ID: 949955713

View in Genome Browser
Species Human (GRCh38)
Location 3:9267027-9267049
Sequence TAGGAAATGAACGCAGCATC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949955713 Original CRISPR TAGGAAATGAACGCAGCATC GGG Intronic
902140807 1:14352418-14352440 TAGAAAATGAATTCAGAATCAGG - Intergenic
903599511 1:24525357-24525379 TAGCATATGAAGGCAGCTTCTGG + Intronic
905124845 1:35708952-35708974 TAGGAGATGCATGTAGCATCTGG - Intergenic
905359763 1:37411210-37411232 TGGGAAATGAATGGAGAATCAGG - Intergenic
910609364 1:89124905-89124927 CAGGTAATGAAGCCAGCATCAGG + Intronic
910695980 1:90016264-90016286 TAGGATATGAACTCAGCAGTTGG + Intronic
913189882 1:116404548-116404570 TAGGAAAGCACCGCAGCATGTGG + Exonic
919311937 1:195921473-195921495 TAAAAAATGAACAGAGCATCAGG + Intergenic
921012377 1:211155220-211155242 TAGCAAATGAATGCAGGAACAGG - Intergenic
922527510 1:226316941-226316963 TAGGAAATGAAGGCAGAAGGAGG - Intergenic
1062967939 10:1624498-1624520 CAGGAAATGACAGTAGCATCTGG - Intronic
1064501393 10:15977291-15977313 TAGGAAATGAACTCAGGTTATGG - Intergenic
1065934255 10:30506577-30506599 AAGGAAATGAACGCATGATCTGG - Intergenic
1067199838 10:44157722-44157744 TAGAAAATGAACAGAGCCTCAGG + Intergenic
1069625494 10:69865363-69865385 CAGGCATTGAACACAGCATCAGG + Intronic
1071662003 10:87513945-87513967 TAGGAAATGCAAGCAGCCTCTGG - Intronic
1084224238 11:67705581-67705603 AAGGAACTGAAAGCAGCCTCTGG - Intergenic
1085630903 11:78115757-78115779 TAGGATATGATCTCAGCATAAGG - Intronic
1096843681 12:54393593-54393615 TAGGAAGTGAACAGAGCAGCTGG - Intergenic
1100016140 12:90013128-90013150 TGGGAAATGTATGCAGCATTGGG + Intergenic
1100770865 12:97921633-97921655 TAGGAAAGGAACGAAGCATCAGG - Intergenic
1101303870 12:103507803-103507825 TAGGACCTGAACATAGCATCAGG + Intergenic
1102425919 12:112844339-112844361 TAGGAAATGTAGGCAGCCTCTGG + Intronic
1103553896 12:121754386-121754408 TAGGAGATGAACACAGAAGCAGG - Intronic
1104569349 12:129911354-129911376 CTGGAAATAAACGCAGCAGCAGG + Intergenic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1104931331 12:132340938-132340960 GAGGAACAGAACGCAGCATCGGG - Intergenic
1104932584 12:132347650-132347672 CATGAAATGAACTCAGCAGCGGG - Intergenic
1105545797 13:21350063-21350085 AAGGAAATGAAATCAGCATGTGG - Intergenic
1108592145 13:51921688-51921710 CAGGACATTAACGCAGCATAAGG + Intergenic
1109784621 13:67157102-67157124 TAGGCATTGATCGAAGCATCAGG - Intronic
1111578857 13:90196349-90196371 CAGGAAATGAAAGAGGCATCAGG - Intergenic
1121689179 14:95863631-95863653 TAGGAACTGAAGGTAGCCTCTGG + Intergenic
1122644104 14:103180306-103180328 TAGGAAATAAAAGGAGCATTTGG + Intergenic
1123813300 15:23951076-23951098 AAGGAACTGAATGCAGCCTCTGG - Intergenic
1123871952 15:24584538-24584560 AAGGAACTGAATGCAGCCTCAGG - Intergenic
1123985962 15:25646270-25646292 AAGGAAATGAGAGCAGGATCTGG + Intergenic
1125355849 15:38816813-38816835 TAAGAAGTGAAGGCAGCCTCTGG + Intergenic
1125411208 15:39408065-39408087 AAGAAAAAGAACGCAGCATCAGG + Intergenic
1126541378 15:49828169-49828191 AAGGAACTGAAAGAAGCATCTGG + Intergenic
1127680588 15:61292937-61292959 TAAAAAATGAAAGTAGCATCAGG + Intergenic
1134251689 16:12578585-12578607 TAGGGAATGCAGGCAGCCTCGGG + Intergenic
1143068069 17:4265301-4265323 TAGGAAAGGAAAGGAGCATCAGG + Intergenic
1146606420 17:34262116-34262138 AAGGAACTGAAAGCAGAATCTGG - Intergenic
1151542551 17:74771987-74772009 AAGGAAATGAACCAAGCATCCGG - Exonic
1158567588 18:58568294-58568316 TAGCCAAGGAACACAGCATCAGG - Intronic
1165301295 19:34971064-34971086 AAGGAATTGAAAGCAGCTTCAGG - Intergenic
929186444 2:39100317-39100339 AAGGAAATGAAATCAGCACCTGG + Intronic
939252068 2:139694563-139694585 AAGGAAATGTATGAAGCATCTGG + Intergenic
941930166 2:170930464-170930486 CAGGAAATGAAGGTAGCACCAGG - Intronic
942425360 2:175854835-175854857 TATTAATTGAAGGCAGCATCTGG + Intergenic
943960640 2:194258030-194258052 TGGGAAATGAAGGCAGCTTGGGG + Intergenic
947250423 2:228096726-228096748 TATGAAATGAAAGCAGTCTCTGG + Intronic
1170122382 20:12925300-12925322 TAAGAAATGAACTGAGCAGCTGG - Intergenic
1174212576 20:48891650-48891672 TGGGAATTGAAAGCAGTATCTGG + Intergenic
1177646112 21:23901545-23901567 CAGGAACTGAAGGAAGCATCTGG + Intergenic
1182265508 22:29111743-29111765 TAGGACAAGAACTTAGCATCTGG + Intronic
1182413886 22:30208751-30208773 TAGGTAATCAAGGCAACATCTGG - Intergenic
1183695459 22:39419389-39419411 TAGGAAATGAAGACAACACCAGG - Intronic
1184863346 22:47189312-47189334 TAGGAAATTAACACAGTGTCAGG + Intergenic
949490237 3:4582046-4582068 TAAGAAATGACAGCAGCATTAGG - Intronic
949955713 3:9267027-9267049 TAGGAAATGAACGCAGCATCGGG + Intronic
960434683 3:117611334-117611356 AAGGCAATTAACTCAGCATCAGG + Intergenic
962609624 3:137063495-137063517 TAGGTAATGCACACAGCAGCTGG + Intergenic
965344840 3:167535738-167535760 AAGGAAATGAAATCAGCATGTGG + Intronic
965614723 3:170582879-170582901 GAGGAAATGAACAGAACATCAGG + Intronic
966319987 3:178691517-178691539 TAGCAAATGAACACAGGAACAGG - Intronic
975935059 4:79569767-79569789 TAGGGAAAGAAAGTAGCATCTGG - Intergenic
976197633 4:82548659-82548681 TAGGAAATAAGTGCAGCAGCTGG + Intronic
976890704 4:90043644-90043666 TAGGAAATGAAGTTAGCATTAGG + Intergenic
977110703 4:92950523-92950545 TCTGAAATGAATGAAGCATCAGG - Intronic
978294924 4:107193887-107193909 TAGGTTATGAAGACAGCATCAGG + Intronic
980159617 4:129144744-129144766 TAGGAGATAAACGGAGCATAAGG - Intergenic
980342147 4:131564605-131564627 TAGGAAATGAGGGCAGCCTCAGG - Intergenic
982028558 4:151276784-151276806 GAGGAAATGAACCCAGTATCTGG - Intronic
982165921 4:152613696-152613718 GAGAAAATGAGCGCAGCAGCAGG - Intergenic
984763210 4:183379741-183379763 ACTGAAATGACCGCAGCATCTGG - Intergenic
987968842 5:24915231-24915253 AAGGAAATGACAGCAGCCTCAGG - Intergenic
989506803 5:42235714-42235736 TAGGAAATGAACTAAGCTTTTGG - Intergenic
993393934 5:87358536-87358558 TAGGAGATGAAGGCAGATTCTGG - Intronic
997374150 5:133384903-133384925 TAGGATATGAAGCCAGCATGGGG - Intronic
998929850 5:147169305-147169327 TTGGAAATGAAAGAAGCCTCAGG + Intergenic
1000152297 5:158515294-158515316 TAAGAAATTGACGCAGCTTCAGG + Intergenic
1001973781 5:175979613-175979635 TAGCACATGAACACAGCCTCTGG + Intronic
1002243651 5:177864166-177864188 TAGCACATGAACACAGCCTCTGG - Intergenic
1002955344 6:1857282-1857304 GTGGAACTGAACGCAGCATACGG - Intronic
1004285084 6:14314285-14314307 TAGGAAATGATGACAGCAACTGG + Intergenic
1004690913 6:17991325-17991347 TAGGAACTGAATGAAGCATTTGG + Intergenic
1004883564 6:20031651-20031673 AAGGAACTGCACGCAGCTTCTGG + Intergenic
1005318523 6:24628666-24628688 TTGGAAATCAACGCATCAGCTGG + Intronic
1005338954 6:24825176-24825198 TAGGAAATTAAACCAGCTTCTGG + Intronic
1005657570 6:27957485-27957507 TAGTAAATTTATGCAGCATCAGG + Exonic
1006027541 6:31157199-31157221 TAGGAAAAGAGCTAAGCATCGGG - Intronic
1008658196 6:53637797-53637819 TAGGAAATGAAATCAGTATGTGG - Intergenic
1010027277 6:71233964-71233986 TATGACATGAACTCTGCATCTGG + Intergenic
1011796555 6:90959879-90959901 AAGAAACTGAACTCAGCATCAGG - Intergenic
1014038152 6:116791937-116791959 TAGGAAATGAAGGGAGCTTCAGG + Intergenic
1017889947 6:158629696-158629718 AAGGGAAGGAACGCGGCATCTGG - Intronic
1020789540 7:12609574-12609596 TAAGAAAAAAACCCAGCATCTGG + Intronic
1022025341 7:26443203-26443225 TGGGAAATGAACGGAGCATGTGG + Intergenic
1022472734 7:30691687-30691709 TAGGAGATGAAGCCAGGATCTGG - Intronic
1022567657 7:31419490-31419512 CAGGAAGTAAAGGCAGCATCGGG - Intergenic
1024093962 7:45969822-45969844 CTGAAAATGAACCCAGCATCTGG - Intergenic
1024272432 7:47652614-47652636 TAGAAAAAGAAAGAAGCATCAGG - Intergenic
1029117706 7:98245798-98245820 AAGGAAATGAAGGCAGGAACTGG + Intronic
1030150664 7:106401549-106401571 GAGGAAATAAAGGCATCATCTGG + Intergenic
1030865848 7:114700835-114700857 TAGGAAATGAAGGCAGGAGGAGG + Intergenic
1034979995 7:155469629-155469651 GAGGTGATGAACGCAGCACCTGG + Intergenic
1039215011 8:35260079-35260101 AATGAAATCAACGCACCATCAGG + Intronic
1039265798 8:35822666-35822688 TAGGAAATTAACACAGAAACAGG + Intergenic
1039904955 8:41779811-41779833 TAGGATTTGAACTCAGCAACCGG + Intronic
1040939649 8:52819173-52819195 TAGGCAATGGACACAGCATGTGG - Intergenic
1040973566 8:53164474-53164496 AAGGAACTGAAAGCAGCCTCTGG + Intergenic
1043964467 8:86457897-86457919 TGGGAAATGAGCACAGAATCAGG - Intronic
1044959544 8:97516860-97516882 AAGCAAATGACCACAGCATCAGG - Intergenic
1047122223 8:121917976-121917998 AAGCAAATGAACACAGCATTTGG - Intergenic
1051228115 9:14923955-14923977 TAGGAAATGAATACAGCATAAGG - Intergenic
1057742037 9:97720366-97720388 TAGGATGTGAACGCAGCTTTTGG - Intergenic
1189888268 X:45572118-45572140 TAGGAAAGGAAAACAGCATAAGG + Intergenic
1193322629 X:80140799-80140821 TAGGAATTGAAAGCTGCATTTGG + Intergenic
1195592136 X:106641731-106641753 AAGGAAATGAACCCACCCTCTGG + Intronic
1195833025 X:109081310-109081332 AAGGAAATGAAATCAGCATATGG + Intergenic
1199926209 X:152467163-152467185 AAGGAAATGAAATCAGAATCTGG + Intergenic