ID: 949966759

View in Genome Browser
Species Human (GRCh38)
Location 3:9363202-9363224
Sequence GCGCCGGCCTCAACTGCAAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949966759_949966762 -7 Left 949966759 3:9363202-9363224 CCTCTTGCAGTTGAGGCCGGCGC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 949966762 3:9363218-9363240 CCGGCGCCGAGCCGGACTTCAGG 0: 1
1: 0
2: 0
3: 0
4: 42
949966759_949966767 8 Left 949966759 3:9363202-9363224 CCTCTTGCAGTTGAGGCCGGCGC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG 0: 1
1: 0
2: 0
3: 1
4: 45
949966759_949966766 5 Left 949966759 3:9363202-9363224 CCTCTTGCAGTTGAGGCCGGCGC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 949966766 3:9363230-9363252 CGGACTTCAGGCGGATCTCGTGG 0: 1
1: 0
2: 0
3: 1
4: 29
949966759_949966763 -4 Left 949966759 3:9363202-9363224 CCTCTTGCAGTTGAGGCCGGCGC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 949966763 3:9363221-9363243 GCGCCGAGCCGGACTTCAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949966759 Original CRISPR GCGCCGGCCTCAACTGCAAG AGG (reversed) Exonic
900123610 1:1059773-1059795 GCGCCGGGCTCACCTGCACGAGG - Intergenic
915890428 1:159768258-159768280 CCTCTTGCCTCAACTGCAAGAGG - Intergenic
920184609 1:204152128-204152150 GCGGCGGCCTCAGCTGCCGGCGG - Intergenic
921065560 1:211620033-211620055 GCACCAGGATCAACTGCAAGGGG + Intergenic
1068089152 10:52411148-52411170 GCGCTGCCCTTAACTGCACGCGG + Intergenic
1073560200 10:104489724-104489746 CCGCCTGCCTCAACTAAAAGAGG + Intergenic
1076539979 10:131207686-131207708 GCGCGGGCCTCTGCAGCAAGAGG + Intronic
1077152226 11:1077525-1077547 GCGCCGGCCTCACCCTCATGTGG + Intergenic
1079695577 11:23478081-23478103 GTGCAGCCCCCAACTGCAAGCGG + Intergenic
1085037573 11:73309229-73309251 GCGCCGGCCGCAGCAGCAACAGG + Exonic
1085129788 11:74028441-74028463 ATGCTGGCCTCCACTGCAAGAGG - Intronic
1085423119 11:76380801-76380823 GCGCTGCCCCCAACTGCACGCGG - Exonic
1095561544 12:43572003-43572025 GCGCTGCCCTCAACCGCATGCGG - Intergenic
1100329215 12:93569823-93569845 GCCGCGGCCTCAACTAAAAGTGG + Intronic
1100830919 12:98516028-98516050 CCGCCGGCACCAACAGCAAGGGG + Exonic
1103926533 12:124426558-124426580 GCGCAGGCCTCAACAGGATGGGG + Intronic
1117133257 14:52707018-52707040 GCGCCGGCATACACTGAAAGAGG - Intergenic
1119596659 14:75941202-75941224 GCGCCGGGCACAGCTGCAAGGGG - Intronic
1120993337 14:90397479-90397501 GCTCCGGCCGCAACTGCAGCGGG + Intronic
1123964269 15:25439176-25439198 GCGCCGGCGGCGACGGCAAGCGG - Intergenic
1124458264 15:29864579-29864601 GGGCCGGGTTCAACTGCAAAAGG + Intronic
1136047765 16:27628688-27628710 GCTCCAGCCTCAATTGCACGGGG - Exonic
1139922935 16:70471063-70471085 GCTCAGGCCTCACCTGCAGGTGG - Exonic
1141079269 16:81036197-81036219 GCGTCGGGCTCACCTGCAGGCGG - Exonic
1144570736 17:16396980-16397002 GCTCTGGCCTGAAATGCAAGTGG - Intergenic
1145362871 17:22226754-22226776 GCTCTGGCCTGAAATGCAAGTGG - Intergenic
1154125555 18:11689473-11689495 GCGCCGGCCTGAACTGGGCGCGG + Exonic
1165786723 19:38466136-38466158 GCGCCGGCGTCAGCCGCACGTGG - Exonic
1166072508 19:40395298-40395320 GGGCCGACCTCAAGTTCAAGGGG - Exonic
1168315010 19:55481230-55481252 GCGCCGGCCTCTACTGCGGAGGG + Exonic
948930317 2:241127775-241127797 GCCTCGGCCCCACCTGCAAGGGG + Intronic
1169282160 20:4277184-4277206 GCCCTGGCCTTGACTGCAAGGGG - Intergenic
1171175531 20:23048954-23048976 GCGCCGGGCTCCACAGCCAGTGG + Exonic
1180801905 22:18635902-18635924 GCGCGGTCCCCCACTGCAAGAGG - Intergenic
1181219815 22:21359359-21359381 GCGCGGTCCCCCACTGCAAGAGG + Intergenic
949966759 3:9363202-9363224 GCGCCGGCCTCAACTGCAAGAGG - Exonic
950021731 3:9792487-9792509 GCCCCCGCGTCAACTGCAAGGGG - Exonic
953326278 3:42014264-42014286 GCACCGGCCGCACCTGCAGGAGG + Intronic
955542592 3:59993654-59993676 GCGCCGGCCTCATCAGAAAGTGG - Intronic
956487706 3:69739840-69739862 GCGCGGCCCCCAACTGCGAGGGG - Intronic
968446276 4:653934-653956 GGGCCTACCTCAACTGCGAGCGG + Exonic
968673654 4:1865454-1865476 TGGCCAGACTCAACTGCAAGGGG + Intergenic
971264875 4:25088611-25088633 GCGCCGGCTGCAAATGGAAGTGG + Intergenic
984341292 4:178459861-178459883 GGGCTGGCCTCAGCTCCAAGAGG + Intergenic
1002082062 5:176743224-176743246 ACGCCAGCCACACCTGCAAGCGG - Intergenic
1003925889 6:10877170-10877192 TGGCCGGCCTCAGCTGCAGGCGG + Exonic
1005638734 6:27774943-27774965 GCTCTTGTCTCAACTGCAAGAGG + Intergenic
1005644200 6:27826139-27826161 GCTCTTGTCTCAACTGCAAGAGG + Intergenic
1010506014 6:76660493-76660515 GCACTGCCCCCAACTGCAAGGGG + Intergenic
1019142943 6:169959802-169959824 TCGCCGGCATCCACTGCAGGAGG - Intergenic
1035022380 7:155807225-155807247 GCCCCGGCCTGTGCTGCAAGTGG - Intronic
1038704205 8:29878804-29878826 GAGCCGGCTGCAACTGGAAGGGG + Intergenic
1042118465 8:65458218-65458240 GCCCAGGTCTCAGCTGCAAGAGG + Intergenic
1049718322 8:144104065-144104087 GCACCGGCCACAACTGAAGGCGG + Exonic
1060087136 9:120713745-120713767 GCGCCGGACTCACCTGGAGGAGG + Exonic
1060228721 9:121811896-121811918 GCGCCGGCCACATGTGGAAGTGG - Intergenic
1060985741 9:127818084-127818106 GGGCCGGCCCCAGCTTCAAGTGG - Intronic
1062212865 9:135373957-135373979 GCCCTGGCCTCAGCTGCAGGAGG - Intergenic
1186961343 X:14739990-14740012 GCCCTGGGCTCTACTGCAAGAGG - Intergenic