ID: 949966767

View in Genome Browser
Species Human (GRCh38)
Location 3:9363233-9363255
Sequence ACTTCAGGCGGATCTCGTGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949966759_949966767 8 Left 949966759 3:9363202-9363224 CCTCTTGCAGTTGAGGCCGGCGC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG 0: 1
1: 0
2: 0
3: 1
4: 45
949966757_949966767 12 Left 949966757 3:9363198-9363220 CCTTCCTCTTGCAGTTGAGGCCG 0: 1
1: 0
2: 1
3: 8
4: 112
Right 949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG 0: 1
1: 0
2: 0
3: 1
4: 45
949966761_949966767 -8 Left 949966761 3:9363218-9363240 CCGGCGCCGAGCCGGACTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 62
Right 949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949966767 Original CRISPR ACTTCAGGCGGATCTCGTGG CGG Exonic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
901542988 1:9933005-9933027 ACTTTGGGCGGATCACGAGGCGG + Intronic
904260269 1:29283933-29283955 AATTCAGCCGGGTCTCCTGGAGG - Exonic
915859967 1:159433598-159433620 ACTTCAGCCTGATCTAATGGAGG - Intergenic
916393245 1:164356665-164356687 AATTGAGGCGGCTCTCGTGGAGG + Intergenic
919435379 1:197553021-197553043 ACTTCAGGTGGCTTTTGTGGAGG - Exonic
1063162717 10:3431268-3431290 AATGGAGGTGGATCTCGTGGGGG + Intergenic
1083536227 11:63468985-63469007 GCTTCAGGTGGGTCACGTGGGGG - Intronic
1089217498 11:116843681-116843703 ACATCAGGCTGAGCGCGTGGTGG + Intronic
1090161521 11:124500249-124500271 ATTTCAGGCAAATCTAGTGGAGG - Intergenic
1097349468 12:58532708-58532730 ACTTCAGGCGAAACTGATGGAGG - Intergenic
1102401092 12:112630428-112630450 ACTTCAGCCTGATGCCGTGGGGG + Intronic
1103380802 12:120492830-120492852 ACTTCAGGGGGACCTGGTGAAGG + Intronic
1122319562 14:100845606-100845628 CCGCCAGGCGGACCTCGTGGAGG + Intergenic
1122860999 14:104582325-104582347 ACTGCAGGCTGGTCTCGAGGGGG + Intronic
1128597747 15:68966854-68966876 ACTTTAGGTGGATCTCTTGCAGG + Intronic
1133178328 16:4033077-4033099 ACTTCAGACTGATGTCCTGGAGG + Intronic
1137581864 16:49638509-49638531 TCTTCAGGTGGATCTTGAGGTGG + Exonic
1142113082 16:88342333-88342355 ACCTCAGGAAGATCTCATGGGGG + Intergenic
1148178372 17:45586117-45586139 TCATCAGGCGGAACTCGTAGAGG - Intergenic
1148270789 17:46260350-46260372 TCATCAGGCGGAACTCGTAGAGG + Intergenic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1157764358 18:50285781-50285803 ACTTCTGCCGGATCTTGTTGGGG + Exonic
1159175357 18:64826691-64826713 ACTTCAAGCTGATCTCTAGGTGG + Intergenic
1167301505 19:48680491-48680513 ACTCCTGGAGGATCTCCTGGCGG - Intergenic
1167305061 19:48703436-48703458 ACTCCTGGAGGATCTCCTGGCGG - Exonic
928242706 2:29600595-29600617 GTTTCAGGCTGATATCGTGGGGG + Intronic
928518890 2:32068742-32068764 ACTTTAGCCGGATGTGGTGGCGG + Intronic
932986414 2:76731161-76731183 ACTTCAGGCCAAACTTGTGGAGG + Intergenic
944317321 2:198296898-198296920 ACTTCTGGAGGCTCTCTTGGGGG + Intronic
1171531029 20:25853831-25853853 ACCTCAGGCGGATCGCCGGGCGG - Intronic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1184838419 22:47037709-47037731 ACTTCAGGCCGTTCTCTTTGTGG + Intronic
949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG + Exonic
960442437 3:117705528-117705550 ACTTCAGGAGGAACTCAAGGAGG + Intergenic
963162850 3:142169593-142169615 ACTTCAGTGGGATCTTATGGTGG - Intronic
965979753 3:174673585-174673607 ACTAAAAGCGGATCTCATGGAGG + Intronic
977576791 4:98683497-98683519 GCTTCAGGCCGCTCTCATGGTGG - Intergenic
979363629 4:119794340-119794362 AGTTCAGGCAGATGTCATGGAGG + Intergenic
998266760 5:140672778-140672800 TCATCAGGCGGAACTCGTAGAGG + Exonic
1001182253 5:169531305-169531327 ACCTAAGGGGGATCTCTTGGGGG + Intergenic
1020037357 7:4972771-4972793 AAATTAGGCGGATGTCGTGGCGG + Intergenic
1026938380 7:74272207-74272229 AAATCAGCCGGATTTCGTGGTGG - Intergenic
1048800955 8:138193482-138193504 TCTTCAGCCTGATCTCGTGATGG + Intronic
1188216208 X:27480520-27480542 GCTTCAGGTGGGTCTCTTGGCGG + Intergenic
1199772369 X:150983281-150983303 CAATCAGGCGGCTCTCGTGGAGG + Exonic