ID: 949958866

View in Genome Browser
Species Human (GRCh38)
Location 3:9294754-9294776
Sequence CTGTTTCTTTGGAGAGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 604
Summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 555}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949958866 Original CRISPR CTGTTTCTTTGGAGAGGAGA AGG (reversed) Intronic
900267316 1:1764541-1764563 CTGCTTGTTTTGAGAGGCGAAGG - Intronic
900895148 1:5478257-5478279 CTAGATCTTTGGAGGGGAGAAGG - Intergenic
902514813 1:16984416-16984438 CTGTTTCTTTGGGCAGGGGAGGG + Intergenic
902546276 1:17192628-17192650 CTCTCTCTTGGGAGAGGAAAAGG - Intergenic
903792385 1:25903698-25903720 CTTCTTCTTTGGAGGGGAAAGGG + Exonic
903832392 1:26182998-26183020 CTGGCTCTTAGCAGAGGAGAAGG + Intronic
903961028 1:27057931-27057953 CGGTTTCTTGGGAGAAGAAACGG - Intergenic
904129784 1:28267156-28267178 CTTTTTCTTTGGTGAGGGGGAGG + Intronic
904700816 1:32357091-32357113 CTTTTTCTTAGAAGAGCAGATGG + Intronic
905027657 1:34861993-34862015 CTGAATATGTGGAGAGGAGAAGG + Intergenic
905933460 1:41806149-41806171 GTGTTTGTCTGGAGAGCAGAGGG - Intronic
906579340 1:46923309-46923331 ATGTTTCTTTGGACGTGAGATGG + Intergenic
906745429 1:48218173-48218195 CTGTTGCTTATGAGAGGTGAGGG + Intergenic
908257533 1:62315295-62315317 CTCTGTCTTTGGAGATCAGACGG - Intronic
908598935 1:65718540-65718562 CTCTGTCTTTGGAAAGGGGAGGG - Intergenic
909449667 1:75784518-75784540 CTGTGTGTGTGGCGAGGAGAGGG + Intronic
909809248 1:79910459-79910481 CTATGTGTTTGGAGAGGATATGG - Intergenic
909845039 1:80382718-80382740 CTCTTTCTTTGGCTCGGAGATGG - Intergenic
910118614 1:83760075-83760097 CAGTTTATCTGGTGAGGAGAAGG - Intergenic
911196133 1:94997211-94997233 CTGGGTCTTTGGGGAGGTGAGGG + Intronic
911677011 1:100669855-100669877 CTATTTCTTTGGAAAGGAAATGG - Intergenic
911691832 1:100843717-100843739 CTGTTTCTTTGTAGCGTTGATGG + Intergenic
911967856 1:104390172-104390194 CTCTGCCTTTGGAAAGGAGAGGG + Intergenic
912036590 1:105324486-105324508 CTCTGTCTTTGCAAAGGAGAGGG - Intergenic
912135903 1:106659863-106659885 CTCTGTCCTTGGAAAGGAGAGGG + Intergenic
913418485 1:118637978-118638000 CTCTTTCTTTGGCTAGGAAAGGG - Intergenic
913520085 1:119637076-119637098 CTTTTTCCTTTGAGAGGAGAAGG - Intronic
913973147 1:143431922-143431944 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
914067531 1:144257529-144257551 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
914111622 1:144708825-144708847 CTGTCTCTGGGGAGAGGAGCAGG + Intergenic
914229154 1:145749028-145749050 CTGTTTCTTCTCAGAGAAGAGGG - Intronic
914287044 1:146236702-146236724 GTGTTTCTTTGGTGAGCAAAAGG + Intergenic
914394563 1:147252693-147252715 CTGTATCCTGGGAGATGAGATGG + Exonic
914548076 1:148687444-148687466 GTGTTTCTTTGGTGAGCAAAAGG + Intergenic
915374073 1:155376909-155376931 CTTTTTTTTTGGGGGGGAGATGG + Intronic
916735781 1:167605736-167605758 CTGTCTGGTTGGAGAGGAGAAGG - Intergenic
916769149 1:167891325-167891347 CTGTTGTGTTGGAGAGAAGAGGG - Intronic
917118107 1:171622745-171622767 CTGTTTCTTGGGAGATGACTTGG + Intergenic
917400948 1:174649088-174649110 CTGTGTCTTTGCACATGAGATGG + Intronic
917425135 1:174905248-174905270 CTGTCTCTTTGGAAAGGTCATGG - Intronic
917630073 1:176882989-176883011 CTGTTTCTGCCCAGAGGAGAAGG + Exonic
917900562 1:179539077-179539099 GTGTGTCTTTGCACAGGAGATGG + Intronic
918522816 1:185433159-185433181 TTGTTTCTATGGAGATGAGCAGG + Intergenic
918666170 1:187154223-187154245 CTGTGCCTTTGGAAAGGGGAGGG - Intergenic
919012124 1:191978497-191978519 CTGTTTCTCAGTAGAGGAGTGGG - Intergenic
919076289 1:192817170-192817192 CTGTCTATTTGGAGTGAAGAGGG + Intergenic
919367053 1:196674818-196674840 CTGTTTTGTAGGAGAGGAAATGG - Intronic
919657127 1:200208186-200208208 CTCTCTCTTTGGATTGGAGATGG - Intergenic
920389969 1:205593480-205593502 CGATTTCTTTAGAGAGGAGTGGG + Intronic
920413685 1:205783198-205783220 CTGTTGCTTTGGGGAGGGGCAGG + Intergenic
921734424 1:218610839-218610861 TTGTTTTGTTGGAGAGGAGTGGG + Intergenic
923721961 1:236474539-236474561 TTATTGGTTTGGAGAGGAGAGGG - Intronic
923805638 1:237254595-237254617 CTCATTCTTTAGAGAGGAGGAGG + Intronic
924760383 1:246979258-246979280 CTGTTGCTTTGGGGATGACATGG + Intronic
1066112081 10:32206596-32206618 CTGATTTTTGGAAGAGGAGAGGG + Intergenic
1066149219 10:32597574-32597596 CTGTTTCTTTGGAGGAGAAGAGG + Intronic
1067268349 10:44767133-44767155 CTGTGGCTTTGGAGATAAGAGGG + Intergenic
1067324212 10:45250805-45250827 CTCTTTCTTTGGCTAGGAAAGGG + Intergenic
1067773227 10:49142401-49142423 CTCTGTCTTTGAAGAGGGGAAGG + Intergenic
1067909936 10:50336104-50336126 CAGTTTTTTTGGAGTGGGGAAGG - Intronic
1067967749 10:50932675-50932697 CTTTTACTTGGCAGAGGAGAAGG - Intergenic
1068116451 10:52741829-52741851 CTGTTTCTTATGAGAGGATGAGG + Intergenic
1068255208 10:54500492-54500514 CTGTCACTTAGGAGAGGACAGGG + Intronic
1068420935 10:56792175-56792197 CTGTTGTTTTAGAGGGGAGATGG - Intergenic
1068646413 10:59472607-59472629 GTGTTTCTTTGCACATGAGATGG - Intergenic
1069491041 10:68860843-68860865 CTTCTTCTTAGGTGAGGAGAAGG + Intronic
1069591896 10:69647254-69647276 CTTTTCCTGTTGAGAGGAGATGG + Intergenic
1070385083 10:75917105-75917127 CTCCTTCTTGGCAGAGGAGATGG - Intronic
1071087433 10:81878894-81878916 CTGTCTCTTTGGAGTGGAAGAGG + Intronic
1071487517 10:86112475-86112497 CTATTTCATTGCTGAGGAGAAGG - Intronic
1071701078 10:87936976-87936998 CTGTTTCTCTTCAGAGGTGAGGG + Intronic
1072743795 10:97926160-97926182 CTGTTTCTGTGGAGCCCAGAAGG + Intronic
1073381248 10:103079525-103079547 CTGAGTCTGGGGAGAGGAGAGGG + Exonic
1074522008 10:114234485-114234507 CTGGGAATTTGGAGAGGAGATGG + Intergenic
1074787510 10:116853999-116854021 GTGTTTCTGTGCAGAGGAGCAGG - Intronic
1074895127 10:117770801-117770823 CTGTCTGGTTGGAGAGGAGCTGG - Intergenic
1075306839 10:121375541-121375563 CTTTTGGTCTGGAGAGGAGATGG - Intergenic
1075492165 10:122880324-122880346 CTGTTTTGGTGGAGAGGAGGTGG - Intergenic
1076230758 10:128818150-128818172 CTGGAGATTTGGAGAGGAGATGG - Intergenic
1076234884 10:128855975-128855997 CTGGTGCTTTGGTGAGGAAAGGG - Intergenic
1076361030 10:129889120-129889142 CTGGTTCTTTGCAAAGGACATGG + Intronic
1078294074 11:10047912-10047934 CTGATTCTTTGGTTTGGAGAGGG - Intronic
1079832106 11:25281225-25281247 CTGTTTCTTTGACTAGGAAAGGG + Intergenic
1080138583 11:28888118-28888140 CTTTTGCTTTGTAGAAGAGAAGG + Intergenic
1080354740 11:31430057-31430079 ATCTTTCTCTGTAGAGGAGATGG - Intronic
1080848823 11:36050053-36050075 TTGTTTATTTGGAGAGAGGAGGG + Intronic
1081066571 11:38548341-38548363 CTTGTTTTTTGGCGAGGAGAAGG - Intergenic
1081763864 11:45595656-45595678 CTGTTTATTTTAAGAGCAGATGG + Intergenic
1082131459 11:48494869-48494891 CTGTGTATTTGAAGAGCAGATGG + Intergenic
1082634236 11:55577382-55577404 CTCTTTCTTTGAATAGGAAAGGG - Intergenic
1082640161 11:55649956-55649978 CTGTTTGATTTGAAAGGAGAGGG - Intergenic
1082844099 11:57713196-57713218 CTGTTTCATTGGTGAAGAAATGG + Intronic
1083058131 11:59842784-59842806 CTGTGTCTTTAGACAGGTGATGG + Intronic
1083182160 11:60993911-60993933 CACTTTCTTGGGAGAGGAGGGGG + Intronic
1083839531 11:65296123-65296145 TTGTTTCTTTGGGGAGGTGGTGG + Intronic
1084437994 11:69155326-69155348 CGGCTTCTCCGGAGAGGAGAGGG - Intergenic
1085119251 11:73956849-73956871 ATGATACCTTGGAGAGGAGATGG + Intronic
1085186235 11:74578416-74578438 CAGTTTCTTAGTAGAGAAGACGG - Intronic
1085557115 11:77434447-77434469 TTTTTTTTTTGGAGAGGGGATGG + Intronic
1085721215 11:78913932-78913954 CTGTTAGCCTGGAGAGGAGAAGG + Intronic
1085864313 11:80270872-80270894 GTGTTTCTGTGGGGAGAAGAGGG - Intergenic
1086507890 11:87524884-87524906 CTCTTTCTTTGAAGAGGGGAAGG + Intergenic
1087056779 11:93944669-93944691 GTGTTTCTTTGGTGAGCAAAAGG - Intergenic
1087500593 11:98948137-98948159 CTGTTTTTTTGGAGGAGAAATGG - Intergenic
1087598336 11:100282821-100282843 CTCTGCCTTTGGAAAGGAGAGGG - Intronic
1088001511 11:104887400-104887422 TTGTTTCTTTGGAGAAGAGAGGG + Intergenic
1088400989 11:109422614-109422636 CTGCTTCTTTCTAGAGGAGCTGG - Intronic
1088510885 11:110573604-110573626 CAGTGTCTTTGGACAGGGGAAGG + Intergenic
1088569980 11:111213490-111213512 CTCTGTCTTTGGAAAGGAGAGGG + Intergenic
1088609095 11:111560144-111560166 CTGTTTCCCTGGTGAGGAGAGGG - Exonic
1088813882 11:113408813-113408835 CTGATGCTTTCCAGAGGAGATGG + Intergenic
1089098845 11:115942914-115942936 CTGTTGTTTTGGAGAGCTGAAGG - Intergenic
1089824648 11:121264423-121264445 CTCTGCCTTTGGAAAGGAGAGGG - Intergenic
1091309103 11:134560321-134560343 CTTCTTCCTTGGTGAGGAGACGG + Intergenic
1091998387 12:5013674-5013696 CAGCTTGATTGGAGAGGAGAAGG + Intergenic
1092773322 12:11918334-11918356 CTGTTTCTAAGGGGAGGAAAAGG - Intergenic
1093532169 12:20179381-20179403 CTGTTTATTTGCAGATGACATGG - Intergenic
1093987044 12:25546523-25546545 CTGTTTCTTCGGAACTGAGAAGG + Exonic
1094352072 12:29537988-29538010 CTGTTTCTCAGGAGAGGTGGTGG + Intronic
1096405993 12:51344691-51344713 CTCTTTTTTGGGGGAGGAGAGGG - Intronic
1096548137 12:52355439-52355461 CTGACACTTTGGAGATGAGATGG + Intergenic
1097412337 12:59270134-59270156 GTGTGTCTTTGGACATGAGATGG - Intergenic
1098566507 12:71943216-71943238 CAGTTTCTTTATATAGGAGAGGG + Intronic
1098591138 12:72214819-72214841 TTGTTTCTTTGGCCAGGAGTAGG - Intronic
1098914834 12:76246505-76246527 CTTCTTTTTTGGGGAGGAGACGG - Intergenic
1099188282 12:79539403-79539425 CTGATCCTTGGGAGAGCAGAGGG + Intergenic
1099669058 12:85667699-85667721 CTGTTTCTTACCAGATGAGAAGG + Intergenic
1100100243 12:91094739-91094761 CAGTGTGTTTGGAGAGGAGTGGG + Intergenic
1101428201 12:104605140-104605162 TTTTTTTTTTGGAGAGGGGATGG - Intronic
1102469947 12:113154163-113154185 CAGCTACTTTGGAGCGGAGATGG + Intronic
1102602844 12:114045878-114045900 CTGTTTCTTTGAAGATTACAGGG - Intergenic
1103214502 12:119191194-119191216 CTGTTTCTTTGCAGAAAAAAAGG - Intronic
1103326886 12:120127636-120127658 CTTTTCCTGTGGAGAAGAGAAGG - Exonic
1103558852 12:121781662-121781684 CTGAATCTTTGGGGAGGGGAGGG - Exonic
1104302194 12:127574542-127574564 CTGGATGTTTGGAAAGGAGATGG - Intergenic
1104331448 12:127850395-127850417 CAGCTTCTTTGAAGAGCAGATGG + Intergenic
1105247204 13:18665054-18665076 ATGTTCCTTTGGAGACGAAATGG + Intergenic
1105291792 13:19058169-19058191 CTGCTTCTTAGGAGCTGAGATGG + Intergenic
1105595813 13:21836960-21836982 CTGTTTCTTTTTAGTGGGGATGG + Intergenic
1105655409 13:22432141-22432163 CTGTTTCCTTGGCTAGTAGATGG + Intergenic
1106543012 13:30706697-30706719 CTCTCTCTTTGAAGAGGGGAAGG + Intergenic
1106743146 13:32669289-32669311 CTTTTTTTTTGGAGGGGAGGGGG + Intronic
1106888220 13:34213684-34213706 CTGTTTCTTTAAAGAGCAGCAGG - Intergenic
1107057018 13:36117126-36117148 CTGTTGCTTTGGATTTGAGAAGG - Intronic
1107097191 13:36549673-36549695 CTGTTTGTAGGGAGAGGGGATGG - Intergenic
1107348561 13:39489551-39489573 CTTTTTTTTTGGAGGGGAGCGGG + Intronic
1109685894 13:65819184-65819206 CTCTTTCTTTGGAAAGGGGAGGG + Intergenic
1110064900 13:71091405-71091427 CTGTATCTTTACAGAAGAGAAGG - Intergenic
1110547355 13:76770345-76770367 TGTTTTCATTGGAGAGGAGACGG + Intergenic
1110835621 13:80078644-80078666 CTGTAGCTTTGGATTGGAGAAGG + Intergenic
1111113037 13:83740082-83740104 CTCCTTCTTTGGAGAAGACAAGG + Intergenic
1112882948 13:104132429-104132451 GAGTCTCTGTGGAGAGGAGATGG - Intergenic
1113120395 13:106918114-106918136 TTGTTTCTTTGGTGAGGAATCGG + Intergenic
1113572837 13:111370860-111370882 TTGTTTTTTTGGGGAGGAGGCGG + Intergenic
1114230913 14:20781820-20781842 CTGTTGCATTGGAGAGGACTTGG - Exonic
1115181906 14:30637205-30637227 CTGTTTATCTGGATAGGTGAGGG - Intronic
1115818657 14:37190041-37190063 ATGTGTCTTTGGACATGAGATGG - Intergenic
1116407117 14:44579609-44579631 CTCTGCCTTTGGAAAGGAGAGGG + Intergenic
1117566432 14:56998679-56998701 CTGTTTCTTTTGGGTGGGGAGGG - Intergenic
1117683307 14:58227358-58227380 CTGTTTATTTTTAGTGGAGATGG - Intronic
1117841812 14:59869406-59869428 CTGTTTCCAGGGAGAGGAAAGGG - Intronic
1118079611 14:62343255-62343277 GTGGTTCTTTGAAGTGGAGATGG - Intergenic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1119860142 14:77930323-77930345 CTGCTGCTTCGGAGAGGAGTGGG + Intronic
1120352395 14:83379462-83379484 GTGTTTTTTTAGAGAGGGGAGGG + Intergenic
1121463775 14:94101420-94101442 CTGCTTTTCTGGAGAGGTGAGGG - Intronic
1121649768 14:95549354-95549376 ATGATTCTTGGGAGAGCAGAGGG + Intergenic
1121759712 14:96434828-96434850 CTCTGTCTTTGGAAAGAAGAGGG - Intronic
1121880849 14:97499228-97499250 CAGTTTCTTTTTACAGGAGAAGG - Intergenic
1122017498 14:98808568-98808590 CTTGTTCTTTGGAGAGGAAGAGG - Intergenic
1122304156 14:100751129-100751151 TTCATACTTTGGAGAGGAGATGG + Intergenic
1124707014 15:31974609-31974631 CTGGGTGCTTGGAGAGGAGACGG + Intergenic
1124948305 15:34292040-34292062 GTGTTTCTTTGGAGAAGAAGAGG + Intronic
1125443124 15:39724606-39724628 CTGTCTCTTTTAAGAAGAGAAGG + Intronic
1125518551 15:40336083-40336105 GAGTTTCTTTGGCAAGGAGATGG - Intronic
1125984957 15:44040919-44040941 GTGTGTCTTTGCAGATGAGATGG - Intronic
1126176440 15:45740128-45740150 CTGATTCTTTGTAGAGGACTTGG + Intergenic
1126183834 15:45811370-45811392 CTCTGCCTTTGGAAAGGAGAAGG + Intergenic
1126518378 15:49559604-49559626 CTGCTTGTCTGGAGAGGAGTGGG - Intronic
1126803963 15:52326911-52326933 CTGTTTCTCTGGAGTCAAGAGGG + Intronic
1128998963 15:72317620-72317642 CTGTTTCTGGGGAGAGGATGAGG + Intronic
1129047128 15:72745489-72745511 GTGTATCTTTGGTGAGGTGAGGG - Intergenic
1129704767 15:77787872-77787894 CAGGTTCTGGGGAGAGGAGATGG - Intronic
1130653792 15:85777701-85777723 CCGTTCCTCTGGAGTGGAGAAGG - Intronic
1130821129 15:87496749-87496771 ATGTTTCTTTGAGGAGGAAAAGG + Intergenic
1132412972 15:101598987-101599009 CTCTCTCTTTGAAGAGGAAAAGG - Intergenic
1133507741 16:6429030-6429052 CTGTTTCCTGGAAGAGGAGAAGG + Intronic
1133544629 16:6793805-6793827 TTGTTTCTTTGGTTAGTAGAAGG + Intronic
1133663642 16:7943756-7943778 ATTTTTCTTTAGAGAGCAGAAGG - Intergenic
1134393429 16:13840787-13840809 CTCTCTCTTTGAAGAGGGGAAGG - Intergenic
1135539383 16:23318288-23318310 CTGTTTTTTAGACGAGGAGATGG - Intronic
1137590069 16:49687966-49687988 CTGTTTTTTGGGAGGGCAGATGG - Intronic
1138218217 16:55224402-55224424 CTGGTTCTTGGGAGATGAGCAGG + Intergenic
1138678722 16:58670227-58670249 CTGCTTCTTGGGAAAGGAGGTGG - Intronic
1139475709 16:67201645-67201667 GTGTGTCTTTGGTGAGGACAAGG + Intronic
1139776177 16:69318407-69318429 CTGTTTCTTCGCGGAGCAGATGG - Intronic
1140205812 16:72932430-72932452 CCATTACTTAGGAGAGGAGATGG + Intronic
1140672934 16:77296820-77296842 CTTTTTTTTTGGAGGGGAGGAGG - Intronic
1140937444 16:79687341-79687363 CTGGTTCTTGGGGGAAGAGAGGG - Intergenic
1141127992 16:81414951-81414973 CACATTGTTTGGAGAGGAGAAGG + Intergenic
1141700096 16:85638530-85638552 CTTTTTCTTGGGTGAGGAGCAGG + Intronic
1141712312 16:85707168-85707190 CTGCTTCTTGGGTCAGGAGAAGG - Intronic
1141956559 16:87375844-87375866 GTGTTTCTTTGGGCAGGTGAAGG - Intronic
1142296130 16:89223737-89223759 CAGTTTCTTTGGGGCGCAGAAGG + Intronic
1143680228 17:8470755-8470777 CTGTGCCTTGGGAGAGGAGCAGG + Intronic
1144408603 17:14976745-14976767 CTGTTCCTTCGTAGAGGAGGAGG - Intergenic
1144707952 17:17382102-17382124 CAGTTTCTTTGGAGCGATGATGG - Intergenic
1145984488 17:29036094-29036116 CTGTTTCTCTGTGGAGGTGAGGG - Intronic
1146821461 17:35986228-35986250 CTGTTTATTTGGAGACTAGAGGG + Intronic
1146938621 17:36828040-36828062 TTGTTTTTTTGGAGGGGGGAGGG + Intergenic
1147320636 17:39643769-39643791 CTCTTTCTCTGGAGAAGAGCAGG + Intronic
1148326418 17:46785823-46785845 ATGTTTCTTTGGGGAGAAAAGGG + Intronic
1148404562 17:47398928-47398950 TTCTTTCTTTGGAGGGGACAAGG + Intronic
1148968636 17:51459387-51459409 TTGCTTCCATGGAGAGGAGAAGG + Intergenic
1149604706 17:57916489-57916511 CTGTTTCCATGGAGATGCGACGG + Intronic
1149808639 17:59644090-59644112 ATGTTTGTTTGAAGAAGAGAAGG + Intronic
1150850456 17:68699164-68699186 CTGTTCCTTTGTAGGGGAGAAGG + Intergenic
1151185889 17:72363649-72363671 CTGTTTCTGTGGGGAGGGAAGGG - Intergenic
1151559935 17:74864664-74864686 CTGTGCCTTTGGGGAGGAGGCGG - Intronic
1151870504 17:76833550-76833572 CTGAGTCTTTGGTGAGGAGTTGG + Intergenic
1152377017 17:79924144-79924166 ATGTTTCCTGGGAGAGGTGACGG - Intergenic
1153026640 18:678905-678927 CTGTGTATCTGCAGAGGAGAAGG + Intronic
1153510570 18:5847280-5847302 CTCTGTCTTTGGATAGTAGATGG - Intergenic
1153723384 18:7930467-7930489 CTGTTTTGTAGGAGAGGAGTTGG + Intronic
1154441639 18:14394067-14394089 ATGTTCCTTTGGAGACGAAATGG - Intergenic
1155532255 18:26778933-26778955 CTGTTTCTTAGCTGAGGAGGTGG + Intergenic
1155597346 18:27502900-27502922 CTCTGCCTTTGGAAAGGAGAGGG + Intergenic
1155925529 18:31651605-31651627 CGGTTTATTTGGAGATGAGGTGG - Intronic
1156204882 18:34874569-34874591 CTTTTTCATAGGAGAAGAGAAGG + Intronic
1156405919 18:36782580-36782602 CTCTTTTTTTGGTGGGGAGATGG + Intronic
1156415752 18:36887794-36887816 CTCTTTGTATGGAGAGGAGGTGG + Intronic
1157150946 18:45217138-45217160 CTGTTGCTTTGGGGATGATAAGG - Intronic
1157611035 18:48955649-48955671 CTTCTTTCTTGGAGAGGAGAGGG - Intergenic
1158093699 18:53745956-53745978 CTGATCCTTTTGAGAGGAAAAGG - Intergenic
1158676760 18:59527383-59527405 ATGTGTCTTTGCACAGGAGATGG + Intronic
1158907545 18:62028397-62028419 CTATTTCTTTTTAGAGCAGATGG - Intergenic
1160741055 19:686017-686039 CTTTTTCCTTGGAGAGCAGTAGG - Intronic
1161614569 19:5262876-5262898 CTGTTAGTTTGGTGAGGAGAAGG + Intronic
1162026305 19:7895810-7895832 CTCTTTCTTGGGTGATGAGAAGG - Intronic
1162100021 19:8333873-8333895 CTAGTTGTTTGGAGAGGAGGCGG - Intronic
1162341307 19:10092908-10092930 CTATTTTTTTGCTGAGGAGATGG - Exonic
1162668472 19:12235362-12235384 TTGTTTTTTTCGAGACGAGACGG - Intronic
1162851708 19:13436134-13436156 CTGTTTCTTCAGAAAGGACAAGG + Intronic
1163023220 19:14495017-14495039 GTGTTGCTTTGGAGAGAAGGAGG + Intronic
1164457926 19:28424146-28424168 CTGTTTCCATGGAGAGGAAGAGG - Intergenic
1164914158 19:32037141-32037163 TTGTTAATTTGGAGAGGACATGG + Intergenic
1165038913 19:33055014-33055036 CTGTGGCCTTGGAGAGGGGAGGG - Intronic
1165361290 19:35338451-35338473 CTGGTTCTAGGGAGAGAAGATGG + Intronic
1166437278 19:42778170-42778192 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166446988 19:42866615-42866637 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166453917 19:42924284-42924306 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166456389 19:42943566-42943588 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166466181 19:43032837-43032859 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166472325 19:43088905-43088927 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166483456 19:43192854-43192876 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166485926 19:43211941-43211963 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166493082 19:43275894-43275916 CTGTGTGTTTGCAGAGAAGATGG - Intergenic
1166703203 19:44893944-44893966 CTGGGTCTGTGGAGAGGAGGGGG - Exonic
1167378611 19:49125718-49125740 TTGTCTCTTAGGGGAGGAGAGGG + Intronic
1167425027 19:49425843-49425865 CTGGTTCTTTAGAGAGGAGAAGG - Intronic
1168468813 19:56624903-56624925 CTGGTTCTCTGGATGGGAGAGGG - Exonic
1168720346 19:58551355-58551377 CAGTATCTTGGGAGAGGTGATGG + Intergenic
925092148 2:1164366-1164388 CAGTCTCTGTGTAGAGGAGAGGG + Intronic
925092184 2:1164536-1164558 CAGTCTCTGTGTAGAGGAGAGGG + Intronic
925092201 2:1164621-1164643 CAGTCTCTGTGTAGAGGAGAGGG + Intronic
925214579 2:2083649-2083671 CTGACACTTTGGAGAGGAGCAGG + Intronic
925293887 2:2765503-2765525 CTGTATCTGTGGGGAGAAGAGGG - Intergenic
925380966 2:3425958-3425980 CTGTTTCTTTGGAGGGGCATAGG + Intronic
925467330 2:4118909-4118931 GTGTTTCTTTGCACATGAGATGG + Intergenic
926624459 2:15079499-15079521 CTGTGTCCTTGGAAAGGAGGAGG - Intergenic
927384139 2:22513800-22513822 CACTTGCTTTTGAGAGGAGATGG + Intergenic
927783090 2:25954890-25954912 CAGTGGCTTTGGAGAGGAGCAGG - Intronic
928605119 2:32938288-32938310 ATGTTTCTTTGGTGGTGAGAGGG + Intergenic
928867722 2:35937260-35937282 TTTTTTCTTGGGAAAGGAGATGG + Intergenic
929745418 2:44652604-44652626 TTGTTACTTTGGAGAGGGGGAGG - Intronic
930685538 2:54303353-54303375 CTTTTTTTTTGGAGGGGGGAGGG - Intronic
931086004 2:58831309-58831331 TTGTATCTCAGGAGAGGAGAAGG - Intergenic
932817362 2:74872646-74872668 CTGTTTCTGTGGAGGGGATAAGG - Intronic
932913050 2:75825001-75825023 CTGTTGTTTTGGGGTGGAGAGGG - Intergenic
933387903 2:81634639-81634661 CTCTGCCTTTGGAAAGGAGAAGG + Intergenic
934050049 2:88202238-88202260 CAGTTTCTTGGGGGAGGAGATGG - Intergenic
934115448 2:88786957-88786979 ATGTTTCTATGGAAAGGGGAAGG + Intergenic
934177843 2:89592879-89592901 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
934288141 2:91667180-91667202 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
934628136 2:95881978-95882000 ATGTTTCTATGGAAAGGGGAAGG - Intronic
934631199 2:95925036-95925058 ATGTTTCTATGGAGAGGGGAAGG - Intronic
934802845 2:97183948-97183970 ATGTTTCTATGGAGAGGGGAAGG + Intronic
934805270 2:97217674-97217696 ATGTTTCTATGGAAAGGGGAAGG + Intronic
934832089 2:97537844-97537866 ATGTTTCTATGGAAAGGGGAAGG - Intronic
934833358 2:97556621-97556643 ATGTTTCTATGGAGAGGGGAAGG - Intronic
936474201 2:112825272-112825294 CTGTGTACCTGGAGAGGAGAAGG - Intergenic
936674121 2:114694750-114694772 CTAATTCATAGGAGAGGAGAGGG + Intronic
937616000 2:123922978-123923000 CTGTTTCTCTGGAGAACACAGGG - Intergenic
938211495 2:129469303-129469325 GTGTTTCTTTTGTGGGGAGAAGG + Intergenic
938956901 2:136307321-136307343 CTCTCTTTTTGGAGAGGATATGG - Intergenic
939064254 2:137463656-137463678 TTCTCTCTTTGAAGAGGAGAAGG + Intronic
939443146 2:142275664-142275686 CTGTGCCTTTGGAAAGGGGAAGG - Intergenic
939935351 2:148285169-148285191 CTATTTGTTTGAAGAGCAGATGG - Intronic
940315119 2:152320259-152320281 CTCTGCCTTTGGAAAGGAGAAGG - Intergenic
940337056 2:152540304-152540326 CTGATTCCTTGGTGAGGTGATGG + Intronic
940560396 2:155288065-155288087 CTCTGTCTTTGGAAAGGGGAAGG + Intergenic
941083939 2:161094579-161094601 CTGATTCTTTGGACGGGAGCAGG - Intergenic
941414229 2:165199054-165199076 CTCTTTCTTGGGAAAGGAAAAGG + Intronic
941548634 2:166886411-166886433 ATGAGTCTTTGGAGATGAGAGGG + Intergenic
941615533 2:167714265-167714287 CTGTTCCCATGGAGATGAGAGGG + Intergenic
942354422 2:175093930-175093952 CTGATTCATTGGGGAGCAGAGGG - Intronic
942643324 2:178083932-178083954 GTGTTTCTTGGGAATGGAGATGG - Intronic
942697092 2:178658436-178658458 GTTTTTCTTAGCAGAGGAGAGGG + Intronic
942697532 2:178662697-178662719 GTTTTTCTTAGCAGAGGAGAGGG + Intronic
942812523 2:180015890-180015912 ATGCTACTTTGGAGAGGAGGCGG + Intergenic
943227906 2:185205088-185205110 GTGATTCATTTGAGAGGAGAAGG - Intergenic
943352067 2:186806929-186806951 CTGCTTTCATGGAGAGGAGAAGG - Intergenic
946378358 2:219327933-219327955 CTGTTTCCTTGGAGAGCATGAGG + Intronic
946686292 2:222274112-222274134 TTGTTGCATTTGAGAGGAGAGGG - Intronic
946920321 2:224573992-224574014 CCATTACTTTGGAGAGGACAGGG + Intronic
948406860 2:237728370-237728392 GTGTTTTTCTGGAGAGGAAAAGG + Intronic
949035872 2:241815527-241815549 CTCTTTATCTGCAGAGGAGAAGG + Intronic
1169040743 20:2493427-2493449 CTCTTTCTTGGGAAAGGAAAAGG - Intronic
1170086902 20:12544209-12544231 CTCTGCCTTTGGAGAGGGGAAGG - Intergenic
1170247207 20:14234621-14234643 TTGTTTCTTTGCAGATGAAATGG + Intronic
1170282730 20:14669205-14669227 CTGTAACTCTGGAGAGGAGATGG - Intronic
1173354218 20:42271732-42271754 GTTTTTCTTTAGAGAGGTGAGGG - Intronic
1173383229 20:42565152-42565174 CTGTGTCTTTTGAGATGTGAAGG - Intronic
1174831800 20:53820344-53820366 CTCTGCCTTTGGAAAGGAGAGGG - Intergenic
1174854400 20:54029142-54029164 GCTTTTCTTGGGAGAGGAGAAGG + Intronic
1175368132 20:58469431-58469453 CTGCTTCTTGGGAGAAGAGTGGG - Intronic
1176251297 20:64121646-64121668 CTTTTTCCTAGGTGAGGAGAAGG + Intergenic
1176294200 21:5062073-5062095 CTTTTTATTTGGAGGGGGGATGG - Intergenic
1176454421 21:6897107-6897129 ATGTTCCTTTGGAGACGAAATGG + Intergenic
1176832594 21:13762155-13762177 ATGTTCCTTTGGAGACGAAATGG + Intergenic
1176999881 21:15599080-15599102 CAGTTTCAGAGGAGAGGAGATGG + Intergenic
1178116864 21:29426843-29426865 CTCTTTGTCTGGAGGGGAGAAGG - Intronic
1178898404 21:36579698-36579720 CTGTTTCTTTGGACATTAAAGGG + Intergenic
1179344079 21:40539695-40539717 CTGTTTCTTATAAGATGAGAAGG + Intronic
1179588764 21:42391098-42391120 CTGTTTCCCTGCAGAGGAGGGGG + Intronic
1179789654 21:43749012-43749034 CTTTTTCTTTGTAGACGGGAAGG - Exonic
1179863059 21:44201575-44201597 CTTTTTATTTGGAGGGGGGATGG + Intergenic
1180616450 22:17131461-17131483 CTGTCTCTTTGGAGAGGGGAGGG - Intronic
1180676455 22:17589789-17589811 CTGTTTTCTTTGAGAGGTGAGGG - Intronic
1181554071 22:23657536-23657558 TTGTTTTTTTTGAGATGAGATGG + Intergenic
1181577491 22:23804546-23804568 CTTTTTTTTGGGAGGGGAGATGG + Intronic
1181601157 22:23952584-23952606 CTGTTTCCCTGGAGAGTCGAGGG + Intergenic
1181607352 22:23988742-23988764 CTGTTTCCCTGGAGAGTCGAGGG - Intergenic
1182634265 22:31712015-31712037 CTGTCTCTGGGGAGATGAGAGGG - Intronic
1182694136 22:32185260-32185282 CCTCTTCTTTGGAGAAGAGAAGG + Intergenic
1182795666 22:32989880-32989902 CTGTGTCTTTAGAGAGGAGAGGG - Intronic
1182973479 22:34599772-34599794 CTGTGTCTGAGGAGTGGAGAGGG - Intergenic
1183384091 22:37505019-37505041 CAGTTTCTTTGGAGAGTACTTGG - Intronic
1183390027 22:37540424-37540446 CTGTGTGTTTGGAGAGCAGTGGG - Intergenic
1183495570 22:38141612-38141634 CAGTTTCTTCGGAGAGGAAAGGG + Intronic
1184667864 22:45998000-45998022 CTTTTTCTTTGGGGAGGAGGAGG - Intergenic
1185003594 22:48262226-48262248 CTGTTTCATAGGCGAGGAAATGG - Intergenic
949120424 3:377385-377407 CTGGTTCTGTGGAATGGAGATGG + Intronic
949188851 3:1226532-1226554 CTGTGTCTTTGAGGAGGAAAAGG - Intronic
949958866 3:9294754-9294776 CTGTTTCTTTGGAGAGGAGAAGG - Intronic
950525283 3:13519490-13519512 CTGCCTCTTGGGAGAGGAGATGG - Intergenic
951435406 3:22657121-22657143 CTCTTCCTTTGGAAAGGGGAGGG - Intergenic
951525408 3:23648308-23648330 CTATGTATTTGGAGAGGAAATGG + Intergenic
952203080 3:31151373-31151395 CTCTGTCTTTGGAAAGGGGAGGG - Intergenic
952851408 3:37732699-37732721 CTTTTTCTTTCAGGAGGAGATGG + Exonic
953311916 3:41888790-41888812 GTTTTTCTTTGGAGTGGAGTTGG - Intronic
953492961 3:43365392-43365414 CTGTTTGCTGGGAAAGGAGAGGG - Intronic
954219071 3:49141631-49141653 CTGTGTCCTTGGCAAGGAGAGGG - Intergenic
954647603 3:52141055-52141077 TTCTCTCTTTGGAGTGGAGATGG - Intronic
955819607 3:62882198-62882220 CTTATTTTTTGGAAAGGAGAGGG + Intergenic
955983914 3:64553615-64553637 CTGTTCCTTTAGGAAGGAGAAGG + Intronic
956201336 3:66709409-66709431 CTTCTTCTCTGGAGAGGACATGG + Intergenic
956241902 3:67140292-67140314 TTGTTTCTTTGCACATGAGATGG + Intergenic
956243643 3:67156531-67156553 TTGTTTCTTTGCACATGAGATGG - Intergenic
957364802 3:79208937-79208959 CTGTTTATGTGGGGAAGAGATGG + Intronic
957408938 3:79811574-79811596 CTGTTTCATTGATAAGGAGAAGG - Intergenic
957965787 3:87321371-87321393 CTCTGCCTTAGGAGAGGAGAGGG + Intergenic
958255276 3:91318519-91318541 GTGTGTCTTTGCACAGGAGATGG + Intergenic
958832936 3:99111408-99111430 CTCTCTCTATGGAGAGGAGGAGG + Intergenic
959351509 3:105270838-105270860 TTCTTTCTTTGGACAGGAGAAGG - Intergenic
959420671 3:106124469-106124491 TTGTTACATTGGAGAGGAGGTGG - Intergenic
959798075 3:110456876-110456898 CTCTGTCTTTGGAAAGGGGAAGG - Intergenic
960027086 3:113021577-113021599 CTGTTTCTTTGTCAAGCAGAAGG - Intergenic
960621345 3:119639482-119639504 CTGATTCTTTGGTGGGGAAAAGG + Intronic
960906818 3:122609858-122609880 CTGTTCCTTTGGTGAAGTGAGGG - Intronic
962548697 3:136466095-136466117 CTGTTTCTTTGGAGGGGGAGAGG - Intronic
962608714 3:137054921-137054943 TTTTTGCTTTGGAAAGGAGAGGG - Intergenic
962817870 3:139019381-139019403 CAGTTTCCTTGGAGAGCAGTTGG + Exonic
963349860 3:144138914-144138936 CTCTTTCTTAGCATAGGAGAGGG + Intergenic
963365087 3:144323993-144324015 CTCTACCTTTGGAGAGGGGAGGG + Intergenic
963715729 3:148801608-148801630 CTGGGTCTTTGGAGAGGTGAAGG - Intronic
964475689 3:157095872-157095894 CTTTTTCTTTGGAGGGGGGGTGG + Intergenic
964541347 3:157783088-157783110 CTATTTCTTTGTGGAGAAGAAGG - Intergenic
964810153 3:160654517-160654539 CTCTTTCTGTGGAAAGGGGAGGG + Intergenic
964961106 3:162427742-162427764 CTGTGCCTATGGAAAGGAGATGG + Intergenic
965096652 3:164237204-164237226 CTGTTTCCTTTGCGAGGACATGG + Intergenic
965886434 3:173451960-173451982 CTGTTTCTTTGACTAGGAAAGGG + Intronic
965933636 3:174078879-174078901 TTGTTGATTTGGAAAGGAGAGGG - Intronic
967252873 3:187561124-187561146 CTGGCTATCTGGAGAGGAGAGGG + Intergenic
967720155 3:192807598-192807620 GTGTTTAATTGGGGAGGAGAAGG + Intronic
967995041 3:195160136-195160158 TTGTTTCTGGGGATAGGAGAAGG - Intronic
968608947 4:1548333-1548355 CTGTTTGTTTTGGAAGGAGAGGG - Intergenic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969438427 4:7201925-7201947 CTGTAGCTTTGGAAAGGTGAAGG + Intronic
969807121 4:9617834-9617856 CTGTTTCTTTGACTAGGAAAGGG - Intergenic
971164838 4:24172307-24172329 CTCTTTCTTTGGCCAGGGGATGG - Intergenic
972184831 4:36515974-36515996 CTGTTTCTCTGGAAACTAGATGG - Intergenic
972371419 4:38427200-38427222 CTATTTGTCTGGAGAAGAGAGGG - Intergenic
972431390 4:38985884-38985906 CTGTTTCTCAGGAGAGGACAGGG + Intronic
973644066 4:52932660-52932682 TTGTTTCTTAGAAGAAGAGAAGG + Intronic
974182950 4:58406764-58406786 CTGTTTCTGTGGAGGGGAAATGG - Intergenic
974854681 4:67446122-67446144 CTGTCTCTATGGCGAGGAGGAGG + Intergenic
978222800 4:106297391-106297413 CTGTTTATTTGGATTTGAGAAGG - Intronic
978485563 4:109250005-109250027 CACTTTTTTTGTAGAGGAGATGG + Intronic
978692502 4:111532040-111532062 ATATTTCTTTGGACAGGACAAGG - Intergenic
979031488 4:115654069-115654091 GTGTTTCTTTGCACATGAGATGG + Intergenic
979100202 4:116603543-116603565 CTCTGCCTTTGGAAAGGAGAGGG - Intergenic
979181035 4:117728067-117728089 TGTTTTCTTGGGAGAGGAGAAGG + Intergenic
979388164 4:120094668-120094690 CTGTTTCTATGGAGTGCTGAAGG + Intergenic
980270676 4:130580104-130580126 CTGTATCTTTTCAGAGGAAAAGG - Intergenic
980677947 4:136114537-136114559 CTCTTTCTTTGAAGACGGGAAGG - Intergenic
980853096 4:138407399-138407421 CTGTTTCTTGGAAGAGAAAATGG + Intergenic
981437296 4:144740237-144740259 CTTTTATTTTGGGGAGGAGATGG - Exonic
981715385 4:147746761-147746783 CTGTTTCATGACAGAGGAGATGG + Intronic
982174264 4:152690579-152690601 CTATCTCTTTGAAGAGGGGAAGG + Intronic
982934001 4:161447991-161448013 GTGTTTGTTTGGAGTGGAGAGGG + Intronic
983106897 4:163697676-163697698 CTGTGTCTAAGGACAGGAGATGG + Intronic
983456330 4:167969036-167969058 CTCTGCCTTTGAAGAGGAGAGGG + Intergenic
983615015 4:169694126-169694148 CTGCTTATTTGGGGAGGAAAGGG - Intronic
984644457 4:182204400-182204422 TTGTTTTTTTGGTGGGGAGAGGG + Intronic
985495407 5:201872-201894 CAGTTTCCTTGGGGAGGGGAGGG - Exonic
986638042 5:9843699-9843721 CTGTTTCTGAAGTGAGGAGATGG + Intergenic
986966229 5:13275175-13275197 CTTCTTCTCTGGAGAGGGGAGGG + Intergenic
988452850 5:31360717-31360739 TTGTTTCTTGGGAGAGGAACTGG - Intergenic
988527263 5:31998185-31998207 CTGTTTCCTATGGGAGGAGAGGG - Intronic
989176841 5:38536050-38536072 CTTTATCTTTGGTGAAGAGAGGG + Intronic
989427864 5:41316765-41316787 CTGTACCTTTGGAAAGGACAGGG + Intronic
989565939 5:42901113-42901135 CTGTTTCTTTGAAGAGAGAAAGG - Intergenic
989671665 5:43924724-43924746 CTTTACCTTTGGAAAGGAGAGGG - Intergenic
989960672 5:50410904-50410926 TTGTTTCTTTCGAGAGGAAAAGG - Exonic
989975668 5:50583802-50583824 CTGTCTCTTTGAAGCTGAGAAGG - Intergenic
991242559 5:64476263-64476285 GTGTTTCTTTGCACATGAGATGG - Intergenic
991611201 5:68451139-68451161 CTCTTTTTTTGGAGGGGGGAGGG - Intergenic
992745466 5:79816029-79816051 CTGTTTCTTTAGTTAGGATAGGG + Intergenic
994214577 5:97123270-97123292 CTTTTTTTTTGGATAGGGGAGGG + Intronic
994367842 5:98935566-98935588 TTCTTTCTTATGAGAGGAGAGGG - Intergenic
994648709 5:102500449-102500471 CTTTTGCTTTGGATAGCAGAAGG - Intergenic
994855156 5:105111119-105111141 CTGGTTCTTGGGAGTTGAGAGGG - Intergenic
995945808 5:117644636-117644658 CTTTTGCTTTGAATAGGAGATGG - Intergenic
996861739 5:128074583-128074605 TTGTTTCTTTGGTGAGGTGGGGG - Intergenic
997171584 5:131727565-131727587 GTGTATCTTTGCAGATGAGATGG + Intronic
997896711 5:137725169-137725191 CTGTTTCACAGGCGAGGAGAGGG - Intronic
998042061 5:138957030-138957052 CTGTTACTGTGGTGAGGAGTGGG - Intronic
998087905 5:139341852-139341874 GTGTTTGTTTGGACTGGAGAAGG + Intronic
999345700 5:150817184-150817206 CTCTTCCTTTGGAAAGGGGAGGG + Intergenic
1000028211 5:157378287-157378309 CTATTTCTTTGTACAGAAGAAGG + Intronic
1001169430 5:169404729-169404751 GTGTTTCTTTTCATAGGAGATGG - Intergenic
1002286645 5:178166872-178166894 CTGTTTCTGTGAAGAGAGGATGG - Intergenic
1003300954 6:4882570-4882592 CTGGTTCTTTTGGGAGAAGAAGG + Intronic
1003555978 6:7140915-7140937 CTGTTTCTGGGGAGGGGCGAGGG + Intronic
1004348494 6:14869972-14869994 CTGGAGCTTGGGAGAGGAGAGGG - Intergenic
1004597603 6:17115103-17115125 CTGTTTCTTTCACTAGGAGATGG - Exonic
1004955836 6:20726686-20726708 CTCTCTCTTTGAAGAGGAAAAGG + Intronic
1005569121 6:27127459-27127481 CTTTTTTTTTGGAGGGGAAAGGG + Intronic
1005646284 6:27841547-27841569 CTCTTCCTTAAGAGAGGAGAAGG - Intronic
1005677099 6:28165681-28165703 CCTTTTCTTAGGAGAGGTGAGGG + Intergenic
1006195580 6:32239778-32239800 ATGTTTCTTTTTAGAGGAAATGG + Intergenic
1006422919 6:33946661-33946683 CTCTTTCTTGGGAAAGGAGTGGG - Intergenic
1007147817 6:39654225-39654247 CTGTTTCTTTGAAGATAAAATGG + Intronic
1007190409 6:40011771-40011793 TTCTTTCTCTTGAGAGGAGAAGG - Intergenic
1007756471 6:44102802-44102824 CTGTTCCTGTGGAGGGGAGCTGG - Intergenic
1008396894 6:51019293-51019315 CTAATTCTTATGAGAGGAGATGG + Intergenic
1008961005 6:57265305-57265327 CCTTTTATTTGGGGAGGAGAAGG + Intergenic
1009289251 6:61864162-61864184 GTGTTTCTTTGAATATGAGATGG + Intronic
1009422351 6:63477848-63477870 CTTTTTGTTTGCAGAGGAGGAGG + Intergenic
1009933825 6:70208467-70208489 TTGTTTCTTTTCAGAGGACATGG - Exonic
1010754351 6:79650050-79650072 CTTTTTCTTTGGAGTCAAGATGG + Intronic
1011033803 6:82951818-82951840 CTCTTTCTTTTGAGACTAGATGG - Intronic
1011174331 6:84543073-84543095 CTGTGTCTTTGTACATGAGATGG - Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011518189 6:88175239-88175261 CTGTTCCTTTGGAGTGCACAAGG - Intergenic
1011658103 6:89569886-89569908 TTGTTTCTTTGGAGTGTAAATGG - Intronic
1012248273 6:96951853-96951875 CTGTTTCTTTAGATAGCAGCAGG + Intronic
1012678996 6:102154407-102154429 CTTTGCCTTTGGAAAGGAGAGGG + Intergenic
1012922178 6:105231890-105231912 ATGTGTCTTTGCACAGGAGATGG + Intergenic
1013174216 6:107663571-107663593 CAGTTTCTTTGGCTATGAGACGG - Intergenic
1013366958 6:109443930-109443952 CTTTTTCCTTGTAGAGGCGATGG + Intergenic
1015122117 6:129711201-129711223 TTTTTTTTTTGGAGGGGAGATGG - Intergenic
1016825637 6:148386131-148386153 CTGCTTCTTTGGAGTGTGGAGGG + Intronic
1016885633 6:148956953-148956975 GTGTTTCTTCGGGGAGGTGAGGG + Intronic
1017098929 6:150830624-150830646 CTATTTCTCTGGGCAGGAGACGG - Exonic
1017523359 6:155221482-155221504 CTGTTTCAATGGAGAGAAAAAGG - Intronic
1018222788 6:161597618-161597640 CTCTCTCTCTGGAGTGGAGAAGG + Intronic
1018345042 6:162891512-162891534 CTGTCTCATTGGAGCTGAGATGG - Intronic
1019293257 7:260796-260818 GTTTTTCTTTGGAGAGGGGGTGG - Intergenic
1019713498 7:2528014-2528036 CTGTTTTTTTTGAAAGGGGATGG + Exonic
1019763272 7:2830124-2830146 CTGTTTCTTTCTAGATGGGAAGG + Intronic
1021129868 7:16898846-16898868 GTGTGTCTTTGCAGATGAGATGG + Intergenic
1021544127 7:21794261-21794283 TTGTTTATTTGGAGAGGTCATGG + Intronic
1021846041 7:24763522-24763544 TTGTGTCATTGGAGAGGACAGGG + Intergenic
1023044054 7:36196584-36196606 CTGTTTCTTTGGTGGGGACGGGG + Intronic
1023679076 7:42665138-42665160 CTGTTGCTTTGGGGAGTAGTAGG - Intergenic
1026513458 7:71046758-71046780 CTGTTTCTCTGGGGCAGAGAGGG + Intergenic
1026877987 7:73890633-73890655 CTTTGTCGGTGGAGAGGAGACGG - Intergenic
1027978483 7:85186943-85186965 CTGGAGCTTTGGGGAGGAGAGGG + Intergenic
1028490880 7:91410264-91410286 TTGTTTCTTTTGAGGGCAGAAGG - Intergenic
1029801701 7:102954646-102954668 CTGTGTCTTTGCACATGAGATGG - Intronic
1029994150 7:104990248-104990270 GTGTTTCACTGGATAGGAGATGG - Intergenic
1030612401 7:111704107-111704129 CTGTGTCTTTGCACATGAGATGG + Intergenic
1030702840 7:112660445-112660467 CTGTGTCTTTGCACATGAGATGG + Intergenic
1030892443 7:115015797-115015819 CTGTTGCTGTGGTGACGAGATGG + Exonic
1031130694 7:117830020-117830042 CTGTTTCTATGGAATGGAGTAGG - Intronic
1031683892 7:124709058-124709080 CTCTGTCTTTGGAGAGAGGAAGG + Intergenic
1032027807 7:128457234-128457256 CTGTTTCTCTGCAGAGGAGTAGG + Exonic
1032212579 7:129929399-129929421 CTTTTTGTGTGGAGAGGAGAAGG - Intronic
1032672806 7:134100460-134100482 CTGTATCTTTAGAGATGAAAAGG + Intergenic
1033121057 7:138666903-138666925 CTTTCTCTTGGAAGAGGAGAAGG - Intronic
1033840716 7:145370395-145370417 ATGATTCTTTGGGGATGAGAAGG - Intergenic
1034684581 7:152958951-152958973 CTTTTTCTCTGCAGGGGAGATGG - Intergenic
1035309635 7:157957255-157957277 CTGTTGCTGTGGAGAGGGGATGG - Intronic
1035693093 8:1572586-1572608 CTGCTGGTATGGAGAGGAGAGGG + Intronic
1035698611 8:1620944-1620966 TTGTTTGTCTGGAGAGCAGAGGG - Intronic
1037086686 8:14860062-14860084 CTGTTTCTTTAAAGTGGAGAGGG - Intronic
1037164661 8:15812022-15812044 CTATTTCTTTGGAGAATAAAAGG - Intergenic
1037281417 8:17246702-17246724 CTGTCTCTATGGCGAGGAGGAGG - Exonic
1037363226 8:18095888-18095910 CTGATTTTTTGGAGATTAGATGG - Intergenic
1037576477 8:20209311-20209333 CTGTGTCTGTGAAGAGTAGAGGG + Intronic
1037686279 8:21142188-21142210 CTGTCTATTTGGAGAGCAGGTGG - Intergenic
1039110066 8:34032088-34032110 TTCTTTCTTTGAAGAGGAGAAGG + Intergenic
1039403667 8:37294511-37294533 CGGCATCTTGGGAGAGGAGAGGG - Intergenic
1041055936 8:53986001-53986023 TTGTTTTCTTGGAAAGGAGAGGG - Intronic
1041154069 8:54965750-54965772 CTGCTGCTTGGGAGAGGTGAAGG - Intergenic
1041725887 8:61017066-61017088 CTGTCTTTTTGGAGAGAAGCAGG - Intergenic
1041989310 8:63966802-63966824 CTGTTTCTTTTGTTTGGAGAGGG + Intergenic
1042194096 8:66217144-66217166 TTCTTTCTTTGGAGAGTATATGG + Intergenic
1042470437 8:69181375-69181397 TTGTTTCTTTTGAGAAGAGATGG - Intergenic
1042473339 8:69216259-69216281 GTGTGTCTTTGGACATGAGATGG - Intergenic
1042813561 8:72852980-72853002 CTCTTTTTCTGGAGGGGAGAGGG + Intronic
1043305341 8:78786892-78786914 CAGCTTCTGGGGAGAGGAGAGGG + Intronic
1043583786 8:81743857-81743879 CTGTCTCTCTGGAGAAGAGAGGG + Intronic
1043627045 8:82274093-82274115 CTGTGCCTTTGGAAAGGGGAGGG + Intergenic
1043813740 8:84775547-84775569 CTGTCTCTCTGGAGAAGAGAAGG - Intronic
1044007826 8:86959907-86959929 TTGTTCCTTTGGAGAGAAGAGGG + Intronic
1044347938 8:91128237-91128259 TTCTTTCTTTAGAGATGAGAAGG - Intronic
1044594992 8:93950851-93950873 GTGTGTCTTTGCAGATGAGATGG + Intergenic
1044864612 8:96558228-96558250 CTGATTCTTGGGAAAGGAGAGGG + Intronic
1045151559 8:99414306-99414328 GTGTGTCTTTGGACATGAGATGG + Intronic
1045415919 8:101967509-101967531 CTGTCTCTTTGCAGAGGAGAAGG + Intronic
1045507781 8:102790863-102790885 CTATTCCTTTGGAGAAAAGATGG - Intergenic
1046169464 8:110485981-110486003 CTCTACCTTTGGAAAGGAGAGGG + Intergenic
1046416988 8:113929642-113929664 ATGTGTCTAGGGAGAGGAGAAGG + Intergenic
1047097925 8:121643495-121643517 CTCTTTCTTTGGGGTAGAGATGG - Intergenic
1047403302 8:124563820-124563842 ATGTTTCTTTTGAGTGGAGATGG - Intronic
1049858219 8:144877577-144877599 CTTTCTCCTTGGAGAGGAGGAGG + Exonic
1050866213 9:10503496-10503518 ATGTTTAATTGGAGAAGAGAGGG + Intronic
1051031160 9:12680796-12680818 TTGTTTCTTTGAAGTGGAAAAGG - Intergenic
1052283102 9:26754921-26754943 ATGCTTCTGTGGAGAGGAAAGGG + Intergenic
1053311601 9:37024316-37024338 TAGCTTCTTTGGAGAGGAGCAGG - Intronic
1055777404 9:79781345-79781367 TTGCTTCTTTGGAGAAGGGAGGG - Intergenic
1055884343 9:81042133-81042155 CTGTTTTTATGCAGAGGGGATGG - Intergenic
1055998182 9:82184738-82184760 CTGTTGTTTTGAAGATGAGAGGG + Intergenic
1056835259 9:89949852-89949874 TTGTTTGTTTGGGGAGGGGAGGG - Intergenic
1057038519 9:91830638-91830660 TTGTTTATTTGCAGAGGAAATGG + Intronic
1057857707 9:98614721-98614743 TTGTTTCTGTGGAGGGAAGAAGG + Intronic
1058040473 9:100296401-100296423 CTGTGTCTTTGGTGACGAAAGGG - Intronic
1058555726 9:106164465-106164487 CATTGTTTTTGGAGAGGAGAGGG + Intergenic
1058627274 9:106948012-106948034 CTATAACTTTGGATAGGAGAAGG + Intronic
1058803669 9:108569073-108569095 CTGAGTCTTTGGAGATGAGCAGG + Intergenic
1058850141 9:109003805-109003827 TTGTGACTTTGGAGAGGATATGG + Intronic
1059515445 9:114889893-114889915 CCCTATCTTTGGAAAGGAGAGGG + Intergenic
1060898430 9:127235777-127235799 CTGTTTCTTTGGAACAGTGAGGG + Intronic
1061915531 9:133751256-133751278 CTCTGCCTTTGGAAAGGAGAGGG - Intergenic
1062134270 9:134916453-134916475 GTGTTTCTCTGCAGAGGTGAAGG - Exonic
1062571360 9:137187031-137187053 TTGTTAGTTTGGAGAGGAGAGGG - Intronic
1187659481 X:21524670-21524692 CTTTTTGTTTGGGGAGAAGAAGG + Intronic
1188048402 X:25454491-25454513 CTGTGTGTTTGGTGAGGAGATGG - Intergenic
1188122485 X:26326170-26326192 CTGTTTCTATGGAGTGTAAAGGG + Intergenic
1188839704 X:35001356-35001378 CTGTTACTTACGAGAGAAGATGG - Intergenic
1189721118 X:43919648-43919670 ATATTACTTTGGGGAGGAGAAGG - Intergenic
1189840835 X:45075091-45075113 CTGTCTTTTAGGAAAGGAGATGG - Intronic
1190256102 X:48763504-48763526 CTTTTTTTTTGTAGAGGTGAGGG - Intronic
1190784118 X:53627195-53627217 CTAGTTCTTTGGAGTAGAGATGG - Intronic
1191829630 X:65402224-65402246 CTCTTCCTTTGGAAAGGAGAAGG + Intronic
1192538340 X:71947525-71947547 CTGATGCTTTGAAGAGGAAAAGG + Intergenic
1192667294 X:73101443-73101465 CTCTGCCTTTGGAAAGGAGAAGG - Intergenic
1192716654 X:73649451-73649473 CTGTGTCTTTGCACATGAGATGG - Intronic
1192927855 X:75775767-75775789 CTGTTTCTTTGGAAAGCATTGGG + Intergenic
1193078725 X:77383058-77383080 CTTTGTCTTTGGAAAGGGGAAGG + Intergenic
1193217178 X:78877126-78877148 GTGTTTCTTTGCACATGAGATGG - Intergenic
1193442163 X:81556186-81556208 TTGGTTCTTTGTAGTGGAGAAGG - Intergenic
1193664645 X:84300490-84300512 CTGTGCCTTTGGAAAGGGGAGGG + Intergenic
1193701525 X:84768235-84768257 CTGTATCTTTGGGTAGAAGACGG - Intergenic
1193886993 X:86994519-86994541 CTCTTTCTTTGGAAAGGAGAGGG + Intergenic
1194229668 X:91306788-91306810 CTCTTTCTTTATAAAGGAGAGGG - Intergenic
1194265004 X:91743102-91743124 CTCTGCCTTTGGAAAGGAGAGGG - Intergenic
1194602550 X:95940510-95940532 CTGTTGCTTTTGAGAGGGGTGGG - Intergenic
1195979123 X:110559322-110559344 GTGTTTCTTTGCACATGAGATGG + Intergenic
1196508365 X:116476324-116476346 TTCTGTCTTTGGAGAGGGGAAGG - Intergenic
1197633313 X:128886880-128886902 CTGTTTTATTGGAGAAGTGAAGG - Intergenic
1197767067 X:130066270-130066292 TAGTTTCTTTGGGGAGGACAGGG - Exonic
1197775357 X:130115158-130115180 CAGGTTCTTTGGAGATGAGGTGG + Intergenic
1198295637 X:135283755-135283777 AGGTTTCTTGGGAGTGGAGAAGG + Intronic
1198645270 X:138799961-138799983 CTGTTTCTTTGTACATGAGATGG + Intronic
1198788237 X:140314141-140314163 CTCTGCCTTTGGAAAGGAGAAGG + Intergenic
1199608416 X:149594392-149594414 CAGTTTCTGTGGAAAGGGGAGGG + Exonic
1199630704 X:149774968-149774990 CAGTTTCTGTGGAAAGGGGAGGG - Exonic
1200582154 Y:4963548-4963570 CTCTGCCTTTGGAAAGGAGAGGG - Intergenic
1200741807 Y:6862328-6862350 GTGTGTCTTTGCATAGGAGATGG + Intergenic
1201543490 Y:15134506-15134528 GTGTTTCTTTGCACATGAGACGG - Intergenic