ID: 949966761

View in Genome Browser
Species Human (GRCh38)
Location 3:9363218-9363240
Sequence CCTGAAGTCCGGCTCGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949966761_949966769 17 Left 949966761 3:9363218-9363240 CCGGCGCCGAGCCGGACTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 62
Right 949966769 3:9363258-9363280 CCCATCTTGCTCCCTCTCCCAGG 0: 1
1: 1
2: 22
3: 145
4: 830
949966761_949966767 -8 Left 949966761 3:9363218-9363240 CCGGCGCCGAGCCGGACTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 62
Right 949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949966761 Original CRISPR CCTGAAGTCCGGCTCGGCGC CGG (reversed) Exonic
903907462 1:26696684-26696706 CTTCAGGTCCGGCTCCGCGCCGG - Exonic
904209016 1:28873562-28873584 GCTGAAGTCCAGCTCAGGGCAGG + Intergenic
915238279 1:154501861-154501883 CCTGAAGACCGTGTCGGAGCGGG - Exonic
917717798 1:177755677-177755699 CCTGCAGTCCGCCTCTGCACAGG + Intergenic
919837509 1:201585145-201585167 CCTGAAGTCAGGCACTGGGCTGG + Intergenic
922680714 1:227593071-227593093 CCTGAAGTCCGGCACCCTGCGGG - Intronic
1071283033 10:84120097-84120119 CCTGAAGTCTGGCACCCCGCGGG - Intergenic
1076874040 10:133207304-133207326 CCTGCAGGCCGGCACGCCGCTGG + Exonic
1081676779 11:44974571-44974593 CCTGGAGTCTGGCTCAGCCCTGG - Intergenic
1081794383 11:45809567-45809589 CCTGAAGTCCAGATCGGTCCAGG - Intronic
1083301068 11:61739841-61739863 CCTGGAGTCCTGCTCAGGGCTGG - Intronic
1087712180 11:101567047-101567069 GCTGAAGTCTGGCTCGGGGCGGG + Intronic
1095997976 12:48105712-48105734 CCCCAAGTACGGCTGGGCGCTGG + Exonic
1103764165 12:123269985-123270007 CCTGAAGTCCTGTTCTGGGCTGG - Intronic
1108559454 13:51628189-51628211 CCTGAGGGGCGGCTCAGCGCAGG - Intronic
1113879991 13:113619659-113619681 TCTGAAGTGCTGCTCGGGGCCGG + Intronic
1115611477 14:35052494-35052516 CCTGAAGTTGGGCCAGGCGCGGG - Intronic
1119266476 14:73265607-73265629 CCTGGAGTCCGGCTCAGGACTGG - Intronic
1124895411 15:33771926-33771948 CATGAAGTCAGGCTCAGAGCTGG + Exonic
1125675723 15:41501669-41501691 CCTGAAGCGCTGCTCGGAGCCGG + Exonic
1129831767 15:78675471-78675493 CCTGAAGTCCTGGGCAGCGCAGG - Intronic
1141068445 16:80932470-80932492 CCCGGAGCCCGGCTCTGCGCAGG - Intergenic
1144966379 17:19079175-19079197 CCTGGAGTCCAGCTGGGCACGGG + Intergenic
1144981539 17:19172882-19172904 CCTGGAGTCCAGCTGGGCACGGG - Intergenic
1144986685 17:19205357-19205379 CCTGGAGTCCAGCTGGGCACGGG + Intergenic
1147293418 17:39461774-39461796 CCTGAGGACTGGCTCGGCGGAGG + Intronic
1151370834 17:73645206-73645228 CCGCAGCTCCGGCTCGGCGCAGG - Intergenic
1153451757 18:5238054-5238076 CCGGAAGTGCGTGTCGGCGCGGG - Intergenic
1157220704 18:45826790-45826812 ACTGGAGTCCAGCTCGGGGCTGG + Intronic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1159051213 18:63422617-63422639 GCGGAAGTCGGGCTCGGCGCAGG + Intergenic
1160579348 18:79874845-79874867 CCTGAAGTCCCGGCCTGCGCTGG - Intronic
1161069262 19:2252305-2252327 CCTGGACTCCGGCGCGGGGCCGG + Exonic
1161153287 19:2720624-2720646 CCTGAAGCCCGGCTCCCGGCCGG + Intronic
1161224352 19:3136254-3136276 CAGGAAGCCCGGCTCGGCGGTGG - Exonic
1168282139 19:55311619-55311641 CCTAAAGTCAGGCCCGGCCCAGG + Intronic
925297500 2:2787613-2787635 CCTGAATTCCGACTCTGCACAGG - Intergenic
937226829 2:120375074-120375096 CCTGAAGACAGGCTTGGGGCTGG + Intergenic
938248696 2:129797640-129797662 CCTGAATTCTGGCTGGGCCCTGG - Intergenic
938328088 2:130427813-130427835 CCTGGCCTCGGGCTCGGCGCAGG - Intergenic
938361862 2:130693665-130693687 CCTGGCCTCGGGCTCGGCGCGGG + Intergenic
945492892 2:210476691-210476713 CCTGAAGCCCTTCTCGGCCCTGG + Exonic
945720336 2:213410883-213410905 CCTGAAGTCCGGCACCCTGCGGG + Intronic
1180100373 21:45581192-45581214 TCTGAAATCCGTCTGGGCGCAGG - Intergenic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
952152315 3:30606696-30606718 CCTGGAGGCCGGCGAGGCGCGGG - Exonic
953912411 3:46899674-46899696 CCTGAATTGAGGCTCGGCCCAGG + Intronic
966514742 3:180806330-180806352 CCTGGAGTCCGGCCAGGCTCTGG + Intronic
969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG + Intronic
977231064 4:94451974-94451996 CCTCGGGTCCGGCGCGGCGCGGG - Exonic
990513257 5:56508700-56508722 CCTGAAATCCTGCTTGGAGCAGG - Intergenic
995867474 5:116707020-116707042 CCTGAAGTCCGGCACCCTGCAGG + Intergenic
1002139950 5:177132642-177132664 GCTGCAGCCCGGCTCGGTGCCGG + Intergenic
1029124200 7:98285864-98285886 CCTGAAGCCATGCTCAGCGCAGG - Intronic
1034993401 7:155562289-155562311 CCTGAAGTCCAGCTCCACCCGGG - Intergenic
1035045167 7:155960936-155960958 CCTGAAGGCCAGCTCAGGGCAGG - Intergenic
1035748675 8:1979784-1979806 CCTGAAGTGCAGCTGGGTGCAGG + Intronic
1038766184 8:30429985-30430007 TCTGAAATCTGGCCCGGCGCAGG + Intronic
1039057905 8:33551179-33551201 TCTGAAGTCCGGCTTGCCCCAGG - Intronic
1044800121 8:95945306-95945328 CCTGAAGCCAGGCTGGGCTCTGG + Intergenic
1049552506 8:143267130-143267152 CCCGAAGCCCGGCCCCGCGCTGG + Intronic
1049599273 8:143499457-143499479 ACTGAACACCGGCTGGGCGCAGG - Intronic
1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG + Intergenic
1049780951 8:144428645-144428667 CCCGAAGTCCGGGCGGGCGCGGG - Intergenic
1061884307 9:133583923-133583945 TCTGATGTCAGGCTGGGCGCTGG - Intronic
1061954257 9:133953458-133953480 CCTGCACCCCGGCTCGGAGCTGG + Intronic
1062162502 9:135087921-135087943 CCTGAAGGCCGCCTGGGCGCGGG + Exonic
1196385110 X:115140598-115140620 CCTGAATTCTGGCTTGGGGCAGG - Intronic