ID: 949949564

View in Genome Browser
Species Human (GRCh38)
Location 3:9217912-9217934
Sequence CAGGAGAGCCAGATGCAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 424}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949949564_949949569 -2 Left 949949564 3:9217912-9217934 CCCCACTGCATCTGGCTCTCCTG 0: 1
1: 0
2: 3
3: 41
4: 424
Right 949949569 3:9217933-9217955 TGCCCTCACCATCCGCAGCAGGG 0: 1
1: 0
2: 1
3: 20
4: 178
949949564_949949576 16 Left 949949564 3:9217912-9217934 CCCCACTGCATCTGGCTCTCCTG 0: 1
1: 0
2: 3
3: 41
4: 424
Right 949949576 3:9217951-9217973 CAGGGGGTACACTACAGCTTCGG 0: 1
1: 0
2: 1
3: 15
4: 100
949949564_949949572 0 Left 949949564 3:9217912-9217934 CCCCACTGCATCTGGCTCTCCTG 0: 1
1: 0
2: 3
3: 41
4: 424
Right 949949572 3:9217935-9217957 CCCTCACCATCCGCAGCAGGGGG 0: 1
1: 0
2: 0
3: 18
4: 239
949949564_949949570 -1 Left 949949564 3:9217912-9217934 CCCCACTGCATCTGGCTCTCCTG 0: 1
1: 0
2: 3
3: 41
4: 424
Right 949949570 3:9217934-9217956 GCCCTCACCATCCGCAGCAGGGG 0: 1
1: 0
2: 2
3: 17
4: 174
949949564_949949568 -3 Left 949949564 3:9217912-9217934 CCCCACTGCATCTGGCTCTCCTG 0: 1
1: 0
2: 3
3: 41
4: 424
Right 949949568 3:9217932-9217954 CTGCCCTCACCATCCGCAGCAGG 0: 1
1: 0
2: 2
3: 26
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949949564 Original CRISPR CAGGAGAGCCAGATGCAGTG GGG (reversed) Intronic
900136929 1:1121679-1121701 CAGGAGTCCCAGATGGGGTGGGG - Intergenic
900234163 1:1578733-1578755 CAGGTGTGCCAGCTGCAGTGGGG - Intergenic
900506952 1:3034362-3034384 CAGGTCAGCCACCTGCAGTGTGG + Intergenic
900648200 1:3718401-3718423 CCGGAGACCCAGAGGGAGTGGGG + Intronic
900803311 1:4751089-4751111 CAGGGGAGCGAGAGGCACTGGGG - Intronic
902041635 1:13496843-13496865 AAGGAGAGCCAGAGGTGGTGGGG + Intronic
902332070 1:15735583-15735605 CATAGGAGCCAGAGGCAGTGGGG + Intergenic
903534400 1:24057109-24057131 TAGGAGACCCGGATGCACTGGGG - Exonic
903763426 1:25715738-25715760 CAGGAGAGCCTGAGGCACTAAGG + Intronic
904621215 1:31776486-31776508 CTGGGGAGTCAGAGGCAGTGGGG - Intergenic
904811999 1:33169440-33169462 CAGGAGAGCTAGAGGCAGGGAGG - Intronic
904966314 1:34377272-34377294 TAGGGGAGTCAGATGCTGTGAGG + Intergenic
905247831 1:36627076-36627098 GAGGAGAGCAAGATGGAGCGAGG - Intergenic
905329403 1:37181704-37181726 CAGGACAGCCAAGGGCAGTGGGG + Intergenic
905524856 1:38628900-38628922 CATGAGGGCCAGATCCAGAGAGG - Intergenic
905969687 1:42132046-42132068 CAGGAAAGCAGGATGCAGAGAGG + Intergenic
906685923 1:47763305-47763327 CAGGAGAGCAAGAGCCAATGTGG - Exonic
906723944 1:48030102-48030124 CAGGAGTGCTAGAGGCACTGGGG - Intergenic
906944662 1:50285483-50285505 CAGCTGAGCCAGATGAAGTGGGG - Intergenic
907725741 1:57018851-57018873 CTGGAGGGCAAGGTGCAGTGAGG - Intronic
909537260 1:76751311-76751333 CAGCACAGCCTGAGGCAGTGGGG - Intergenic
909867183 1:80687541-80687563 CAGGGGAGGGAGCTGCAGTGAGG - Intergenic
910540529 1:88350858-88350880 CTGGTGAGCCAGATGGGGTGGGG + Intergenic
911052031 1:93680002-93680024 CTGGAGAGTCAGATGGAGAGAGG + Intronic
911814759 1:102333144-102333166 CAGGATAGGAAGATGCAGGGTGG - Intergenic
913159543 1:116132770-116132792 CAGAAGAGGCAGAAGCAGGGAGG + Intronic
917211237 1:172633949-172633971 CAGGAAAGACAAATGCAGAGAGG + Intergenic
917218445 1:172702292-172702314 GAGGAGAGTCATATGAAGTGAGG + Intergenic
917657139 1:177137738-177137760 CAGGAGACCCAGGTTCAGTTTGG - Intronic
917901204 1:179545162-179545184 CAAGTGAGCCAGGAGCAGTGAGG - Intronic
918114648 1:181485514-181485536 CAGGGGAGCGGGATGCAGAGAGG - Intronic
919852979 1:201686212-201686234 GAGGAGGGGCAGATGCAGTTGGG - Intronic
919923613 1:202180650-202180672 CAGGAGAGTCTGAGGCATTGCGG + Intergenic
920009599 1:202858374-202858396 GAGGAGATCCAGATGCAGAAGGG + Intergenic
920528947 1:206687767-206687789 CAGGAGAGGAAGATGGAGTGGGG + Intronic
920653603 1:207857416-207857438 TAGGAGATCCAGATGCAGAAGGG + Intergenic
921752871 1:218817877-218817899 CAGGACAGCCTGCTGCAGGGCGG + Intergenic
922162713 1:223090157-223090179 CTGGAGAGCCAGATGAGGGGAGG - Intergenic
923004472 1:230035815-230035837 CAGAAAGGCCAGAAGCAGTGGGG - Intergenic
923428251 1:233893172-233893194 CAGGAGAGCGAGAGAGAGTGAGG + Intergenic
923755311 1:236786043-236786065 CAGGACAACCAGCTGCAGAGGGG + Intergenic
924611740 1:245579345-245579367 AAGGAGAGCCAGGTGCAGTAGGG + Intronic
924757140 1:246951700-246951722 CAGGAAAGCCAGCTTCTGTGTGG + Intronic
1063973106 10:11395321-11395343 TAGGAGGGCCAGAGGCAGTGAGG - Intergenic
1065895464 10:30159381-30159403 CAGGAGAGCAAGGTGGAGGGTGG - Intergenic
1066188760 10:33036737-33036759 CAGGGATGCCAGTTGCAGTGAGG + Intergenic
1066556327 10:36618449-36618471 TAGGAGAGGCAGAGACAGTGGGG + Intergenic
1066818845 10:39456609-39456631 CACGGGAGCCAGAGGCAGGGAGG + Intergenic
1067202695 10:44187016-44187038 CCTGACAGCCAGATGCAATGGGG - Intergenic
1067847878 10:49737676-49737698 CAGCAGAGCCACAGGCAGAGGGG + Intronic
1069515455 10:69073504-69073526 CAGGAAAGAAAGATGAAGTGAGG + Intergenic
1070975786 10:80604487-80604509 CAGGAGGGCCAGAGGCTGGGTGG + Intronic
1070982166 10:80657748-80657770 TAGGAGAGGCAGATGCAGGTTGG - Intergenic
1071570887 10:86696240-86696262 CAGGAGGGCCCTATGCTGTGCGG - Intronic
1072236597 10:93459142-93459164 CCTCAGAGTCAGATGCAGTGAGG - Intronic
1072680458 10:97502328-97502350 CAGGAATGCCAGGTGCACTGTGG - Intronic
1073030860 10:100524531-100524553 CAGGAGAGCAAGGAACAGTGTGG - Intronic
1073631005 10:105149016-105149038 CAGGAGAGAGAGAGGAAGTGAGG - Intronic
1073974797 10:109087759-109087781 CAGGAGCCCAAGGTGCAGTGTGG - Intergenic
1074532335 10:114305942-114305964 GAGGAGATGCAGATGCAGGGGGG + Intronic
1076832978 10:133006238-133006260 CAGGTGAGCCTGGTGTAGTGTGG - Intergenic
1076926597 10:133493438-133493460 CAGCAGAGGCAGATGTAATGAGG + Intergenic
1077220585 11:1413767-1413789 CAGGAGGGGCTGATGGAGTGGGG - Intronic
1078315134 11:10288542-10288564 CAGGACAACCAGCTGCAGAGAGG - Intronic
1078849933 11:15154597-15154619 CAGGAGAGCACAGTGCAGTGGGG + Intronic
1080451676 11:32383300-32383322 AAGGATTGCCTGATGCAGTGGGG - Intergenic
1081666003 11:44917499-44917521 CATGGGAACCAGAGGCAGTGGGG + Intronic
1081672096 11:44948192-44948214 CAGGAGAGGCAGCTGCAGGGCGG - Intronic
1081691826 11:45083520-45083542 GAGGATAGACAGAGGCAGTGGGG + Intergenic
1082944083 11:58739961-58739983 CAGGAGGCCCACATGCAGTGGGG + Intergenic
1083319792 11:61838652-61838674 CAGGAAAGCCAGAGGCAATGGGG - Intronic
1085110555 11:73883980-73884002 CATGAGAACCAGCTGCTGTGGGG + Intronic
1085202164 11:74708376-74708398 CAGGAGGGCCAGATCTACTGCGG - Exonic
1085212064 11:74790613-74790635 AAGGCGAGCCAGGTGCAGAGGGG + Intronic
1087045063 11:93837976-93837998 CAGGAGGGCAAGATGCAGGGGGG + Intronic
1087726086 11:101719000-101719022 CAGGAGTCCCAGGTGCAGAGGGG - Intronic
1089782667 11:120884534-120884556 CAGGAGAGGGAGAGGCTGTGGGG - Intronic
1089880964 11:121773265-121773287 CCGGAGAGCCAAGTGCTGTGCGG - Intergenic
1090453421 11:126826655-126826677 AAGGAGAGCCAGCTTCTGTGTGG - Intronic
1091918628 12:4287039-4287061 CAGCAGAGCAAGAGGCAGGGAGG + Intronic
1092447464 12:8570439-8570461 CAGGAGAGTTACTTGCAGTGAGG + Intergenic
1092523436 12:9295125-9295147 CATGAGTGCCAGTGGCAGTGAGG + Intergenic
1092543860 12:9436774-9436796 CATGAGTGCCAGTGGCAGTGAGG - Intergenic
1092911750 12:13151773-13151795 CAGGTGAGCCCTATTCAGTGTGG + Intergenic
1093753889 12:22831150-22831172 CTGGAGACCCACATGCATTGGGG - Intergenic
1094509085 12:31085277-31085299 CATGAGTGCCAGTGGCAGTGAGG + Intronic
1096186866 12:49587259-49587281 CAGGGGAGCCAGGTGTAGGGAGG - Intronic
1096411857 12:51382783-51382805 CAGGAGAGTTAGTAGCAGTGTGG + Intronic
1096571393 12:52525399-52525421 CAGGAAAGCCAGATGGAATAAGG - Intergenic
1096977338 12:55707158-55707180 CAGGGGAGCCAGAGGCCCTGGGG + Intronic
1097190139 12:57215906-57215928 CAGGAGAGAGAGAGGCAGTGGGG + Intergenic
1098264729 12:68706814-68706836 GAGGAGAGCCAGCTGGAGTCTGG + Intronic
1099703502 12:86119847-86119869 AAGAAAAGCCAGATGCAGTGGGG - Intronic
1099752339 12:86791910-86791932 CAGGAGAGACACAGGCATTGTGG + Intronic
1099982132 12:89616877-89616899 CAGGAGAACCAGAACCAGAGTGG - Exonic
1100847940 12:98679276-98679298 CAGGAGGACCAGCTGCAGAGAGG + Intronic
1102298935 12:111757495-111757517 GAGGTGAGCCAGGGGCAGTGAGG + Intronic
1102900385 12:116632071-116632093 CAGGACACCCAGATGACGTGTGG - Intergenic
1103791748 12:123477017-123477039 CAGGAGAGACTGAAGCAGAGGGG + Intronic
1103915703 12:124374575-124374597 CAGGAGAGCGAGCAGCAGCGAGG - Intronic
1104651403 12:130537092-130537114 CATGAGGGCCAGATGCAGTGTGG + Intronic
1104720850 12:131044399-131044421 CAGGAGAGGCAGAAGCACAGGGG + Intronic
1104908612 12:132228763-132228785 CAGGAAAGCCATCTGCAGAGCGG - Intronic
1104910135 12:132236328-132236350 CAAGGGAGCCACATCCAGTGTGG + Intronic
1105048582 12:133027802-133027824 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1105878487 13:24582158-24582180 GAGCAGAGCCAGGTGAAGTGAGG - Intergenic
1105921365 13:24966935-24966957 GAGCAGAGCCAGGTGAAGTGAGG + Intergenic
1106265674 13:28107547-28107569 CAGGAGAGCCAACTGCAGATGGG - Intergenic
1106275682 13:28203597-28203619 CAGAAAAGCCAGACCCAGTGTGG - Intronic
1106695691 13:32170283-32170305 CAGTACAGCTAAATGCAGTGTGG + Intronic
1107108609 13:36673118-36673140 CAGCAGAACCAGATGGAGTAGGG + Intergenic
1107737871 13:43417123-43417145 CAGGGGAGCCCGAGGCAGGGAGG + Intronic
1108411121 13:50148186-50148208 CAGGGGTGCCAGATGTAGAGTGG - Intronic
1108956545 13:56165884-56165906 CAGGAGAAAGAGATGGAGTGGGG + Intergenic
1109562736 13:64075157-64075179 CAGGCATGCCAGCTGCAGTGGGG + Intergenic
1111800449 13:92974613-92974635 CAGGACAACCAGTTGCAGAGAGG - Intergenic
1112086231 13:96034784-96034806 CAGGAGTGCCAGCTGCAGTGGGG - Intronic
1112239406 13:97666350-97666372 CCTGAGACCCAGAAGCAGTGAGG + Intergenic
1112850731 13:103703239-103703261 CAAGGGAGGCAGAAGCAGTGAGG - Intergenic
1112921674 13:104621352-104621374 CAGGAGAGCCACTTGAACTGGGG - Intergenic
1114281074 14:21192751-21192773 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1115418816 14:33168662-33168684 CAGGAGAGGAAAATGCAGTCGGG - Intronic
1115485027 14:33901937-33901959 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1117794640 14:59379714-59379736 CAGGAGAGTCAGAGGGAGAGAGG + Intergenic
1117954625 14:61112947-61112969 CAACAGAGCCAGCTGCAGAGGGG - Intergenic
1118728087 14:68644576-68644598 AAGGAGAGCAACATTCAGTGTGG - Intronic
1121695321 14:95907866-95907888 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1122821175 14:104345958-104345980 CAGCAGGGGCACATGCAGTGGGG - Intergenic
1202831868 14_GL000009v2_random:43189-43211 CTGGAGGCCCACATGCAGTGGGG - Intergenic
1124069666 15:26379722-26379744 CAGGAGAGTCAGAGTCAGAGAGG - Intergenic
1124247671 15:28084880-28084902 CTGGAGAGCGAGCAGCAGTGAGG + Intronic
1124789279 15:32712139-32712161 CAGGATAGCCAGAGACAGCGGGG + Intergenic
1125418024 15:39473846-39473868 GAGGAGAGTAAGATGTAGTGAGG + Intergenic
1126052379 15:44697806-44697828 AAGGAGACCGAGATGCAGAGAGG - Intronic
1127019811 15:54734062-54734084 AAGGAGAGCAAGATGCTATGAGG + Intergenic
1127685873 15:61343165-61343187 CAGGAGAGCCAGGTTGAATGAGG - Intergenic
1127992748 15:64132928-64132950 CTGGAGAGCCAGCTGCAGGAAGG + Intronic
1129291169 15:74568995-74569017 CAGCAGAGGCAGATGGAGGGTGG - Intronic
1129461365 15:75701614-75701636 AAGGAGGGCCAGAGGGAGTGTGG - Intronic
1129723469 15:77890193-77890215 AAGGAGGGCCAGAGGGAGTGTGG + Intergenic
1133026230 16:2990064-2990086 CTGGAGAGACAGATGAGGTGAGG - Intergenic
1133201632 16:4207539-4207561 CAGCAGAGCCAAAGGCAGAGGGG - Intronic
1134025105 16:10947276-10947298 CAACAGAGCCAAATGCAGAGTGG - Intronic
1135060835 16:19270139-19270161 CAGGGGAGCCAGGTGGACTGAGG + Intergenic
1136064421 16:27749310-27749332 CAGGACAGTCAGAAGCTGTGTGG + Intronic
1136405083 16:30040601-30040623 TAGGAGAGGCAGAAGGAGTGAGG + Intronic
1136542371 16:30935299-30935321 CAAGAGAGCAGGATGCAGTGTGG + Intronic
1136542878 16:30938146-30938168 CAGGAGAGCGAGTGGCAGAGGGG + Intronic
1137334290 16:47533120-47533142 CAGGACAACCAGGTGCAGAGAGG - Intronic
1139373847 16:66484660-66484682 CAGGAGTACCAGATGGAGTGAGG + Intronic
1141283603 16:82650911-82650933 CAGGAGAGACAGGTGAAGTTGGG + Intronic
1141699098 16:85634324-85634346 CAGGAGAGACAGAAGCACAGAGG - Intronic
1141932136 16:87212835-87212857 CAGGGCAGCCAAATGAAGTGAGG + Intronic
1142103878 16:88291766-88291788 CAGGACACCCAGACGCAGGGAGG - Intergenic
1143510237 17:7391448-7391470 CAGCAGAGCCTGTTGCTGTGTGG - Intronic
1143566827 17:7727153-7727175 CAGGACTGGCGGATGCAGTGTGG + Exonic
1144212248 17:13025561-13025583 CTGGAGAGCAAGGTGCAGAGTGG - Intergenic
1144468848 17:15518999-15519021 CAGGAGAGCGAGAGAGAGTGGGG - Intronic
1144789262 17:17848320-17848342 ACGGAGAGGCAGATGGAGTGGGG + Intronic
1145789063 17:27613546-27613568 CTGGAGACCCACATGCACTGGGG - Intronic
1146372610 17:32275010-32275032 GAGGGGAGCAAGATGCAGAGCGG - Intronic
1147126019 17:38369298-38369320 CAAGAGAACCCGATGCAGTGTGG - Intronic
1147139689 17:38454072-38454094 CAGGGCAGCCAGAGGCAGCGCGG - Intronic
1147334159 17:39716671-39716693 CAGGATGGCGAGATGCAGTAGGG + Intronic
1147350036 17:39835200-39835222 AAGGAGAGCCAGCTGAAGTCTGG - Intronic
1147961165 17:44168465-44168487 GAGGAGCCCCAGATGCAGAGGGG + Intergenic
1148214600 17:45827569-45827591 CAGGAGAGACAGAGACAGAGAGG - Intronic
1148630739 17:49106456-49106478 CAGGAGAGCCTGCTCCAGGGAGG + Intergenic
1148681995 17:49479482-49479504 CAGGAGAGCCAGGGGAAGGGCGG + Intergenic
1150210335 17:63438136-63438158 CAGGAGTTCCATATGCGGTGAGG + Intronic
1150343619 17:64387781-64387803 GAGGTGAGGCAGCTGCAGTGAGG + Intronic
1150529182 17:65959023-65959045 CAGGACAACCAGCTGCAGAGAGG + Intronic
1150952838 17:69822003-69822025 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1151336981 17:73445848-73445870 CAGGAGGCCAAGAGGCAGTGGGG + Intronic
1151395262 17:73819139-73819161 CAGGACAACCAGTTGCAGAGAGG - Intergenic
1151882310 17:76903101-76903123 CAGGGGGTTCAGATGCAGTGAGG - Intronic
1151895179 17:76975168-76975190 CAGGACAGCCGGCTGCAGAGAGG + Intergenic
1152020569 17:77778341-77778363 CATCAGGGCCAGAGGCAGTGTGG - Intergenic
1152530421 17:80915317-80915339 CAGGAAAACCAGCTGCAGAGAGG + Intronic
1152713168 17:81885041-81885063 CAGGACAGCCAGAGGCAGAGGGG + Intergenic
1152764373 17:82128050-82128072 CAGGAGAGGCAGCTGCAGACAGG + Intronic
1154493723 18:14940684-14940706 CAGGACAGCCTGATGCCGTCAGG - Intergenic
1155164612 18:23222208-23222230 GAGGAGAGCCTGATGCATTAAGG - Intronic
1155574689 18:27231802-27231824 CAGGGGAGGCAGATGGGGTGGGG + Intergenic
1156005422 18:32435208-32435230 CAGGAGAGCTGAATGCAATGTGG + Intronic
1157063530 18:44321023-44321045 GAGGAGAGCCAGCTGGAGTCTGG - Intergenic
1157778692 18:50418347-50418369 CAGGGGAGCCCGAGGCAGGGAGG + Intergenic
1161089682 19:2353609-2353631 CCGGAGAGCAGGATGCCGTGGGG - Exonic
1161719523 19:5895276-5895298 CAGGAGAGCCTGGAGAAGTGGGG - Intronic
1163368410 19:16888914-16888936 CAGGCCAGCAAGATGCAGGGGGG - Exonic
1164453647 19:28388641-28388663 CAGGAGTGGGAGATACAGTGTGG + Intergenic
1164853913 19:31505805-31505827 CAGGAGAGCAAGCAGGAGTGGGG + Intergenic
1165020750 19:32922183-32922205 CAGGATAGGCAGGCGCAGTGTGG + Intronic
1166168266 19:41007920-41007942 CAGAAGAACCAGAAGCAGTCTGG - Intronic
1167066093 19:47187186-47187208 CAGGAGAGCCAGAATCAGAGTGG + Intronic
1168139667 19:54376789-54376811 CAGGGAAGCCACCTGCAGTGTGG + Intergenic
1168158214 19:54490450-54490472 CAGGGAAGCCACCTGCAGTGTGG - Intergenic
925779862 2:7372295-7372317 CAGGAGAAGAAGGTGCAGTGGGG - Intergenic
926103706 2:10137273-10137295 CAAGAGGGGCACATGCAGTGAGG - Intergenic
926156708 2:10459032-10459054 CAGGAAGGCCAGAAGCAGTGCGG - Intergenic
927240624 2:20917035-20917057 CAAGAGAGGCAGAAGCCGTGTGG + Intergenic
927682528 2:25149494-25149516 GAGGACAGCGAGATGCAGCGGGG - Intronic
927689467 2:25197581-25197603 CAGGCAGGCCAGGTGCAGTGGGG + Intergenic
927743058 2:25589972-25589994 CAGGCATGCCAGCTGCAGTGGGG + Intronic
928224543 2:29436941-29436963 CAGGAGTGACAGAGGTAGTGAGG + Intronic
928359264 2:30649596-30649618 CTGGAGAGCCAGCTGCCTTGAGG + Intergenic
928820426 2:35355286-35355308 CAGGTGTGCCGGCTGCAGTGGGG + Intergenic
929002263 2:37359102-37359124 CAGGAGACAGAGATGCAGTTCGG - Intronic
929551380 2:42895308-42895330 CAGAAGGGCCAGGGGCAGTGTGG - Intergenic
930858669 2:56045930-56045952 CAGGGGAACCAGGTGAAGTGTGG + Intergenic
931005708 2:57848946-57848968 CAGGCATGCCAGCTGCAGTGGGG + Intergenic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
932703983 2:74009444-74009466 CAGCAGGGCCTGATGCAGTAGGG - Intronic
933383759 2:81583871-81583893 CGGGAAGGCCAGATGCAGAGAGG + Intergenic
933395119 2:81721548-81721570 CAGAATAGACAGAAGCAGTGAGG + Intergenic
934519062 2:95007838-95007860 GAGGAAAGCCAGAAGCACTGTGG + Intergenic
935109733 2:100081506-100081528 CAGGAATGCCGGATGCAGGGTGG - Intronic
935404609 2:102696062-102696084 CAGCAGAGCTAGGAGCAGTGGGG + Intronic
936057380 2:109271129-109271151 GCAGAGAGCCAGAAGCAGTGAGG + Intronic
936125241 2:109783703-109783725 CAGGAAGGCCAGATGCAGGGTGG + Intergenic
936219452 2:110587765-110587787 CAGGAAGGCCAGATGCAGGGTGG - Intergenic
936484966 2:112917837-112917859 CAGGAAAGCGAGAGGCATTGAGG - Intronic
936518228 2:113195943-113195965 CCGGAGGGCCAGAGGTAGTGGGG + Intronic
937285104 2:120745779-120745801 CAGGTGAACCAGCTGCAGGGTGG - Intronic
938049722 2:128157753-128157775 AAGTAGATCCAGATGCACTGAGG + Intronic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938757421 2:134393596-134393618 CAGGACAGCCAGATTCAGGCAGG - Intronic
938760210 2:134418458-134418480 CAGGAGGGCAGGATGCAGAGGGG + Intronic
939109632 2:137991993-137992015 CATGAGAGCCACATGGAGTGGGG + Intronic
939620371 2:144411785-144411807 CAGGAGAGCGAGGTGAAGAGTGG + Intronic
940396253 2:153195987-153196009 CAGGATAGCCAGCTGCAGAGAGG - Intergenic
942228316 2:173836129-173836151 TAGAAGAGCCAGAGACAGTGAGG + Intergenic
942329934 2:174812289-174812311 GAGGTGAGCCATTTGCAGTGCGG - Exonic
943820398 2:192314641-192314663 CAGGACAACCAGCTGCAGAGAGG - Intergenic
944505082 2:200402668-200402690 CAGCAGTGACAGATGCATTGGGG - Intronic
944763419 2:202840569-202840591 GAGGAGAGCCAGTTGGAGTCTGG - Intronic
944772209 2:202925832-202925854 AAGGAGAGCCAGGTGGAGTCTGG + Intronic
945333995 2:208570266-208570288 CAGGAGGGACAGATACTGTGGGG + Intronic
945859645 2:215106026-215106048 CTGGAGAGCAAGGTGCAGTCTGG + Intronic
945859833 2:215108017-215108039 CTGGAGAGCAAGGTGCAGTCTGG - Intronic
946523603 2:220493755-220493777 CAGAAGACCCAGATGCTTTGAGG + Intergenic
947111261 2:226721687-226721709 GATGAGTGCCAGAGGCAGTGAGG - Intergenic
947316708 2:228866622-228866644 CAGGACAACCAGCTGCAGAGAGG + Intronic
947462686 2:230317232-230317254 CAGGCCAGCCAGACGCTGTGTGG - Intergenic
947471876 2:230408575-230408597 CAGGCCAGCCAGATGCTGTTTGG - Intergenic
947569604 2:231221948-231221970 CTGGAGAGGCAGAGACAGTGGGG + Intronic
948031207 2:234819117-234819139 CAGTAGAGCCACATGCTGTACGG + Intergenic
948558737 2:238836174-238836196 CAGGAGCCCCAGCTGCAGTCAGG + Intergenic
948562939 2:238866077-238866099 CAGTAACACCAGATGCAGTGTGG - Intronic
948575364 2:238946468-238946490 CAGGATAACCAGCTGCAGAGAGG - Intergenic
949018085 2:241724852-241724874 CAGGAGAGGCACACGCAGTGGGG - Intronic
1169189254 20:3646963-3646985 CAGGTGAGTCAGATGCTTTGAGG - Exonic
1170032474 20:11957458-11957480 CCGAAGAGCCAGATGCCGTTGGG + Intergenic
1170987547 20:21272359-21272381 CATGAAAGCCAAATGCAATGAGG - Intergenic
1172998206 20:39086374-39086396 AAAGAGGGCCGGATGCAGTGTGG - Intergenic
1173316694 20:41951108-41951130 CAGGAGACCCTGATTCAGTCTGG + Intergenic
1173554715 20:43957855-43957877 CAGGAGAGACAGAGCAAGTGGGG + Intronic
1173978592 20:47205967-47205989 AAGAAGAGGGAGATGCAGTGAGG - Intergenic
1174171365 20:48620013-48620035 CAGCAGGGCCAGCTGCAGGGTGG + Intergenic
1174832391 20:53824895-53824917 CAGGGGAGACTGAGGCAGTGAGG - Intergenic
1175016858 20:55800775-55800797 CAGCAGAGCTAAATGCAGTATGG + Intergenic
1175236564 20:57516985-57517007 CTGGGGAGGCAGATGGAGTGTGG - Intronic
1177628660 21:23699400-23699422 CAGGAGAGTGAAGTGCAGTGGGG - Intergenic
1178082324 21:29077899-29077921 CAGGAGAGCTAAAAGCCGTGAGG + Intronic
1179285351 21:39973200-39973222 CAGGGGAGACAGATGCAGGGCGG - Intergenic
1179816873 21:43911978-43912000 CAGCAGAGCAAGATGCGCTGGGG - Intronic
1180131755 21:45831115-45831137 GAGCAGAGCCAGCTGCAGGGAGG - Intronic
1180361133 22:11897299-11897321 CCGGAGGCCCACATGCAGTGGGG - Intergenic
1180607306 22:17068428-17068450 CAGAAAAGCCAGTTTCAGTGTGG - Intergenic
1180700007 22:17776099-17776121 CAGGAGAGGCAGAGACTGTGGGG - Intergenic
1181895957 22:26107633-26107655 AAGGAGAGAGAGATGCAGAGGGG - Intergenic
1182398428 22:30054881-30054903 CTGGACAAACAGATGCAGTGTGG + Intergenic
1182578024 22:31286729-31286751 CAGGACAGCCAAATGCTGTTGGG + Intronic
1183966928 22:41447601-41447623 AAGGAGCGCCAGAGGCGGTGAGG - Intergenic
1184599422 22:45533737-45533759 TAGGAGAGACCGAGGCAGTGCGG - Intronic
1184755383 22:46512864-46512886 GAGGACAGCCAGGTGCTGTGGGG - Intronic
1185171711 22:49298161-49298183 GAAGAGAGGCAGATGCGGTGAGG + Intergenic
1185174904 22:49321023-49321045 CAGGAGGGTCAGAGGCAGCGTGG - Intergenic
1185174919 22:49321079-49321101 CAGGAGGGACAGAGGCAGCGTGG - Intergenic
1185174934 22:49321135-49321157 CAGGAGGGACAGAGGCAGCGTGG - Intergenic
1185174949 22:49321191-49321213 CAGGAGGGACAGAGGCAGCGTGG - Intergenic
949949564 3:9217912-9217934 CAGGAGAGCCAGATGCAGTGGGG - Intronic
950207626 3:11092694-11092716 CAGTACAGCCAGCTGCAGAGAGG + Intergenic
952961027 3:38589167-38589189 CAGGAGAGCAACAGGCAATGGGG - Intronic
953095224 3:39768210-39768232 GAGGTGAGCCAGAAGCACTGGGG + Intergenic
953108839 3:39912251-39912273 CTGGAGAGCCAGATCCAGCTGGG - Intronic
953563251 3:44011327-44011349 CAGGAGGGCCTGATGCATAGCGG - Intergenic
953828161 3:46272149-46272171 CAGGCCAGCCAGCTGCACTGGGG + Intergenic
953929727 3:46999905-46999927 ACGGACAGCCAGATGTAGTGCGG + Exonic
954797953 3:53171155-53171177 CCAGAGAGCCAGATCCTGTGAGG - Intronic
955111771 3:55957706-55957728 CAGGTGTTCCAGCTGCAGTGGGG + Intronic
956066928 3:65406537-65406559 CGGGAGACCCAAATGCAGAGGGG - Intronic
956674000 3:71717660-71717682 CAGGAAAGCCATGTGCAGTGGGG + Intronic
957678783 3:83404511-83404533 CAGGAGTACCAGCTGCAGAGAGG + Intergenic
957845152 3:85722136-85722158 CAGGATAACCAGCTGCAGAGAGG - Intronic
957845162 3:85722204-85722226 CAGGATAACCAGCTGCAGAGAGG - Intronic
958636264 3:96750642-96750664 CAGGAGGACCAGCTGCAGAGAGG + Intergenic
960977611 3:123190734-123190756 CAGGTTCGCCTGATGCAGTGTGG - Intronic
961306500 3:125961420-125961442 CAGGAGGGCCTGAGGGAGTGGGG - Intergenic
961442746 3:126962515-126962537 CTGGCCAGCCAGAGGCAGTGGGG - Intergenic
961588274 3:127953854-127953876 CAGAAGAGCCAATTACAGTGTGG - Intronic
962236182 3:133709589-133709611 CAGAAGTGCCAACTGCAGTGTGG - Intergenic
964075062 3:152683777-152683799 CAGGCATGCCAGCTGCAGTGGGG + Intergenic
964504159 3:157380241-157380263 CAGATGAGCCAGATCAAGTGAGG - Intronic
964802268 3:160568986-160569008 TAGGAGAGCCAGCTGGAGTCTGG + Intergenic
965205104 3:165712513-165712535 CAGGAGTGCCAGCTGCAGCAGGG + Intergenic
1202737737 3_GL000221v1_random:22824-22846 CTGGAGGCCCACATGCAGTGGGG - Intergenic
968538649 4:1151022-1151044 CAGGGCAACCAGATGCAGAGAGG - Intergenic
968552364 4:1230148-1230170 CTGGTGCACCAGATGCAGTGTGG + Intronic
968554814 4:1241607-1241629 CGGGTGTGGCAGATGCAGTGAGG - Intronic
968974663 4:3815475-3815497 CAGTACAGCCTGATGGAGTGGGG - Intergenic
969392755 4:6902028-6902050 GAGAACAGCCAGCTGCAGTGGGG + Intergenic
969848717 4:9940102-9940124 CAAGAGAGCCAGAGGGGGTGCGG + Intronic
971420214 4:26467674-26467696 CAGGAGAGTCAGAGTCAGAGAGG + Intergenic
972298635 4:37764447-37764469 TAGGAGTGCCAGCTGCAGAGGGG + Intergenic
973384336 4:49495095-49495117 CCGGAGGCCCACATGCAGTGGGG + Intergenic
973571580 4:52245160-52245182 CAGGAGACCCACACTCAGTGAGG - Intergenic
973631767 4:52826357-52826379 GAGGAGAGGCCGAGGCAGTGTGG - Intergenic
974972969 4:68853827-68853849 CAGGACAACCAGCTGCAGAGAGG - Intergenic
976683639 4:87786234-87786256 CAGGAGAGCCAACTGCAGAGAGG + Intergenic
976734495 4:88296401-88296423 CAGGACAACCAGCTGCAGAGAGG - Intergenic
978498497 4:109384772-109384794 TGGGATAGCCAGATGCAGAGAGG + Intergenic
978545972 4:109873095-109873117 CAGGTCAGCCAGGTGCAGAGTGG - Intergenic
980180260 4:129392913-129392935 CAGGACAACCAGCTGCAGAGAGG + Intergenic
982521137 4:156417879-156417901 CAGGAGACCCACGTGCATTGGGG + Intergenic
983000456 4:162408474-162408496 CAGGCATGCCAGCTGCAGTGAGG + Intergenic
984581253 4:181512210-181512232 CATGAGAGACAGAAGTAGTGAGG - Intergenic
985068962 4:186149946-186149968 CCGGAGAGCCGGCTGCAGGGTGG - Intronic
1202768186 4_GL000008v2_random:170418-170440 CCGGAGGCCCACATGCAGTGGGG + Intergenic
986021902 5:3812388-3812410 AAGCAGAGCCAGATGGTGTGGGG + Intergenic
986106299 5:4662574-4662596 CAGTGGAGTCAGCTGCAGTGTGG + Intergenic
986191099 5:5496522-5496544 CAGGAGAGCCATCTGCATTGTGG + Intergenic
986215059 5:5712522-5712544 CAGGACAGTCAGCTGCAGAGAGG - Intergenic
986349760 5:6866659-6866681 CTGGAGAGCAAGAAGCAATGGGG + Intergenic
987951815 5:24686476-24686498 AAGGGGAGCAAGATGCAGAGTGG + Intergenic
987951825 5:24686548-24686570 CAGGCATGCCAGCTGCAGTGGGG + Intergenic
988093185 5:26569010-26569032 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
988434107 5:31153537-31153559 CTGGAGAGCCAGGTTCAGGGAGG - Intergenic
989699542 5:44245475-44245497 TTGGAGAGCTAGCTGCAGTGGGG - Intergenic
990308212 5:54514549-54514571 CAGGACAGCCAACTGCAGAGAGG - Intergenic
991359277 5:65803019-65803041 CAGGACAACCAGCTGCAGAGAGG - Intronic
992508670 5:77412336-77412358 CATGAGAGCCAGAACCCGTGAGG - Intronic
993962456 5:94316613-94316635 CAGGACAGCCAGATGGGGTGAGG - Intronic
994453922 5:99981269-99981291 CTGGAGGGCCACATGCACTGAGG + Intergenic
994765953 5:103918930-103918952 CAGGACAGTCAGTTGGAGTGAGG + Intergenic
997281568 5:132651394-132651416 AAGGAAAGCCAGAAGGAGTGAGG - Intergenic
998172601 5:139881326-139881348 CAGGAGAGGCAGAGGCAGCTGGG - Intronic
999003950 5:147955429-147955451 CAGGAGAGTCAGAGTCAGAGAGG - Intergenic
999057745 5:148598151-148598173 CAGGAGAGTCAGAAGAAATGAGG + Intronic
1001088204 5:168716995-168717017 CAGGAAAGGCATATGCACTGGGG - Intronic
1001091177 5:168742106-168742128 CAGGAAAGGCATATGCACTGGGG + Intronic
1002001849 5:176200481-176200503 TAGGAGAGCCAGCAGCAGAGAGG + Intergenic
1002252489 5:177938497-177938519 TAGGAGAGCCAGCAGCAGAGAGG - Intergenic
1002301432 5:178259544-178259566 CAGGGCAGCCACCTGCAGTGAGG + Intronic
1004242237 6:13934929-13934951 CAGGAGAGTCAGATGAAATGCGG + Intronic
1004815049 6:19303712-19303734 CATGAGAGGCAGATCCTGTGAGG - Intergenic
1005292338 6:24392115-24392137 CAAGAGAGCCAAAAGCATTGTGG + Intergenic
1005781962 6:29201731-29201753 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1005840790 6:29743513-29743535 CAGGAGAGAGGGATGCAGAGAGG + Intergenic
1006096225 6:31658502-31658524 CATGGGAGCCAGAGGGAGTGGGG - Exonic
1006856163 6:37134669-37134691 CAGGAGGGCCTGGTGCAATGTGG + Intergenic
1007076951 6:39074231-39074253 GAGGAGAGCCAAGTACAGTGGGG + Intronic
1007243365 6:40442781-40442803 CAGCAGGGCCCCATGCAGTGAGG - Intronic
1007254683 6:40520533-40520555 CAGCATAGCCAGAAGCATTGTGG + Intronic
1007367167 6:41403012-41403034 CTGGAGAGGCAGAGGCAATGGGG - Intergenic
1007402870 6:41614378-41614400 CAGGAGAGGCAGGGGCAGTCAGG + Intergenic
1007807925 6:44464430-44464452 CAGGAGCGCCTGATGCGGTTGGG + Intergenic
1009642980 6:66362039-66362061 AAGGCGAGCCAGGTGCAGAGTGG + Intergenic
1009826217 6:68868274-68868296 CAGGAGAGACAGAGCAAGTGGGG - Intronic
1014632314 6:123803080-123803102 CAGGGGAGCCAGGTGCTGGGCGG + Intergenic
1015549095 6:134393437-134393459 CAGGAGGGCCAGCTGCAAAGGGG + Intergenic
1016506070 6:144780883-144780905 CAAGAGATCCACATGAAGTGAGG - Intronic
1016527381 6:145017458-145017480 CAGGAGAGGCTGAAGCAGTGTGG - Intergenic
1016818981 6:148330007-148330029 CATGAGTGCCAGATGCATGGTGG - Intronic
1017316751 6:153039841-153039863 CAGGACAGCGTGAAGCAGTGAGG - Intronic
1017587813 6:155946804-155946826 CAGAGGTGCCAGCTGCAGTGGGG + Intergenic
1018530011 6:164752446-164752468 TTGGAGAGCCAGATGCAACGAGG + Intergenic
1020260776 7:6529676-6529698 CAGCAGAGCCAGGAGCAGTGGGG + Intronic
1020305329 7:6829604-6829626 TTGGAGAGGCAGATGCATTGAGG - Intergenic
1021431003 7:20559422-20559444 AAGGTGAGCCACATGCAGAGTGG + Intergenic
1021625346 7:22587600-22587622 CAGGAAGCCCAGATGCTGTGTGG - Intronic
1021965561 7:25915009-25915031 AAGGAGACCCAGAAGGAGTGGGG - Intergenic
1022195177 7:28058335-28058357 AAGAAGAGCTAGATGCAGAGAGG + Intronic
1022531281 7:31068505-31068527 CAGCAGAGGCAGTTGCAATGAGG + Intronic
1022804287 7:33806436-33806458 GAGGAAACCAAGATGCAGTGTGG - Intergenic
1023529418 7:41137052-41137074 CAGGGACGCCAGCTGCAGTGGGG - Intergenic
1023842630 7:44105666-44105688 AAGGAGAGCCAGAGGCAGGAGGG - Intronic
1023955899 7:44886148-44886170 AAGGAAAGCCATTTGCAGTGCGG + Intergenic
1024293830 7:47827266-47827288 CAGGAGGACCAGCGGCAGTGGGG + Intronic
1026070291 7:67112796-67112818 CAGGGGAGCCAGATGCAGAACGG + Intronic
1026706619 7:72699473-72699495 CAGGGGAGCCAGATGCAGAACGG - Intronic
1027164600 7:75825461-75825483 CAGGAGAGCCAGGTGAACAGTGG + Intergenic
1027266434 7:76497528-76497550 CAGAAGAGTCAGAGGCAGCGAGG - Intronic
1027741641 7:82015109-82015131 CAGGTGAGACAGGTGAAGTGAGG - Intronic
1029081255 7:97975659-97975681 TTGGAGAGGCAGATGCATTGAGG - Intergenic
1029636507 7:101788087-101788109 GAGGAGGGTCAGGTGCAGTGGGG - Intergenic
1029661194 7:101963235-101963257 CAGGCGAGCCAAATACAGGGAGG - Intronic
1029834697 7:103297083-103297105 TGGGAGAGACAGATGCCGTGAGG - Intergenic
1031008814 7:116502237-116502259 CAGAAGAGCCAGCTGGAGAGAGG - Intronic
1031248651 7:119350739-119350761 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1032366916 7:131308105-131308127 GAGGAGAGAGAGATCCAGTGAGG - Intronic
1035367004 7:158355560-158355582 CAGGAGAGGCAGGAGCAGTCAGG + Intronic
1036091159 8:5667238-5667260 CAGGAGTGACAGATGAACTGTGG - Intergenic
1036595826 8:10211176-10211198 CAGGAAAGACAGATAGAGTGTGG + Intronic
1040576374 8:48654935-48654957 CAGGAGAGTCAGAGTCGGTGTGG - Intergenic
1040874090 8:52132100-52132122 GAGGACAGCCAGAAGCTGTGCGG + Exonic
1041078607 8:54191898-54191920 CAGGAGAGCCAACTGCAGATGGG + Intergenic
1042198468 8:66255228-66255250 TAGGAAAGCCAGATTTAGTGTGG - Intergenic
1042396090 8:68293040-68293062 CAGTAGAACCAGATGCAAAGAGG + Intergenic
1042503004 8:69529892-69529914 CAGGTCAGCCATATTCAGTGTGG + Intronic
1042585770 8:70336591-70336613 CAGGAGAGACAGAGACAGAGAGG + Intronic
1042799056 8:72697967-72697989 CAGGTGATCCTGATGTAGTGAGG + Intronic
1043180473 8:77082177-77082199 CAGGTGTGCCAGGTGCAGTGGGG + Intergenic
1043738393 8:83775663-83775685 CAGGAGTGACAGTAGCAGTGTGG - Intergenic
1044008660 8:86965953-86965975 CAGGAGGACCAGCTGCAGAGAGG - Intronic
1044199030 8:89412855-89412877 GAGGAGAGCCAGCTGGAGTCTGG - Intergenic
1046367048 8:113248037-113248059 CTTGAGAGTCAGATGCAGTGTGG - Intronic
1047127105 8:121974780-121974802 CAGAAGAGCCAGATGCCCTGAGG - Intergenic
1047243958 8:123121627-123121649 CAGGAGCGACAGATGAGGTGAGG - Intronic
1047738649 8:127789141-127789163 CAGGACAGCTAGATACTGTGTGG + Intergenic
1047926790 8:129689949-129689971 CAGGAAACCCCAATGCAGTGAGG + Intergenic
1048019204 8:130522919-130522941 CAAGAGGGACAGTTGCAGTGGGG + Intergenic
1048396557 8:134019615-134019637 CAGGAGAGACAGATGCCATAGGG - Intergenic
1049001149 8:139826326-139826348 CAGGAGAGTGAGAGACAGTGTGG + Intronic
1049700647 8:144010133-144010155 CAGGTGGGCCAGATCCAGTTGGG - Intronic
1050785296 9:9393316-9393338 CAGGAGAGGCACTTGCAATGGGG + Intronic
1052596992 9:30574421-30574443 CGAGAGCGCCAGCTGCAGTGGGG + Intergenic
1052832222 9:33225290-33225312 CTGGAGAGCTGGATGCAATGAGG + Intronic
1053166231 9:35846087-35846109 GAGGAGAGGAAGCTGCAGTGTGG + Intronic
1053243842 9:36518479-36518501 CAGGAGTTCCAGACCCAGTGTGG - Intergenic
1053826563 9:42030700-42030722 CAGGAGAGACAGCTGCAGGTGGG - Intronic
1054603997 9:67156697-67156719 CAGGAGAGACAGCTGCAGGTGGG + Intergenic
1057510794 9:95678289-95678311 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1057886247 9:98831998-98832020 CAGGTCAGCCAGATTCAATGAGG - Intronic
1058368448 9:104235970-104235992 CACGGGAGCCCGAGGCAGTGAGG + Intergenic
1058528864 9:105886365-105886387 CAGGAGACACAGAGGCAGTTGGG - Intergenic
1058583556 9:106483757-106483779 CTGGAGAATCAGATGCAGGGAGG - Intergenic
1058705373 9:107633658-107633680 CAGGAGAGAGAGAGACAGTGAGG + Intergenic
1058861830 9:109123989-109124011 CTGGAAAGCAAGAGGCAGTGTGG - Intergenic
1061267387 9:129514644-129514666 CAGGAAGGCCAGCTGCAGAGAGG + Intergenic
1062158437 9:135066891-135066913 GAGGGGAGACACATGCAGTGGGG + Intergenic
1062287262 9:135778689-135778711 CTGGACAGCCTGCTGCAGTGTGG + Exonic
1062446745 9:136598420-136598442 CAGGAGCGCCTGGGGCAGTGTGG + Intergenic
1062446786 9:136598567-136598589 CAGGAGCGCCTGGGGCAGTGTGG + Intergenic
1062446820 9:136598690-136598712 CAGGAGCGCCTGGGGCAGTGTGG + Intergenic
1062446848 9:136598788-136598810 CAGGAGCGCCCGGGGCAGTGTGG + Intergenic
1062446856 9:136598812-136598834 CAGGAGCGCCCGGGGCAGTGTGG + Intergenic
1062518010 9:136945713-136945735 CTGGGGAGCCACATGCAGTGTGG - Exonic
1203692589 Un_GL000214v1:59325-59347 CCGGAGGCCCACATGCAGTGGGG + Intergenic
1203706465 Un_KI270742v1:53268-53290 CTGGAGGCCCACATGCAGTGGGG - Intergenic
1203556774 Un_KI270744v1:6217-6239 CCGGAGGCCCACATGCAGTGGGG + Intergenic
1203643706 Un_KI270751v1:44866-44888 CCGGAGGCCCACATGCAGTGGGG - Intergenic
1187527624 X:20068428-20068450 CAGAAGAAGCAGATGCTGTGTGG - Intronic
1188859849 X:35243966-35243988 CAGGACAACCAGCTGCAGAGAGG - Intergenic
1189104829 X:38224557-38224579 CAGATGAGCCTGATGCAGTGGGG - Intronic
1190745729 X:53320915-53320937 GAGGAGAGCCAGCTGCACCGCGG - Exonic
1191141212 X:57118552-57118574 CAGGTGAGGCAGATGCCATGGGG - Intronic
1191142816 X:57134276-57134298 CAGGTGAGGCAGATGCCATGGGG - Intergenic
1192265307 X:69533651-69533673 CAGGATGACCAGCTGCAGTGAGG - Intergenic
1192466613 X:71361467-71361489 CAGGAGTTCAAGATTCAGTGTGG - Intergenic
1192553062 X:72069288-72069310 CTGCAGAGGCAGATGAAGTGGGG + Intergenic
1193565677 X:83073662-83073684 CAGAAGAACAATATGCAGTGGGG - Intergenic
1194380343 X:93182174-93182196 CATGACAGCCAGTTGCAGTGAGG + Intergenic
1196196566 X:112843115-112843137 CAGGAGAGCTAGATGTGGGGGGG + Intergenic
1198320298 X:135513349-135513371 CAGGAGAGCAGGATGCAGAGGGG - Intergenic
1199499038 X:148488993-148489015 CAGGACAACTAAATGCAGTGTGG + Intergenic
1199717273 X:150515637-150515659 CAGGAGTGCCAGGGGCAGTGAGG - Intergenic
1200065460 X:153502392-153502414 CAGGAGAGCAAGATGGAGTGGGG - Intronic
1200077939 X:153561005-153561027 CAGGAAAGCCAGGTGGGGTGGGG - Intronic