTAAGTAGGCAGGTGG - Intergenic
1080052566 11:27871945-27871967 TACATATCCAAGAGGGCAGGGGG - Intergenic
1082032019 11:47611597-47611619 CAAGTCTCCAAGATGACACGTGG - Intergenic
1082660691 11:55907059-55907081 CACTTCTCAAGCAGGGCAGGAGG + Intergenic
1083395262 11:62386857-62386879 CCATTCTACTGGAGGGCAGGTGG + Intronic
1083475391 11:62912013-62912035 GAATTCTCTATGAGGGCAGCAGG + Intronic
1089699217 11:120234383-120234405 CATGTCTCCATGAGGTCAGGAGG - Intergenic
1089852402 11:121511142-121511164 TAATTCTCCAAGAAGGTAGTGGG + Intronic
1090623169 11:128579883-128579905 CAATTGCCAAAGAGGGTAGGGGG - Intronic
1091862125 12:3795155-3795177 CCATGCTTAAAGAGGGCAGGAGG - Intronic
1091987730 12:4926286-4926308 CAATTCCCCAAGAGAGCTGATGG + Intronic
1094042107 12:26129069-26129091 TAATTCTCCAGAAGGGCAGTAGG - Intronic
1095414825 12:41965346-41965368 CAAATCTCAGAGAGGTCAGGTGG - Intergenic
1096551748 12:52377857-52377879 AAATCCTCCAAGAGGACATGGGG + Exonic
1097982380 12:65747505-65747527 CAATGCTGCAGCAGGGCAGGAGG + Intergenic
1098184758 12:67884239-67884261 AAATTCTCAAAGATGGAAGGAGG + Intergenic
1102540781 12:113617728-113617750 CTCTTCTGCAAGATGGCAGGTGG - Intergenic
1104220320 12:126776394-126776416 CGCTTCTCCCAGTGGGCAGGTGG - Intergenic
1104733767 12:131123450-131123472 CAATGTCCCAAGAGGGCATGAGG - Intronic
1105484086 13:20809493-20809515 CAATTCTCCCATATGGGAGGTGG - Intronic
1110411335 13:75206526-75206548 GAGCTCTCCAAGAGGGCAGTTGG + Intergenic
1112247682 13:97749399-97749421 CAATACTCCAAGACACCAGGTGG + Intergenic
1112958276 13:105088657-105088679 GGATTCTACAAGAGGGAAGGAGG - Intergenic
1112990846 13:105512479-105512501 CAATTCTCCTAGATGGCCGGGGG - Intergenic
1113087605 13:106584379-106584401 CAATGATCCAAGATGGCAGCAGG + Intergenic
1113876764 13:113599612-113599634 CACTGATCCAACAGGGCAGGGGG - Intronic
1115375494 14:32671008-32671030 GAAAGCTCCATGAGGGCAGGAGG - Intronic
1116680467 14:47962475-47962497 CTAATATCAAAGAGGGCAGGTGG + Intergenic
1117701201 14:58415212-58415234 CAATGCTCCATGAGGGGAAGTGG - Intronic
1119185800 14:72641596-72641618 AAATTCTCCAGGAGGGAAGTTGG + Intronic
1119526542 14:75327240-75327262 GAATGCTCCAACAGGGAAGGAGG - Intergenic
1120391441 14:83913445-83913467 CACTTCTCCAAGAATGCAGGTGG + Intergenic
1122310224 14:100789563-100789585 CAATTCTCCTGGAGGGCTGCAGG - Intergenic
1122610302 14:102977766-102977788 GATTTCTCCCAGAGGCCAGGGGG - Intronic
1122930304 14:104930152-104930174 CAAGTCCCCAGGAGTGCAGGCGG - Intronic
1125224348 15:37378468-37378490 AAATTCTCAAAGAGGGCACTGGG - Intergenic
1128333848 15:66773692-66773714 GAGTTTTCCAGGAGGGCAGGAGG + Intronic
1128530588 15:68442983-68443005 CAAAACTCCATCAGGGCAGGAGG - Intergenic
1130864729 15:87922936-87922958 CAAAGCACCAAGATGGCAGGTGG + Intronic
1130920695 15:88342087-88342109 AAACTATCCAAGGGGGCAGGTGG + Intergenic
1131396714 15:92092082-92092104 CTTTTCTGCAAGAGGGCAGGAGG + Intronic
1132047796 15:98579451-98579473 CATCTCTCCAGGAGGGCATGGGG - Intergenic
1132713077 16:1277899-1277921 TGATTCTCCAAGGGAGCAGGGGG + Intergenic
1134093001 16:11401496-11401518 CAAGGCTGCAAAAGGGCAGGTGG + Intronic
1134310354 16:13070598-13070620 CAAATTTCCAAAAAGGCAGGAGG + Intronic
1138538980 16:57676933-57676955 CATTTCTTCCAGAAGGCAGGAGG - Intronic
1138787997 16:59869185-59869207 CCATTCTCCCAGTGTGCAGGTGG + Intergenic
1140339529 16:74143327-74143349 GAATTATCCAAGAGGAAAGGTGG - Intergenic
1140405552 16:74708628-74708650 GAATTGTCCAATAGGACAGGAGG - Intergenic
1143594368 17:7905731-7905753 GAGTTCTCCAAGAGGGCATGAGG + Intronic
1144969110 17:19096065-19096087 CAGTCCTGAAAGAGGGCAGGAGG - Intronic
1144978806 17:19156001-19156023 CAGTCCTGAAAGAGGGCAGGAGG + Intronic
1144989416 17:19222231-19222253 CAGTCCTGAAAGAGGGCAGGAGG - Intronic
1146812750 17:35916984-35917006 CCATTCTTCAACAGAGCAGGAGG - Intergenic
1149436657 17:56639232-56639254 CAGTAATCCAGGAGGGCAGGTGG + Intergenic
1149529115 17:57380678-57380700 CAACAGTCTAAGAGGGCAGGGGG + Intronic
1150168990 17:62971902-62971924 CAATTTTTCCAGAGGGTAGGGGG - Intergenic
1152144356 17:78559359-78559381 CCATTGGCCAAGAGGGCAGGTGG - Intronic
1152637184 17:81434982-81435004 CCCTTCTCCAGGTGGGCAGGAGG + Intronic
1153539844 18:6141724-6141746 CAATTCTTCAAGAAGGAAGATGG - Intronic
1158703288 18:59768694-59768716 CAATTCTCCTATAGCTCAGGAGG - Intergenic
1159052418 18:63433749-63433771 GAATTCTCCAAGAGGACCAGGGG - Intergenic
1159332170 18:67010121-67010143 CAACTCTCCAAGTGGACATGTGG - Intergenic
1159960729 18:74554159-74554181 CAATGCTGGAAGAGGGCATGTGG - Intronic
1160588306 18:79925255-79925277 CAGAAATCCAAGAGGGCAGGTGG + Intronic
1163200174 19:15761036-15761058 GAATTGACAAAGAGGGCAGGGGG + Intergenic
1163514627 19:17755545-17755567 CAATTCTCCAGGATGGGAAGGGG - Intronic
1165511711 19:36270067-36270089 CATTTCTCGATGAGGGCAGAGGG - Intergenic
1165512260 19:36272568-36272590 CATTTCTCGATGAGGGCAGAGGG - Intergenic
1165512807 19:36275109-36275131 CATTTCTCGATGAGGGCAGAGGG - Intergenic
1165513363 19:36277664-36277686 CATTTCTCGATGAGGGCAGAGGG - Intergenic
1165513912 19:36280198-36280220 CATTTCTCGATGAGGGCAGAGGG - Intergenic
1165514465 19:36282735-36282757 CATTTCTCGATGAGGGCAGAGGG - Intergenic
1165515016 19:36285268-36285290 CATTTCTCGATGAGGGCAGAGGG - Intergenic
1165515567 19:36287804-36287826 CATTTCTCGATGAGGGCAGAGGG - Intergenic
1165516118 19:36290341-36290363 CATTTCTCGATGAGGGCAGAGGG - Intergenic
1165516668 19:36292867-36292889 CATTTCTCGATGAGGGCAGAGGG - Intergenic
1165517221 19:36295390-36295412 CATTTCTCGATGAGGGCAGAGGG - Intergenic
1165517773 19:36297925-36297947 CATTTCTCGATGAGGGCAGAGGG - Intergenic
1165518326 19:36300460-36300482 CATTTCTCGATGAGGGCAGAGGG - Intergenic
1165518876 19:36302992-36303014 CATTTCTCGATGAGGGCAGAGGG - Intergenic
1165519425 19:36305507-36305529 CATTTCTCGATGAGGGCAGAGGG - Intergenic
1165519973 19:36308035-36308057 CATTTCTCGATGAGGGCAGAGGG - Intergenic
1165624094 19:37270546-37270568 CATTTCTCGATGAGGGCAGAGGG + Intergenic
1165624640 19:37273087-37273109 CATTTCTCGATGAGGGCAGAGGG + Intergenic
1165625183 19:37275614-37275636 CATTTCTCGATGAGGGCAGAGGG + Intergenic
1165625717 19:37278152-37278174 CATTTCTCGATGAGGGCAGAGGG + Intergenic
1165626258 19:37280680-37280702 CATTTCTCGATGAGGGCAGAGGG + Intergenic
1165626796 19:37283207-37283229 CATTTCTCGATGAGGGCAGAGGG + Intergenic
1165627338 19:37285725-37285747 CATTTCTCGATGAGGGCAGAGGG + Intergenic
1165627879 19:37288253-37288275 CATTTCTCGATGAGGGCAGAGGG + Intergenic
1165628416 19:37290777-37290799 CATTTCTCGATGAGGGCAGAGGG + Intergenic
1165628953 19:37293305-37293327 CATTTCTCGATGAGGGCAGAGGG + Intergenic
1165629499 19:37295828-37295850 CATTTCTCGATGAGGGCAGAGGG + Intergenic
1165630040 19:37298353-37298375 CATTTCTCGATGAGGGCAGAGGG + Intergenic
1165630583 19:37300881-37300903 CATTTCTCGATGAGGGCAGAGGG + Intergenic
1165631117 19:37303422-37303444 CATTTCTCGATGAGGGCAGAGGG + Intergenic
1166738385 19:45099503-45099525 TCATGCTCCAACAGGGCAGGGGG - Intronic
927309542 2:21614727-21614749 CAATTCAGCAAGACAGCAGGAGG - Intergenic
927882694 2:26699788-26699810 CACTGCTCCAGGACGGCAGGCGG + Intronic
928443698 2:31314680-31314702 CCATACTCCAAGAGGGCACAGGG + Intergenic
929508438 2:42547181-42547203 CAATTCGCCAATCGGGCAGCCGG + Intronic
933541411 2:83647702-83647724 CCATTCTCCCAGTGCGCAGGCGG - Intergenic
935197244 2:100824642-100824664 CATCTCTCCTAGATGGCAGGAGG - Intronic
935708507 2:105877153-105877175 AAATGCACCAAGAGTGCAGGTGG - Intronic
935802018 2:106707294-106707316 TAATTTTCCAAGAGTGAAGGAGG + Intergenic
940421045 2:153479154-153479176 CCATTCGCCCAGAGGTCAGGGGG - Intergenic
943024132 2:182608156-182608178 CTCTTCTCCAAGAGGGGTGGGGG + Intergenic
944844662 2:203656807-203656829 CAATCATGCAAGAGGGCAAGAGG - Intergenic
946165308 2:217859948-217859970 CAATTCTCAGAGTGGACAGGAGG + Intronic
946888417 2:224247819-224247841 CACCTCTTCATGAGGGCAGGGGG + Intergenic
948703442 2:239775073-239775095 GAAACCTCCCAGAGGGCAGGAGG + Intronic
1170152641 20:13241454-13241476 GAATTCTTCAAGAAGGCAAGGGG + Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1170931685 20:20774354-20774376 CATGTCTCCAAGGTGGCAGGTGG - Intergenic
1171985855 20:31660836-31660858 CAATTCTCGAACCGGGAAGGTGG + Intergenic
1175281070 20:57804548-57804570 CAGTTCTCAAAGTGGGCATGTGG - Intergenic
1175905836 20:62378905-62378927 CACATTTCCCAGAGGGCAGGAGG + Intergenic
1176235858 20:64053195-64053217 CAACTCTGGGAGAGGGCAGGTGG + Intronic
1176705613 21:10118525-10118547 GATTTCTCCATGAGGGCAGAGGG + Intergenic
1177414825 21:20780121-20780143 CCATTCTCCCAGTGTGCAGGTGG + Intergenic
1180728184 22:17961663-17961685 CATATCTCCAACATGGCAGGAGG + Intronic
1181000500 22:19985842-19985864 CCAGGCTCCCAGAGGGCAGGAGG + Intronic
1181873587 22:25922598-25922620 TAACCCTCCAAGAAGGCAGGTGG - Intronic
1181879945 22:25970545-25970567 TAATTATCCAAGCGGGCGGGCGG - Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182806009 22:33071076-33071098 CAAATCTCCAAAAGGGTAGGAGG - Intergenic
1184981534 22:48099281-48099303 CAGTTCTGGGAGAGGGCAGGTGG - Intergenic
949948301 3:9207774-9207796 CAATTCTCCAAGAGGGCAGGCGG + Intronic
950102622 3:10367274-10367296 GAATTCACCAAGCAGGCAGGGGG - Intronic
950621168 3:14206437-14206459 CAATTCTCAAAGATGTCAAGGGG - Intergenic
953743085 3:45553662-45553684 CAACTCTGCAGGAGGGAAGGGGG + Intergenic
958406078 3:93760638-93760660 CACTTCCCCAAAAGGGCAGCCGG + Intergenic
958859659 3:99431175-99431197 AAATTCTCCAAGATAGCAGTTGG - Intergenic
961035062 3:123636460-123636482 CAAGTCTCCATGACGGCTGGAGG + Intronic
961437450 3:126929218-126929240 CAATTCTAAAAGGGAGCAGGTGG - Intronic
961655826 3:128441244-128441266 CATTTCTCCAGCAGGGCAGGAGG - Intergenic
961999970 3:131285489-131285511 CAATTCTTCAAGAGGGCTGATGG + Intronic
963435471 3:145260035-145260057 CCATTCTCCCAGTGTGCAGGTGG + Intergenic
963958526 3:151282167-151282189 CAAGTCTCCAAGAGAGCAAGTGG - Intronic
966249715 3:177850487-177850509 AAATTGTCCAGGAGGGGAGGAGG - Intergenic
977054593 4:92175474-92175496 CTATTCTCCCAGGGTGCAGGTGG + Intergenic
979856850 4:125644253-125644275 CAATCTTCCAAGATGGTAGGTGG - Intergenic
981654636 4:147099661-147099683 AAATTCTTCAAGAGGGCTAGTGG - Intergenic
982323268 4:154102762-154102784 CAATCCACCAAGAGCTCAGGTGG + Intergenic
989438140 5:41438444-41438466 CCATTCTCCCAGCGTGCAGGTGG - Intronic
989635139 5:43523957-43523979 GCATTCCACAAGAGGGCAGGGGG + Intergenic
991484813 5:67123956-67123978 CAAATCTCCATGTGGGAAGGAGG - Intronic
991922425 5:71670017-71670039 GAATACTCCAAGAGCACAGGAGG - Intergenic
993533253 5:89049417-89049439 TAATTCTCCAGGAGCACAGGTGG + Intergenic
993793769 5:92240317-92240339 CAATTTTCCAAAAGTGCAGGTGG + Intergenic
995322653 5:110854388-110854410 CAATTCTCCAACAGGGCTGAAGG + Intergenic
995893233 5:116981126-116981148 CAAGTGTCCCAGAGGGCACGTGG + Intergenic
996366159 5:122703472-122703494 CACTGCTCCAAGGGGGCAAGAGG + Intergenic
997775079 5:136596942-136596964 CCATTCTCCAAGGGAGAAGGAGG + Intergenic
1000883104 5:166719758-166719780 GAATTCTCCCAGAGAGCAGGAGG + Intergenic
1001159886 5:169303341-169303363 CAATTCTCCAAGAGGGGTGAAGG - Intergenic
1002087548 5:176785403-176785425 CACCTCTCCCCGAGGGCAGGGGG - Intergenic
1003167746 6:3696129-3696151 CCAGTCTCCAAAAGGCCAGGTGG + Intergenic
1003306559 6:4934201-4934223 CAAGTGGCTAAGAGGGCAGGGGG + Intronic
1003889267 6:10549464-10549486 CACTTCTCCATCAGGGCATGAGG + Intronic
1003997150 6:11553418-11553440 CAATTATCCAAGAAGGGAGGTGG - Intronic
1004921377 6:20379324-20379346 GGATGCTCCAGGAGGGCAGGGGG - Intergenic
1005490518 6:26343350-26343372 CAGGTCTCCAATAGGGAAGGAGG + Intergenic
1010042712 6:71405613-71405635 CAATTCTCCAAGTGAGAGGGTGG + Intergenic
1011203240 6:84861710-84861732 CTAATCTGCTAGAGGGCAGGGGG - Intergenic
1011928552 6:92679387-92679409 CACTTATCCAAGAGGACAGATGG + Intergenic
1013191406 6:107806911-107806933 CAACTCTGCCAGCGGGCAGGCGG - Intronic
1015434101 6:133165984-133166006 GAATTCTTCAATAGGGTAGGTGG + Intergenic
1017734497 6:157348655-157348677 GAATTCTCCAATCAGGCAGGTGG - Intergenic
1019075150 6:169380835-169380857 AATTTCTCCACGTGGGCAGGAGG - Intergenic
1019687895 7:2391875-2391897 CATGTCTCCAAGAGGCCTGGCGG - Intergenic
1020014905 7:4825184-4825206 CAGTTCTAGAAGAGGGCAGAGGG + Intronic
1020587649 7:10089363-10089385 CAATTCAACAAGAGGGCTCGAGG + Intergenic
1020624475 7:10560594-10560616 CAACTCTACAGGAAGGCAGGAGG + Intergenic
1020627429 7:10599465-10599487 CCATTCTCCCAGTGTGCAGGTGG - Intergenic
1023285633 7:38616023-38616045 CACTGCTCCCAGAGGACAGGAGG + Intronic
1026350404 7:69510460-69510482 CAAGTCCCCAAGAAGGCAGGAGG - Intergenic
1026431081 7:70347810-70347832 CAAGTCTCCCAGAGGGTAGAAGG - Intronic
1028463929 7:91127564-91127586 CAAATCTCCCAAAGGGCATGTGG - Intronic
1028572474 7:92306053-92306075 CTGGTCTCCAAGAGGGGAGGAGG + Intronic
1028676444 7:93468632-93468654 GAATTCTGCAAGAGTGGAGGTGG - Intronic
1029025401 7:97411964-97411986 CAATATTCCAAGAGGGAAGTGGG + Intergenic
1029581669 7:101440427-101440449 CAATTCTTCATGGGGACAGGAGG + Intronic
1029990673 7:104960074-104960096 CAAATCTCAGACAGGGCAGGAGG - Intergenic
1030737383 7:113065679-113065701 CAATTCTCCAATAGTGCACTTGG - Intergenic
1032435661 7:131898355-131898377 CAGTTGTACAAGAGGGTAGGCGG + Intergenic
1032856947 7:135842759-135842781 GAATTGGCCAAGAGGGAAGGAGG + Intergenic
1035595188 8:852059-852081 CAATTCTCACAGCTGGCAGGAGG - Intergenic
1047812319 8:128424338-128424360 CAATTCTCCAAGAGGAAGAGAGG - Intergenic
1051374185 9:16387648-16387670 ACAAGCTCCAAGAGGGCAGGAGG - Intergenic
1052147301 9:25065821-25065843 CAAATCTTCAAAAGGGCAGCAGG + Intergenic
1053396031 9:37775201-37775223 GACTTCTCCAAGAGGCCATGTGG - Intronic
1053642896 9:40105649-40105671 GATTTCTCCATGAGGGCAGAGGG + Intergenic
1053763257 9:41359841-41359863 GATTTCTCCATGAGGGCAGAGGG - Intergenic
1054541866 9:66271008-66271030 GATTTCTCCATGAGGGCAGAGGG - Intergenic
1056466542 9:86861259-86861281 CAATTCTCCAAGTGAGCACAGGG + Intergenic
1056885813 9:90442687-90442709 CTATTTTCTAACAGGGCAGGAGG - Intergenic
1058138207 9:101330589-101330611 AAATTCTCCAAGGATGCAGGAGG + Intergenic
1060039829 9:120290508-120290530 GAACTCTGGAAGAGGGCAGGGGG + Intergenic
1060410307 9:123395662-123395684 CAAGTCTCCAAGATGCCAGCTGG - Intronic
1061675920 9:132215626-132215648 GAATCCTCCAAGAGGCCAGGGGG + Intronic
1061927779 9:133814542-133814564 CTTTTCTCCAACAGGCCAGGTGG + Intronic
1202790646 9_KI270719v1_random:88634-88656 GATTTCTCCATGAGGGCAGAGGG + Intergenic
1193128235 X:77892381-77892403 CCATTCTCAGAGAGGGAAGGAGG + Intronic
1197038181 X:121903554-121903576 CCATCCTCCTAGTGGGCAGGTGG - Intergenic
1197177294 X:123499775-123499797 CAATACTCCAATAGGGGAGGAGG + Intergenic
1197450798 X:126614325-126614347 TAATTCTCAAAGAGGTCATGTGG - Intergenic