ID: 949966757

View in Genome Browser
Species Human (GRCh38)
Location 3:9363198-9363220
Sequence CGGCCTCAACTGCAAGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949966757_949966763 0 Left 949966757 3:9363198-9363220 CCTTCCTCTTGCAGTTGAGGCCG 0: 1
1: 0
2: 1
3: 8
4: 112
Right 949966763 3:9363221-9363243 GCGCCGAGCCGGACTTCAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 49
949966757_949966766 9 Left 949966757 3:9363198-9363220 CCTTCCTCTTGCAGTTGAGGCCG 0: 1
1: 0
2: 1
3: 8
4: 112
Right 949966766 3:9363230-9363252 CGGACTTCAGGCGGATCTCGTGG 0: 1
1: 0
2: 0
3: 1
4: 29
949966757_949966762 -3 Left 949966757 3:9363198-9363220 CCTTCCTCTTGCAGTTGAGGCCG 0: 1
1: 0
2: 1
3: 8
4: 112
Right 949966762 3:9363218-9363240 CCGGCGCCGAGCCGGACTTCAGG 0: 1
1: 0
2: 0
3: 0
4: 42
949966757_949966767 12 Left 949966757 3:9363198-9363220 CCTTCCTCTTGCAGTTGAGGCCG 0: 1
1: 0
2: 1
3: 8
4: 112
Right 949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949966757 Original CRISPR CGGCCTCAACTGCAAGAGGA AGG (reversed) Exonic
916250700 1:162735023-162735045 TGGACTCAACTGCAGGAGGTAGG + Intronic
917802142 1:178580833-178580855 CGGCCTCAAAGACCAGAGGAGGG - Intergenic
921261944 1:213392335-213392357 CGGTCTCAACTGGTAGAGGCTGG + Intergenic
921874315 1:220176901-220176923 ATTCCTCAACTGCAACAGGAGGG - Intronic
922137690 1:222847642-222847664 AGGTTTCCACTGCAAGAGGAGGG - Intergenic
1064234534 10:13562064-13562086 GGGCCTCAACTGCCAAAGGCAGG - Intergenic
1070829285 10:79408767-79408789 CAGCCTAAACTGCAAAAGGTGGG + Intronic
1070933190 10:80274973-80274995 GGTCCTCCACTGCAACAGGACGG + Intronic
1071904827 10:90161303-90161325 CTGCCTCAAGATCAAGAGGAAGG - Intergenic
1074998882 10:118780552-118780574 AGGCCTCAAGTTCAAGAGCAAGG - Intergenic
1075786768 10:125055314-125055336 TGGCCTCAACTGCAACACAAGGG + Intronic
1076294693 10:129375430-129375452 CTCACTCCACTGCAAGAGGAAGG - Intergenic
1076539981 10:131207690-131207712 GGGCCTCTGCAGCAAGAGGAGGG + Intronic
1076688726 10:132209869-132209891 TGGCCTCAGCTGCAGGAGGTGGG - Intronic
1076887324 10:133268682-133268704 CGTGCTCAGCTGCCAGAGGAAGG - Intronic
1077088653 11:767654-767676 AGTCCTCACCTGCAAGGGGATGG + Exonic
1077497089 11:2891616-2891638 CCTCCTCCACTGCAGGAGGAGGG + Intronic
1080503221 11:32889174-32889196 CTTCCTCAACTACAAAAGGAAGG + Intergenic
1084241879 11:67826879-67826901 CGGCCACCACAGCAAGAGCATGG + Intergenic
1084830461 11:71764975-71764997 CGGCCTCCATAGCAAGAGCATGG - Intergenic
1087201197 11:95346387-95346409 AGGCCACCACTGCCAGAGGATGG - Intergenic
1097454168 12:59775462-59775484 CGTTCTTACCTGCAAGAGGAGGG - Exonic
1097998200 12:65913419-65913441 GGGCTTCAACTGCAACAAGAAGG - Intronic
1100671654 12:96819842-96819864 AGTCTTCAACTGCAACAGGAGGG - Intronic
1102303537 12:111788323-111788345 CAGCCTCGACTGCGAGGGGAAGG + Intronic
1102678008 12:114671722-114671744 CAGACGCAACTGCAAAAGGAAGG + Exonic
1104801261 12:131556504-131556526 CAGCCTCAACAGCAATAGGCAGG + Intergenic
1106962472 13:35014912-35014934 CAGGCTCATCTGCAAGAAGATGG + Intronic
1108429603 13:50340806-50340828 CGGCCTCAGCTCCTTGAGGAAGG + Intronic
1108609374 13:52069274-52069296 CAGCATCAACTGGAAGAGAAAGG - Intronic
1114296441 14:21333778-21333800 CTGTCTCAACTGAAAGAGTACGG - Intronic
1115224137 14:31085904-31085926 CACCCTCAACTGCAATAGAAGGG - Exonic
1116284414 14:42953530-42953552 TGGACTCAAATCCAAGAGGATGG + Intergenic
1124099575 15:26680946-26680968 CTGCTACAATTGCAAGAGGAAGG - Intronic
1124624441 15:31300049-31300071 ATGCATCAACTGCAAGAGAAAGG + Intergenic
1129109645 15:73329984-73330006 CTGCCCCCATTGCAAGAGGAAGG - Intronic
1130785128 15:87087496-87087518 AGGCCTCAGCTGGAATAGGATGG + Intergenic
1133122348 16:3617606-3617628 AGGCCTCAACCGCAAGGTGATGG + Intronic
1135485874 16:22864148-22864170 CAGCCTCAACTGAAAGGGCAGGG - Intronic
1135905563 16:26508692-26508714 AGGCCTCAATTCCAATAGGATGG + Intergenic
1136579994 16:31145690-31145712 AAGCCTCATCTGCAAAAGGAGGG - Intronic
1138062767 16:53909111-53909133 CAGACTCTACTGGAAGAGGATGG - Intronic
1138458312 16:57133622-57133644 GGTCCTCAGCTGCAGGAGGAGGG - Intronic
1138518024 16:57549240-57549262 GAGCCTCATCTGCAAGGGGACGG - Intronic
1141807247 16:86349816-86349838 AGGCCTCAACTGAATGAGCAGGG - Intergenic
1142054091 16:87981374-87981396 CGGCCGCAACATGAAGAGGAAGG - Intronic
1143082009 17:4388805-4388827 GGGCCTCATCTGCAAGAAGAGGG - Intergenic
1150125665 17:62632905-62632927 CTGCCTCATCTACAGGAGGAAGG - Intronic
1150531348 17:65985791-65985813 ATGCCTCATCTTCAAGAGGATGG - Intronic
1151574806 17:74947409-74947431 CCACCTCAACTGGAAGCGGAGGG + Exonic
1152124492 17:78438179-78438201 AGCCCTCAGCTTCAAGAGGAGGG - Intronic
1203177112 17_KI270729v1_random:27034-27056 TGGCCTCAAATGCAATAGAATGG + Intergenic
1153285766 18:3452596-3452618 CGGCCTCAAGTGAAACAGGCCGG - Intronic
1153835048 18:8956120-8956142 AGGCCACAACTGCAAGAGTGAGG - Intergenic
1156533953 18:37845150-37845172 GTGCCTCAACTCCAAAAGGAAGG - Intergenic
1163005858 19:14396328-14396350 CGTCCACATCTGCAAGAGGAAGG - Exonic
1163061885 19:14767101-14767123 CGTCCACATCTGCAAGAGGAAGG + Exonic
1164817884 19:31220217-31220239 CGGCTGCAACTTTAAGAGGAAGG + Intergenic
1165374303 19:35430921-35430943 TGGATTCAACTGCAGGAGGACGG + Intergenic
1167506789 19:49875167-49875189 GGGCCACAACTGGAAGAGGCAGG + Intronic
925920251 2:8633240-8633262 CTGCCCCACCTGCCAGAGGAAGG + Intergenic
926241572 2:11092937-11092959 CGGGCTCCACTGCACGAGGAGGG - Intergenic
926324820 2:11776113-11776135 CGGCCGCAACTGCAAGATGAGGG - Exonic
928320397 2:30278718-30278740 AGTCCTCTACTGCAACAGGAGGG - Intronic
928679102 2:33680752-33680774 AGGCCTCCACTGCAGGTGGAGGG + Intergenic
935216650 2:100980247-100980269 CCGCCTCCACTGCAGGTGGAAGG + Intronic
936151251 2:110023488-110023510 GGGCCTCAGCTGCTAGCGGACGG + Intergenic
936159121 2:110070785-110070807 CGGCCCCAGCTGGAAGTGGAGGG - Intergenic
936185540 2:110300547-110300569 CGGCCCCAGCTGGAAGTGGAGGG + Intergenic
936193424 2:110347881-110347903 GGGCCTCAGCTGCTAGCGGACGG - Intergenic
937460758 2:122083680-122083702 CAGCCTCCACTCCAAGAGGAGGG - Intergenic
938482239 2:131672154-131672176 CGGCCCCAGCTGCAGGAGGGCGG - Intergenic
938971357 2:136436054-136436076 CTGCATCAACTTCAAGAAGAAGG + Intergenic
940342371 2:152594941-152594963 AGAGCTCAACTGCAAGATGAAGG - Intronic
940888301 2:159010495-159010517 CGGCCTCCACTTCAAGAGTGAGG - Intronic
943794446 2:191974306-191974328 CAGACTCAACTGAAAGAAGAAGG - Intronic
1171361772 20:24590899-24590921 CGGACTCCAGAGCAAGAGGAAGG + Intronic
1179048812 21:37871074-37871096 AGCCCTCAACATCAAGAGGAGGG - Intronic
1179511419 21:41876588-41876610 GGGCCATGACTGCAAGAGGAGGG + Intronic
1179660058 21:42868619-42868641 TGGCCTCATCTCCAAGAGTAGGG + Intronic
1180825463 22:18858054-18858076 CTGCCTCAAATGCCAGGGGAGGG - Intronic
1181187269 22:21116493-21116515 CTGCCTCAAATGCCAGGGGAGGG + Intergenic
1181211929 22:21294000-21294022 CTGCCTCAAATGCCAGGGGAGGG - Intergenic
1181397566 22:22632886-22632908 TGGCCTCAAATGCCAGGGGAGGG + Intergenic
1181651838 22:24263172-24263194 CTGCCTCAAATGCCAGGGGAGGG - Intergenic
1181705538 22:24647567-24647589 TGGCCTCAAATGCCAGGGGAGGG + Intergenic
1181851036 22:25750150-25750172 GGGCCTGAACTGTCAGAGGAGGG + Intronic
1183316314 22:37138936-37138958 CGGCCTTGAATGCCAGAGGAAGG + Intronic
1184879941 22:47298298-47298320 AGGTCTCACCTGCAGGAGGATGG - Intergenic
1203215025 22_KI270731v1_random:1432-1454 CTGCCTCAAATGCCAGGGGAGGG + Intergenic
1203275611 22_KI270734v1_random:83957-83979 CTGCCTCAAATGCCAGGGGAGGG - Intergenic
949966757 3:9363198-9363220 CGGCCTCAACTGCAAGAGGAAGG - Exonic
950720402 3:14878376-14878398 AGGCCTTAACTGCAAAATGAAGG - Intronic
951459711 3:22937533-22937555 CTGCCTCAACTACTAGGGGAAGG - Intergenic
966921065 3:184611665-184611687 CTTCCTCAACTTCAAGAGCAAGG - Intronic
971378729 4:26077279-26077301 TGGCCTGAGCTGTAAGAGGAAGG + Intergenic
975507597 4:75156477-75156499 GTTCTTCAACTGCAAGAGGAGGG + Intergenic
985539783 5:482539-482561 GGGCCTCACCTGGAAGATGACGG + Exonic
987877432 5:23696777-23696799 CTGCTTCAATTGCAGGAGGATGG - Intergenic
998616669 5:143748107-143748129 CGGCCACATGTGCAAGAGGTTGG + Intergenic
999257255 5:150216592-150216614 GGGCCTCAACTGGAGGTGGAGGG - Intronic
999330464 5:150670568-150670590 CTGCCTCTTCTGGAAGAGGAGGG - Exonic
1000463404 5:161548159-161548181 CGGCCTGAGCTTCAGGAGGAAGG - Intronic
1006912411 6:37571967-37571989 CAGCCTCAGCTGCCAGAGGAAGG + Intergenic
1011103906 6:83757944-83757966 GTACCTCAACTGCAACAGGAGGG + Intergenic
1019403825 7:872068-872090 AGGCCTCACCAGCAGGAGGAGGG - Intronic
1022118455 7:27283431-27283453 AGACCTCATCTGGAAGAGGAAGG - Intergenic
1035455581 7:159006596-159006618 CGGCTTCCACAGGAAGAGGACGG + Intergenic
1035727804 8:1835346-1835368 CGGCCTCAGCTGCACAGGGACGG - Intronic
1036797431 8:11766456-11766478 GGGCCTCAGCTCCAAAAGGATGG - Intergenic
1037089592 8:14897411-14897433 CGGCATCAAGTTTAAGAGGAAGG - Intronic
1041912391 8:63102793-63102815 CCCACCCAACTGCAAGAGGAGGG - Intergenic
1049258852 8:141628081-141628103 CGTCCTCAACTGTAAAACGATGG - Intergenic
1051265544 9:15306224-15306246 CGGTCTCAACTTCAAGAGCAGGG + Intronic
1053070828 9:35101003-35101025 TGGCCTCTCCTGCAAGAGAAGGG + Exonic
1058139306 9:101341060-101341082 AGGCCTCACCTCCAAGAGTAGGG + Intergenic
1062610303 9:137370481-137370503 CGACCTCTGCTGCCAGAGGATGG + Intronic
1203352835 Un_KI270442v1:95416-95438 TGGCCTCAAATGCAATAGAATGG + Intergenic
1186827476 X:13354774-13354796 TGGCCTCCACAGCAAGAGGAAGG - Intergenic
1189850440 X:45171673-45171695 TGGCCTAAACTGGGAGAGGAAGG - Intronic
1198156928 X:133970130-133970152 CTGCCTAAACAGCAACAGGAAGG - Intronic
1199214426 X:145249277-145249299 GGGGCTCAACTGCTAGAGGTTGG + Intronic