ID: 949952472

View in Genome Browser
Species Human (GRCh38)
Location 3:9240631-9240653
Sequence TGTCTCTCCATGACGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949952472 Original CRISPR TGTCTCTCCATGACGGTGGA AGG (reversed) Intronic
900861738 1:5238616-5238638 GGTTTCTCCATGAAGTTGGAAGG + Intergenic
901037637 1:6345888-6345910 ACGCTCTCCATGACGGTTGACGG + Intronic
901928191 1:12580264-12580286 TTTCTCTCCAGGACTGTGGCGGG - Intronic
902235695 1:15056000-15056022 TTTCTCCCCATGGCGGTGGGTGG + Intronic
903815291 1:26060324-26060346 TGTATCTCCATGCTGGTGGCGGG - Exonic
905459885 1:38115686-38115708 TTCCTCTCCAGGAAGGTGGAGGG + Intergenic
906182689 1:43835514-43835536 GCTCTCTCCATGGCAGTGGAAGG - Intronic
906513171 1:46423186-46423208 TGACTCTCCCTGCTGGTGGAGGG - Intergenic
907673982 1:56501735-56501757 TATCTCTTCATCACGGTGAATGG - Intronic
920569761 1:207007840-207007862 GGTCTCTCAATCATGGTGGAAGG + Intronic
1063187855 10:3666560-3666582 TGTCTCCCCAGGACGGCAGATGG + Intergenic
1069635526 10:69922694-69922716 TTTCTCTCCCTGGGGGTGGAAGG - Exonic
1070790136 10:79184223-79184245 TTTCTGTCCCTGATGGTGGAAGG - Intronic
1071397695 10:85239359-85239381 TTTCTCTCCATGATGGCAGAGGG + Intergenic
1071597292 10:86937614-86937636 TGTCTCTCAAGGAAGTTGGAAGG - Intronic
1072788419 10:98300578-98300600 GCTCTCTCCATGAGTGTGGAAGG - Intergenic
1073689446 10:105791535-105791557 TCTATCTCCATGAGGTTGGATGG - Intergenic
1074898306 10:117795697-117795719 TGCCTTTCCATTACTGTGGATGG - Intergenic
1076363365 10:129905702-129905724 AGCCTCTCCAGGACGGTGGCGGG + Intronic
1077325729 11:1963197-1963219 TGTCTCTCAGTGAGGGAGGATGG - Intronic
1084447284 11:69210924-69210946 TGCCTCTCCCCGACAGTGGATGG - Intergenic
1086388363 11:86334054-86334076 TGTTTATCCATGATGGTTGATGG + Intronic
1087254767 11:95941100-95941122 TGTCTCCCCATGAGTGTGGCAGG - Intergenic
1089678970 11:120109015-120109037 TCTCTGTCCAGGACGGGGGAAGG - Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1089864984 11:121623947-121623969 GGCCTCTCCATCATGGTGGAAGG + Intronic
1202808709 11_KI270721v1_random:18376-18398 TGTCTCTCAGTGAGGGAGGATGG - Intergenic
1092022016 12:5210734-5210756 TGTCTCTCCATGGCAATGGCTGG - Intergenic
1094474256 12:30829030-30829052 CATTTCTCCATGTCGGTGGATGG + Intergenic
1106027304 13:25967430-25967452 TTTCTTTCCTTGAAGGTGGAGGG + Intronic
1107576707 13:41731866-41731888 GGCCTCACCATCACGGTGGAAGG - Intronic
1113818613 13:113194318-113194340 TGTCTCTGCCTGATGGTGAAAGG + Intronic
1113890436 13:113732537-113732559 TTTCACTCCACCACGGTGGACGG - Intronic
1114274217 14:21127436-21127458 AGTCTCACAATCACGGTGGAAGG + Intergenic
1115649805 14:35394890-35394912 TGCCTCTCAATGACGGAGGTGGG + Intergenic
1117571175 14:57050627-57050649 TGCCTCACCATCACGGTAGAAGG + Intergenic
1120716992 14:87850860-87850882 TGCCTCACAATGATGGTGGAAGG - Intronic
1121782220 14:96629244-96629266 TGTCTTTCCATCTCGGTGAATGG - Intergenic
1122172373 14:99887543-99887565 TGTGGCTCCATGGCGGTGGCGGG - Intronic
1126505750 15:49402398-49402420 TGTCTATCCATGAGCATGGAAGG + Intronic
1126966758 15:54062908-54062930 TGTCTCTCAATGAAAGGGGATGG - Intronic
1132156689 15:99500740-99500762 TGTCTGTCCTCGAAGGTGGAGGG + Intergenic
1132638371 16:965222-965244 AGTCTCTCCATGAAGCTGAATGG - Intronic
1134008264 16:10832901-10832923 TGTGTCACCATGATGGTGGTTGG - Intergenic
1134356773 16:13489643-13489665 TGTCTCACAATCATGGTGGAAGG - Intergenic
1134891946 16:17848652-17848674 TGTCCCTCCATGAAGCAGGAGGG - Intergenic
1137761031 16:50940488-50940510 TGTCTCACCATGACCCTGGAGGG - Intergenic
1137960638 16:52878542-52878564 TGTCTCTCCATCATGCTTGAAGG - Intergenic
1142134750 16:88446513-88446535 GGTCTGTCCATGAAGGTCGAAGG - Intergenic
1145396859 17:22503297-22503319 TGTTTCTCCAGGACTGTGGGAGG + Intergenic
1146098239 17:29953563-29953585 GGCCTCACAATGACGGTGGAAGG - Intronic
1146224380 17:31052862-31052884 TGATTCTCCCTGACGGGGGAAGG - Intergenic
1146733982 17:35221316-35221338 TGTGTTTTCATGACTGTGGAAGG + Intergenic
1147036680 17:37686727-37686749 TGTTTCTCCATGAGGGGAGAGGG + Exonic
1158275082 18:55758290-55758312 TGTCTGTCCAAGAGGGAGGAGGG + Intergenic
1162976340 19:14208741-14208763 TGTCTCTTCACGACGGGGAAGGG + Intergenic
1163573974 19:18099671-18099693 CGTCCCTCCACGAAGGTGGAGGG + Intronic
1163715730 19:18870901-18870923 TGCCTCTCCAGGCCGCTGGAGGG + Intronic
925256211 2:2490832-2490854 GGCCTCACCATCACGGTGGAAGG + Intergenic
925653268 2:6115597-6115619 TCTTTCTCCATGATGGTAGAGGG + Intergenic
928626800 2:33148144-33148166 TGTCTTTCCAGGAAGGTGGAAGG + Intronic
930862325 2:56087814-56087836 TATTTCTCTATGACAGTGGATGG + Intergenic
931319512 2:61162289-61162311 TTTCTCTCCATAACTGTGGTGGG - Intronic
936060543 2:109293096-109293118 TGTCTCGCCATGACACTGCAGGG + Intronic
939436544 2:142184434-142184456 GGTCTCACAATCACGGTGGAAGG + Intergenic
947828731 2:233124375-233124397 TGTGTTTCCATGAGGGTGGGAGG - Intronic
1169063467 20:2678540-2678562 TGTCTCTCCATTAGGGATGAGGG + Intergenic
1169985068 20:11435137-11435159 GGTCTCACAATCACGGTGGAAGG + Intergenic
1170581224 20:17700995-17701017 TGGCTCTCCTTGACTGTGTAAGG + Intronic
1173317848 20:41961181-41961203 TGCCTCTCCATGAAGGTGGGAGG + Intergenic
1174272396 20:49379176-49379198 TGTCTCTCCATTTGGGTGGCGGG - Intronic
1174575783 20:51536059-51536081 TCTTTCTCCATCCCGGTGGATGG - Intronic
1177871714 21:26580829-26580851 GGTCTCACAATCACGGTGGAAGG - Intergenic
1179073245 21:38093022-38093044 TGAATCTCCATTACGGTGAATGG - Intronic
1181830320 22:25555321-25555343 TGTTATTCCATGAAGGTGGAGGG + Intergenic
1183543266 22:38442028-38442050 TGTCTCTGCTTGTCTGTGGATGG + Intronic
1184091482 22:42295176-42295198 TCTCTCTCCATCAAGGAGGAAGG - Intronic
949952472 3:9240631-9240653 TGTCTCTCCATGACGGTGGAAGG - Intronic
953813894 3:46137385-46137407 TTTCTCTGCATGATGATGGAGGG + Intergenic
955035855 3:55266881-55266903 GGTCTCACAATCACGGTGGAAGG + Intergenic
959754856 3:109884730-109884752 TGTCTCACAATCATGGTGGAAGG + Intergenic
960493557 3:118348444-118348466 TGACTCTCCATGACCTAGGAAGG + Intergenic
961427604 3:126860264-126860286 GTGCTCCCCATGACGGTGGAAGG - Intronic
963088313 3:141459080-141459102 TGCCTCTCCCTGCCTGTGGATGG + Intergenic
968808974 4:2791725-2791747 TGTCTCTCCAGCAGGGAGGAGGG + Intergenic
972879644 4:43407715-43407737 TGCCTCACCATCATGGTGGAAGG + Intergenic
975414501 4:74091563-74091585 TGTCTCTCCATAAGTGAGGAAGG - Intergenic
975456371 4:74596275-74596297 GGTCTCACAATCACGGTGGAAGG - Intergenic
976444417 4:85114051-85114073 TTTCTCTCCATGACTGTGTGTGG - Intergenic
979158175 4:117424745-117424767 TTTCTATCCATGACCATGGAAGG + Intergenic
979202681 4:117997313-117997335 TGTCTCTCCATGACTTTGGCAGG - Intergenic
981120558 4:141046223-141046245 CGTCTCTCCATGACCTTAGATGG + Intronic
981226029 4:142295322-142295344 GGTCTGTCAATGACTGTGGATGG + Intronic
982761063 4:159284464-159284486 TGTGTCTCCATGGCGGTGGGAGG - Intronic
983089121 4:163483654-163483676 TCTCTCTCCCTGACTTTGGATGG + Intergenic
984564938 4:181318134-181318156 TGTAACTTCATGATGGTGGAGGG - Intergenic
986928675 5:12792205-12792227 TGTCTCTGCCTGACAGAGGATGG + Intergenic
991959634 5:72031427-72031449 TGTCTCTCCAGGTGGCTGGATGG - Intergenic
994211198 5:97089163-97089185 GGTCTCACAATCACGGTGGAAGG - Exonic
998392683 5:141797461-141797483 TGTCTCCCCATGACAGGGCAGGG - Intergenic
999442655 5:151614609-151614631 TGTCTCTCCCTCATGTTGGATGG - Intergenic
1000368608 5:160513716-160513738 GGACTCTCCATGACTGTGAATGG + Intergenic
1010248155 6:73681510-73681532 GGTCTCACAATCACGGTGGAAGG + Intergenic
1012311217 6:97725741-97725763 TGCCTCTCCTTGAGGCTGGAGGG - Intergenic
1013414340 6:109911610-109911632 TGTCTCTCAATTACTGTGGAAGG + Intergenic
1013692856 6:112666901-112666923 GGTCTCACAATGATGGTGGAAGG + Intergenic
1018031457 6:159845090-159845112 TGTCTCTCCAGGGCCTTGGATGG + Intergenic
1018479252 6:164173636-164173658 TGTCCTTCCATGAAAGTGGACGG - Intergenic
1031230295 7:119096813-119096835 GGTCTCACAATCACGGTGGAAGG + Intergenic
1035483485 7:159204735-159204757 TTTCTCTCATGGACGGTGGAGGG - Intergenic
1039422015 8:37451091-37451113 TGTCTCTGCATCACAGTGGGAGG - Intergenic
1039443127 8:37609445-37609467 TGTGTCTGCTTGAAGGTGGAGGG - Intergenic
1043876753 8:85494173-85494195 GGTCTCTCCATAAAGGTGGCAGG + Intergenic
1044532678 8:93325513-93325535 TTTCTCTCCAGAACTGTGGAAGG - Intergenic
1046719746 8:117606004-117606026 AGTCTCACAATCACGGTGGAAGG + Intergenic
1048933527 8:139336335-139336357 GGTCTCACAATCACGGTGGAAGG + Intergenic
1048956685 8:139543360-139543382 TGTCTCTCCCTGCCAGTGGCTGG - Intergenic
1049476450 8:142799219-142799241 AGTCACTCCATGTGGGTGGAGGG - Intergenic
1051592844 9:18794070-18794092 TTTCTCTCCATGACCTTGAAGGG + Intronic
1053131678 9:35618939-35618961 TGGCTCCCCATGAGGGTGCATGG - Intronic
1056184932 9:84125249-84125271 TGTCTCCCAGTGACTGTGGAAGG + Intergenic
1056507692 9:87272956-87272978 TGACCCTCCTTGAAGGTGGAGGG + Intergenic
1058391243 9:104497868-104497890 AGTCTCTCAATGAAAGTGGATGG - Intergenic
1059753743 9:117273106-117273128 TGTCTCTTAATCATGGTGGAGGG + Intronic
1061150731 9:128826618-128826640 TCTCTCTCCAGGACTGTGGAGGG - Exonic
1062492535 9:136813452-136813474 TTTCTCTCCATGATAGTGCAGGG + Intronic
1185513601 X:681203-681225 TTTCTTCCCATGCCGGTGGATGG + Intergenic
1202366431 Y:24168758-24168780 TGCCGCTCCATGATGGGGGAGGG - Intergenic
1202504351 Y:25501365-25501387 TGCCGCTCCATGATGGGGGAGGG + Intergenic