ID: 949962609

View in Genome Browser
Species Human (GRCh38)
Location 3:9325620-9325642
Sequence ATGTCCTTCTAGACGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 14, 2: 32, 3: 48, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949962607_949962609 1 Left 949962607 3:9325596-9325618 CCTGGGAAAAGGGCCTAACAAAT 0: 1
1: 0
2: 2
3: 10
4: 152
Right 949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG 0: 1
1: 14
2: 32
3: 48
4: 72
949962606_949962609 8 Left 949962606 3:9325589-9325611 CCTAAATCCTGGGAAAAGGGCCT 0: 1
1: 0
2: 1
3: 24
4: 233
Right 949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG 0: 1
1: 14
2: 32
3: 48
4: 72
949962602_949962609 18 Left 949962602 3:9325579-9325601 CCTCTTTCATCCTAAATCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 176
Right 949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG 0: 1
1: 14
2: 32
3: 48
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949962609 Original CRISPR ATGTCCTTCTAGACGAGTGA AGG Intronic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910062388 1:83109617-83109639 ATTTCCATCTAGACAAGTAAAGG - Intergenic
910809643 1:91223092-91223114 ATCCCCTTTTAGAAGAGTGAAGG - Intergenic
916177279 1:162053017-162053039 ATTTCTTTCTGGACCAGTGAAGG + Intergenic
916567043 1:165990026-165990048 ATGTCCTTCTATAAGTGAGAGGG + Intergenic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918834412 1:189442132-189442154 ATGTCCTACTATACCACTGATGG - Intergenic
920144450 1:203846460-203846482 ATTTCCTTGTAGACAAGTGTAGG + Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1068170338 10:53384606-53384628 ATATCCTTCTAAACAAGTGAGGG - Intergenic
1071790936 10:88953242-88953264 ATGTATTTATAGACGACTGAAGG - Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1080604001 11:33848949-33848971 ATGTCGTTTTAGAGGAGGGAGGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1086163427 11:83749110-83749132 AGGTCCTTCTAGACTTGTGCAGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1089524867 11:119090266-119090288 GTATCCTTTTAGAAGAGTGACGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098502563 12:71210505-71210527 GTGTCCTTCTAGAAGAATAAAGG - Intronic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1100793775 12:98158527-98158549 ATGTCCAGATAGACAAGTGAGGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101526197 12:105533358-105533380 ATGTCCACCTACACTAGTGAGGG + Intergenic
1106624385 13:31405578-31405600 ATGGACTTTTAGAAGAGTGAAGG - Intergenic
1109860162 13:68187779-68187801 ATGTCATTCTAGAGGAGAGAAGG + Intergenic
1110960105 13:81610618-81610640 ATGCCCTTCTAAAAAAGTGAAGG - Intergenic
1111106918 13:83657407-83657429 AAATCCTTCCAGACAAGTGAGGG - Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116725624 14:48558391-48558413 ATACCCTTATAGAAGAGTGAAGG + Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1121427407 14:93862347-93862369 ATCTCCTTCTAGAGAGGTGATGG + Intergenic
1122076001 14:99234995-99235017 AAGTCCCTCTAGAAGAGAGACGG - Intronic
1127398804 15:58564939-58564961 ATGGCCTTCGCGACAAGTGAAGG - Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1134829539 16:17312078-17312100 AAGGCCTTCTAGAAGAGTCAAGG + Intronic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1149973487 17:61242545-61242567 ATGTCCTTCTAAATGGGAGAAGG - Intronic
1153232026 18:2947373-2947395 TTGTCCTTCTAGAGGATGGATGG - Intronic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1162229779 19:9256542-9256564 ACATCCTTCTAGAATAGTGATGG - Intergenic
1164422102 19:28103446-28103468 ATGTCCTTCTAGAGCTGAGATGG + Intergenic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
929428940 2:41870659-41870681 ATGTCCTTCAAGAAGAGTTTAGG + Intergenic
929823293 2:45290492-45290514 ATGACCTGCTAGATGAGAGAGGG + Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
939210352 2:139166863-139166885 ATGTGCTTCTATACGGGGGATGG - Intergenic
939250112 2:139671910-139671932 ATCAACTTCTTGACGAGTGAGGG + Intergenic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171330988 20:24338831-24338853 AAGACATTCTAAACGAGTGAAGG + Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1175055913 20:56198012-56198034 GTTTCCTTCTAGTTGAGTGAGGG + Intergenic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177411374 21:20734352-20734374 ATGGCTTTCTAGTCGAGTGAAGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
950447103 3:13044694-13044716 ATGTCCTTCTCCAGGAGTGTGGG - Intronic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
960969412 3:123129006-123129028 CTGTCCATCTACACGAGGGAGGG - Intronic
962146686 3:132847029-132847051 ATGTCCTTGTAGAGGTATGATGG - Intergenic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
973813874 4:54600250-54600272 ATATCCTTCTACAGGACTGAAGG + Intergenic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
974449556 4:62035434-62035456 ATTTCCTTCTAGATGAGAAAGGG - Intronic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981201305 4:141982806-141982828 ATATCCTTTTAGAAGATTGAAGG - Intergenic
986194339 5:5524363-5524385 ATGTGCTTGTAGACGTGTGTGGG - Intergenic
987624371 5:20378453-20378475 ATGTCCACCTAGACCAGTGCTGG - Intronic
987682177 5:21151221-21151243 ATGTCCTTCTTTATGAGGGATGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990082002 5:51928480-51928502 ATGCCCTTCTAGAAGATCGAAGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
994172070 5:96668885-96668907 GTGTCCCTCTAGACTAGGGATGG - Intronic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006506575 6:34492802-34492824 ATGGACTTCTAGAGGAGGGAAGG + Intronic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1019140948 6:169942041-169942063 ACGTCCTTCCAGAAAAGTGAGGG - Intergenic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1043827090 8:84942282-84942304 ATGTCCTTCTAAAGGAGTGAAGG - Intergenic
1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG + Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051119509 9:13736716-13736738 GTGTCCTTCTAGAGCACTGAAGG + Intergenic
1052037469 9:23699056-23699078 ATGTCTTTCTATAGGAGTGAAGG + Intronic
1052399418 9:27981684-27981706 TTGTCCATCTAGATTAGTGAAGG + Intronic
1055685828 9:78773693-78773715 ATCTCTTTTTAGAGGAGTGAGGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1058047265 9:100369934-100369956 ATGTCCATCCAAAAGAGTGAAGG - Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187852637 X:23606362-23606384 ATGTCCTTGTAGACAAGGGTGGG + Intergenic
1190521459 X:51282131-51282153 ATGACCTTCTATACGTGGGAGGG - Intergenic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1193365714 X:80629857-80629879 ATCTCCTTCTTGAGGAGTCAAGG - Intergenic
1194414401 X:93592606-93592628 AGGTCCTTCTAGTCTAGTGGAGG - Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1197934465 X:131726602-131726624 ATGCCCTTTGAGAAGAGTGAAGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic