ID: 949966769

View in Genome Browser
Species Human (GRCh38)
Location 3:9363258-9363280
Sequence CCCATCTTGCTCCCTCTCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 999
Summary {0: 1, 1: 1, 2: 22, 3: 145, 4: 830}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949966764_949966769 11 Left 949966764 3:9363224-9363246 CCGAGCCGGACTTCAGGCGGATC 0: 1
1: 0
2: 0
3: 0
4: 30
Right 949966769 3:9363258-9363280 CCCATCTTGCTCCCTCTCCCAGG 0: 1
1: 1
2: 22
3: 145
4: 830
949966765_949966769 6 Left 949966765 3:9363229-9363251 CCGGACTTCAGGCGGATCTCGTG 0: 1
1: 0
2: 0
3: 7
4: 478
Right 949966769 3:9363258-9363280 CCCATCTTGCTCCCTCTCCCAGG 0: 1
1: 1
2: 22
3: 145
4: 830
949966761_949966769 17 Left 949966761 3:9363218-9363240 CCGGCGCCGAGCCGGACTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 62
Right 949966769 3:9363258-9363280 CCCATCTTGCTCCCTCTCCCAGG 0: 1
1: 1
2: 22
3: 145
4: 830

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949966769 Original CRISPR CCCATCTTGCTCCCTCTCCC AGG Exonic
900186764 1:1336515-1336537 CCCATCCTGTTCTCACTCCCAGG - Exonic
900415530 1:2532799-2532821 CGCCTCTTCCTCCCTCCCCCTGG + Intergenic
900420825 1:2555298-2555320 CCCTGCCTGCTCCCTCTCCAGGG + Intergenic
900763098 1:4486172-4486194 CCTATCTTCCTCCCTCCCTCAGG + Intergenic
900818297 1:4867218-4867240 ACCATCTTGGAACCTCTCCCCGG + Intergenic
901063309 1:6483838-6483860 CCCACCTTGTCCCCTCTTCCTGG + Intronic
901333934 1:8432250-8432272 CCCATCCTGATTCCTTTCCCTGG + Intronic
901406789 1:9054090-9054112 CCCATCTTCTTACCTCTCTCGGG - Intronic
901640564 1:10691003-10691025 CCCTTCCCGCTCCCTCCCCCAGG + Intronic
901668972 1:10843041-10843063 CCCAGGCTGCTCCCTCTGCCTGG + Intergenic
901751461 1:11412541-11412563 CCCATCCTGATCCCTCTGCCAGG - Intergenic
901800340 1:11704742-11704764 TCCATCTTGTCCCCTATCCCGGG - Intronic
902130065 1:14252505-14252527 CTCATGTTGTTCCCTCTGCCTGG + Intergenic
902391556 1:16109962-16109984 CCCCTGTCCCTCCCTCTCCCTGG - Intergenic
902403443 1:16170686-16170708 CCTTCCTTGCCCCCTCTCCCGGG - Intergenic
902675481 1:18005768-18005790 CTCATGTTGCACCCTCTCCCTGG - Intergenic
903105571 1:21076462-21076484 GGGATCTTGCTCTCTCTCCCAGG - Intronic
903275579 1:22219282-22219304 TCCATCTCTCTCCATCTCCCTGG + Intergenic
903453573 1:23471207-23471229 CTCATGCTGCTCCCTCTGCCTGG + Intronic
903564201 1:24252599-24252621 CACTTCCTGCTCCCTCTTCCTGG - Intergenic
904454012 1:30636115-30636137 CCCATGTTGTTCCCTCTGCCTGG - Intergenic
904524197 1:31120351-31120373 CCCAGCTTTCTGCTTCTCCCAGG - Intergenic
904972826 1:34432462-34432484 CCCATCTTGCTCTCAGTGCCCGG - Intergenic
905144220 1:35874514-35874536 ACCATCTCTCTCCCTCTCCTTGG + Intronic
905260978 1:36718975-36718997 CCCATCTCTCTCCCTCCCCTTGG - Intergenic
905459926 1:38115874-38115896 CCCGCCTCGCTCCCTCCCCCAGG - Intergenic
905529711 1:38667901-38667923 ACCATCTTGCCTCCTCTCACTGG - Intergenic
905794901 1:40810250-40810272 CACATCCTGCTTCCTCTGCCTGG + Intronic
906240400 1:44239043-44239065 TCCAGCTTCCTCCCACTCCCTGG + Intronic
906551719 1:46671186-46671208 CCCATGCTGCTCCTTCACCCAGG - Intronic
906673479 1:47676890-47676912 GCCTTCTTGCTGCCTCTCCATGG + Intergenic
906714111 1:47954315-47954337 CCCATTTCCCTCCCTTTCCCTGG + Intronic
906718190 1:47985923-47985945 CTCATGTTGTTCCCTCTACCTGG - Intronic
907042012 1:51269843-51269865 CCCAGCTTCCTACCCCTCCCAGG + Intronic
907046982 1:51305444-51305466 GCCTTCCTGCTCCCTCTGCCTGG + Intronic
907388194 1:54139476-54139498 CCCATCTGGTTCCTTCCCCCTGG - Exonic
907430069 1:54406421-54406443 CCCGCCTCGCTCCCTCGCCCGGG - Intronic
907443328 1:54491425-54491447 CCCACCAAGCTCCCTCTCCCTGG - Intergenic
907916816 1:58877881-58877903 CCCATCTTCCTCCCTCTCCTCGG + Intergenic
908064391 1:60386872-60386894 CTCATTTTGCTTCCTCTGCCTGG + Intergenic
908397735 1:63741543-63741565 CCCATATCTCTCCCTCTCCTTGG + Intergenic
909221742 1:72971989-72972011 ACAGTCTTGCTCCGTCTCCCAGG + Intergenic
910151535 1:84153092-84153114 CCCATTTCTCTCCCTCTCCTTGG - Intronic
910510386 1:87997035-87997057 CCTAGCGTGCTCACTCTCCCTGG + Intergenic
910780483 1:90927040-90927062 TCCACCTTGCTCCCTCTTTCAGG + Intronic
910860920 1:91741741-91741763 CCCATCTTCCACCTTATCCCTGG + Intronic
911165930 1:94724237-94724259 CCCATTCTGCTTGCTCTCCCTGG + Intergenic
911649645 1:100373254-100373276 CCCATCTCTCTCCCTCTCCTTGG - Intronic
911897031 1:103449181-103449203 CCTGTCTTTCTCCCTCTCCTAGG - Intergenic
912253323 1:108033216-108033238 CCCATGTTGTTCCTTCTGCCTGG + Intergenic
912272757 1:108227754-108227776 TCCCTCTTGCTCACTTTCCCTGG - Intronic
912295463 1:108466568-108466590 TCCCTCTTGCTCACTTTCCCTGG + Intronic
912547976 1:110465083-110465105 CCCTTCTTCCTCCCTCTCCCGGG - Intergenic
912915646 1:113812071-113812093 CCCCTCTCGCTCCCCCTCACCGG - Exonic
913088162 1:115458140-115458162 CCCTCCTTGCTCTCTGTCCCAGG + Intergenic
913250486 1:116909323-116909345 CCCAGCTCCCTCCCTCTCCTCGG - Intergenic
913336704 1:117715643-117715665 CCCAATTTGCCCCCTCCCCCAGG - Intergenic
914434941 1:147651591-147651613 CACAGCTTGCTGCCACTCCCTGG - Intronic
914774573 1:150724751-150724773 CCCATCTCTCTCCCTCTCCTTGG - Intergenic
915304626 1:154970375-154970397 CCCATCCTGCCTCCTCTGCCTGG - Exonic
915545833 1:156597086-156597108 CACATGTTGCTCCCTCTGCTTGG - Intronic
916060974 1:161098508-161098530 CCCACCGCCCTCCCTCTCCCCGG + Exonic
916304277 1:163311610-163311632 CCCATCTCTCTCCCTCTCCTTGG - Intronic
916423559 1:164659660-164659682 CCTCCCTTGTTCCCTCTCCCTGG + Intronic
916516096 1:165517991-165518013 CCCACCTCTCTCCTTCTCCCAGG - Intergenic
917689099 1:177449142-177449164 CACATATTGTTCCCTCTTCCAGG + Intergenic
918067455 1:181110981-181111003 CCCATGCTGTTCACTCTCCCTGG + Intergenic
919408066 1:197209228-197209250 CCCGATTTGCTCCCTCTCCCAGG + Intergenic
919448833 1:197745440-197745462 CCCATCTCTCTCCCTCTCCTGGG - Intronic
919487880 1:198166605-198166627 CCCATCTCTCTCCCTCTCCTTGG - Intronic
919699153 1:200613296-200613318 TACATGCTGCTCCCTCTCCCTGG + Intronic
919907398 1:202087259-202087281 ACCCTCTGGCTCCCTCTGCCAGG - Intergenic
920264650 1:204712539-204712561 CCCATCTGCCTCCCCGTCCCCGG - Intergenic
920458251 1:206117109-206117131 CCCCTCCTTCTCCCTCTCCTGGG - Exonic
920494590 1:206445778-206445800 CCCATCCTCATCCCTATCCCCGG - Intronic
920541992 1:206785638-206785660 CACACTCTGCTCCCTCTCCCTGG - Intergenic
921276198 1:213523157-213523179 CCCATCTCTCTCCCTTTCCTTGG - Intergenic
921816413 1:219569051-219569073 CCCATTTTCCTACTTCTCCCTGG - Intergenic
922005861 1:221530063-221530085 TCCATCTTCCTACCTCTGCCTGG + Intergenic
922012594 1:221606216-221606238 CCTGTCTTCCTCCCTCTCCTTGG + Intergenic
922347429 1:224708019-224708041 CCCATCCTGCTCCCTGTCTCTGG + Intronic
922588640 1:226755220-226755242 CCCATCTCTCTCCCTCTCCTTGG + Intergenic
922963498 1:229667866-229667888 CCCAACTTGTTCCCTCAGCCAGG - Intergenic
923286176 1:232497967-232497989 CCAATCCTGCTCCCTCTGCCTGG + Intronic
923763158 1:236866420-236866442 CCCATCTCTCTCCCTTTCCTCGG + Intronic
924445257 1:244124007-244124029 TCCATCTTGCTCGCTCTCCCTGG - Intergenic
924790559 1:247243732-247243754 CTCATCTCTCCCCCTCTCCCCGG + Intergenic
924909683 1:248497168-248497190 CCCAGTTTGCCCCCTCCCCCAGG + Intergenic
924914419 1:248550892-248550914 CCCAGTTTGCCCCCTCCCCCAGG - Intergenic
1063039729 10:2324846-2324868 CCCAGCTCGCTCCCTCCCCCAGG - Intergenic
1063681146 10:8188985-8189007 AGAATCTTGCTCTCTCTCCCAGG - Intergenic
1063793422 10:9482093-9482115 TCCATCTCTCTCCCTCTCCTGGG + Intergenic
1063957389 10:11280122-11280144 CCCATCTCAGCCCCTCTCCCAGG - Intronic
1063978176 10:11433494-11433516 ACCATCTTGCTCTGTCTTCCAGG - Intergenic
1064251156 10:13707464-13707486 CCCTGCTGGGTCCCTCTCCCCGG - Intronic
1064820270 10:19321773-19321795 TCCTTCTTGCTCCCACTTCCTGG + Intronic
1065293407 10:24253153-24253175 CGCCTCTGGCTACCTCTCCCAGG - Intronic
1065456723 10:25914152-25914174 CCCATCTTTCTCCTTCTCATTGG - Intergenic
1065461183 10:25966140-25966162 GCCATCTTGCCCCCGCTCCCTGG + Intronic
1065570563 10:27067598-27067620 CCCACCTTGCTCTCTTGCCCTGG - Intronic
1066277672 10:33884795-33884817 CACATCTTCCTCACTCTCTCAGG + Intergenic
1067186698 10:44035252-44035274 CCCATCTCTTTCCCTCTCCTTGG - Intergenic
1067462318 10:46466745-46466767 CCCATCTCCTTCCCTCACCCTGG - Intergenic
1067570587 10:47368458-47368480 GTCATCGTGCTCCCTCTCCTGGG + Exonic
1067624879 10:47917892-47917914 CCCATCTCCTTCCCTCACCCTGG + Intergenic
1068690001 10:59905712-59905734 CCCAGCTTCCTCCCTCTTCCAGG + Intronic
1068700391 10:60013684-60013706 CCCATATCTCTCCCTCTCCTTGG - Intergenic
1068800874 10:61138352-61138374 CCCATCCTGCTGCTTCACCCAGG - Intergenic
1069417770 10:68216391-68216413 CACATCTCTCTCCCTCTCCTTGG + Intergenic
1070162500 10:73874524-73874546 CTCCTCTTGCTCCCTCGGCCGGG - Exonic
1070216600 10:74388941-74388963 GCCTTCTTTCTCCCTCTCCATGG + Intronic
1070281652 10:75053295-75053317 CCCATCCTGCTTCCTCTGCCTGG + Intronic
1071450185 10:85786589-85786611 CCCACCCTGCTGCCTCACCCAGG + Intronic
1071683305 10:87729532-87729554 CGCATCTCTCTCCCTCTCCTTGG + Intronic
1071763869 10:88639759-88639781 CCCATTTTGCTCCCTCTCCTGGG - Intergenic
1072059584 10:91797119-91797141 GCCATCTCTCTCCCTCTCCTGGG - Intergenic
1072226260 10:93372786-93372808 CCCATCCTGGTCCCTCTCTCTGG - Intronic
1072540387 10:96394084-96394106 CCCATCTTAGACCTTCTCCCAGG - Intronic
1072936419 10:99717755-99717777 CCCATCTCCATCACTCTCCCTGG + Intronic
1073291786 10:102416790-102416812 CCCGTGTTGCTCCCTCACCCTGG - Exonic
1074201498 10:111240110-111240132 CCCATCTCTCTCCCTCTCTTTGG - Intergenic
1074595904 10:114866755-114866777 GCCATCTTACTTCCTTTCCCTGG - Intronic
1074778738 10:116785384-116785406 CACATCTTGATCTCTGTCCCCGG - Intergenic
1075047809 10:119159797-119159819 CCCTTCTGGCCCCCTCTGCCTGG - Intronic
1075179517 10:120197253-120197275 CCCATCTCTCTCCCCTTCCCTGG - Intergenic
1075276483 10:121097582-121097604 CCCATCCTGTTCCCTTTACCTGG + Intergenic
1075451000 10:122551905-122551927 CCCCTCTTGCTTCTTATCCCAGG - Intergenic
1075507789 10:123040323-123040345 ACAGTCTTGCTCCGTCTCCCAGG - Intronic
1075857102 10:125638760-125638782 CCCAACCTGCTCCCTGTCCTGGG + Intronic
1076095392 10:127731106-127731128 CCCATCTGTGTCCCTCTCCTTGG - Intergenic
1076302237 10:129437124-129437146 TCCATCTTCCTGCCTCACCCTGG + Intergenic
1076549567 10:131269535-131269557 CCCATCCTTCTCCCTCTCCTTGG - Intronic
1076726187 10:132414513-132414535 CCCATCTTGCACGCAGTCCCTGG + Intronic
1076732756 10:132446672-132446694 GCCATCTTGCACCTTCTGCCTGG - Intronic
1076786988 10:132754783-132754805 CCCAGCCTGCTCCTTCTTCCTGG + Intronic
1077029547 11:458535-458557 CAGATCTTGCTCTGTCTCCCAGG + Intronic
1077055694 11:591770-591792 ACCATCTTGCTCTTTCACCCAGG + Intronic
1077263759 11:1638506-1638528 CCTATCTCTCTCCCTCTCCAGGG + Intergenic
1077892081 11:6426181-6426203 ATCATCTTGCTCCGTCGCCCAGG + Intergenic
1078117723 11:8470734-8470756 TCCATCTCTCTCCCTCTCCTTGG - Intronic
1078427888 11:11266165-11266187 CCCTTCGTGCTCCCACCCCCAGG - Intergenic
1078609338 11:12806522-12806544 GCCATCTTCCTCCTCCTCCCAGG - Intronic
1078635476 11:13045766-13045788 TCCTTCTTCCTACCTCTCCCTGG - Intergenic
1079620982 11:22553696-22553718 CCCATCTCTCTCCCTTTCCTTGG + Intergenic
1080063621 11:27983788-27983810 CCCATCTTCATGCCTCTACCTGG - Intergenic
1081099153 11:38980252-38980274 CGAATCTTGCTCTGTCTCCCAGG - Intergenic
1081649321 11:44813060-44813082 CCCAGCTTCCTCACTCTCCCAGG + Intronic
1082761423 11:57130626-57130648 CCCATGTTATTCCCTCTGCCTGG - Intergenic
1083040130 11:59677870-59677892 CTCATCTTTCTCCCTCTCTTTGG - Intergenic
1083166023 11:60888423-60888445 ACTCTCCTGCTCCCTCTCCCTGG - Intergenic
1083293584 11:61703252-61703274 ACCATCTGGCTCCCTCCACCAGG - Intronic
1083725824 11:64627482-64627504 CTCATCTTGCTCACCCTGCCAGG + Intronic
1083747391 11:64743650-64743672 GCCCTCTTCCTCCCTATCCCCGG + Intronic
1083798446 11:65032293-65032315 CCCTCCTTCCTCCCTGTCCCTGG + Intronic
1083898086 11:65630272-65630294 GCCATGTTGGTCACTCTCCCAGG + Intronic
1083901167 11:65644236-65644258 CCCATGCTCCTCCCCCTCCCTGG - Intronic
1083932367 11:65853003-65853025 CCCACCTCCCTCCCTCCCCCAGG + Intronic
1083943550 11:65911619-65911641 CCCATTTGGCTCCCACTCCCAGG - Intergenic
1083946193 11:65924461-65924483 CCCTTGCTGTTCCCTCTCCCTGG - Intergenic
1084447551 11:69212586-69212608 CTCATCTCCCTTCCTCTCCCTGG + Intergenic
1084447830 11:69214078-69214100 CCCATGTTGCCCCCTCTTCATGG + Intergenic
1084454196 11:69258035-69258057 CCCATGTTATTCCCTCTACCTGG + Intergenic
1084566477 11:69931589-69931611 CCTGTCCTGCTCCCTGTCCCTGG + Intergenic
1084738871 11:71125101-71125123 CCCACCTCTCTCCCTCTCCTTGG + Intronic
1085050804 11:73379245-73379267 CTCCTCTTGCTCCCCCTCCCAGG - Intronic
1085125914 11:74002238-74002260 CTCCTCTTGCTCCCTCTGCCTGG + Intronic
1085436512 11:76508936-76508958 CCCATCTCTCTCCCTCTCCTTGG - Intronic
1085517968 11:77122352-77122374 CCCACACTGCTCCCTCTGCCCGG - Intronic
1086330528 11:85749493-85749515 CCCCTCTTTTTCCCACTCCCAGG - Intronic
1086409798 11:86533024-86533046 CCCATCTTGCTCTGTCACCCAGG - Intronic
1086449348 11:86900690-86900712 CATATGCTGCTCCCTCTCCCTGG + Intronic
1086527967 11:87751272-87751294 GCCATCTTCCTTCCTCTGCCAGG - Intergenic
1086896967 11:92324454-92324476 CCCATCTCTCTCCCTCTCCTCGG - Intergenic
1087199924 11:95335223-95335245 CCAATCTTGCTCCCTCTCTCTGG + Intergenic
1087887440 11:103496881-103496903 GCCATCTTGCTCAGTCTCTCAGG - Intergenic
1087948961 11:104196575-104196597 CCCACATTGCTCCCTCTGCCTGG + Intergenic
1088480721 11:110294366-110294388 CCCATCTCGCTCTGTCTCCCAGG - Intronic
1088598162 11:111455181-111455203 CCCAACCTGTTCCATCTCCCTGG + Intronic
1089263096 11:117236297-117236319 GGCATCTTGCTCCGTCACCCAGG + Intronic
1089303507 11:117512816-117512838 CCCACTTCCCTCCCTCTCCCTGG + Intronic
1089572057 11:119417569-119417591 CCCCTCTTGCCCCCAATCCCAGG + Exonic
1090037925 11:123264751-123264773 CCCCTGTACCTCCCTCTCCCTGG - Intergenic
1090051422 11:123383012-123383034 CCCATCTTGCTCTGTGACCCAGG - Intergenic
1090381550 11:126331125-126331147 CCCTTCCTGCTCCATCTTCCAGG - Intronic
1090557103 11:127888021-127888043 CCCATCTCTCTCCCTCTCCTTGG - Intergenic
1090664578 11:128905949-128905971 AGCATCGTGCTCCCACTCCCGGG - Intronic
1090686508 11:129128581-129128603 CCCCTCCCCCTCCCTCTCCCCGG + Intronic
1090797824 11:130150448-130150470 CCCAGCCTGCTCCCTGGCCCAGG - Intergenic
1091172429 11:133530548-133530570 CCCACCTAGCTCCCTCTACCAGG + Intronic
1091362516 11:134988845-134988867 CCTCTCCTACTCCCTCTCCCTGG + Intergenic
1091684618 12:2552823-2552845 CCCATCTTCCTCCCTGTCCATGG - Intronic
1092211676 12:6650650-6650672 TCCACCTTGCCCCCTCTCCCAGG + Exonic
1092230247 12:6772268-6772290 TCCAGACTGCTCCCTCTCCCAGG - Intergenic
1092464995 12:8723283-8723305 CCCATCTCTCTCCCTCTCCTTGG - Intronic
1092966150 12:13645265-13645287 CCCATCTCTCTTCCTCTCCTTGG - Intronic
1092990102 12:13888706-13888728 GGAGTCTTGCTCCCTCTCCCAGG - Intronic
1093402033 12:18758068-18758090 CCCATCTTTCTCCCTCTCCTTGG + Intergenic
1093615699 12:21220790-21220812 CCAGTCTTGCTCTGTCTCCCAGG - Intronic
1093838298 12:23864258-23864280 CCCATCTCTCTCCCTCTACTCGG + Intronic
1094426847 12:30324913-30324935 CCCTTGTTGTTCCCTCTGCCTGG - Intergenic
1094610233 12:31988714-31988736 GGCATCTTGCTCTGTCTCCCAGG + Intronic
1094754357 12:33449062-33449084 CCTATCTCTCTCCCTCTCACTGG - Intergenic
1095284759 12:40395696-40395718 CCCATCTCTCTCCCTCTCTTTGG - Intronic
1095875938 12:47079955-47079977 CCCAGCCTGCTCCCTCCCGCAGG - Intronic
1095936869 12:47693243-47693265 CCCATCTCTCTCCTTCTCCTTGG - Intronic
1096518357 12:52170617-52170639 GCCATCTGGCTTCCACTCCCAGG + Exonic
1096530341 12:52238658-52238680 CCCATCTTGCCCCAACCCCCAGG + Exonic
1096696928 12:53355269-53355291 TCCATCTTGCTCTGTCACCCAGG - Intergenic
1097206518 12:57326144-57326166 CCGATCTCTCTCCCTCTCCTTGG + Intronic
1097328495 12:58306587-58306609 CCCATCTCTCTCCCTCTCCTTGG + Intergenic
1097798602 12:63889082-63889104 CACATGCTGTTCCCTCTCCCTGG + Intronic
1097936483 12:65257593-65257615 CCCATCTTTCTCCCTCTCCTCGG - Intergenic
1098299826 12:69042981-69043003 CCCGTCATGCGCCCTCTCCATGG - Intergenic
1098309711 12:69136226-69136248 CCAACCTTCCTGCCTCTCCCAGG - Intergenic
1098928739 12:76384217-76384239 CCCAACTTGCACCCTCTCCTGGG - Intronic
1099052302 12:77794903-77794925 CCCATCTCTGTCCCTCTCCCTGG + Intergenic
1099239539 12:80122921-80122943 TCCCTCTTGCTCACTTTCCCTGG + Intergenic
1099474248 12:83088594-83088616 TCCATCTTTCTCCTTCTCCTCGG - Intronic
1099480926 12:83165465-83165487 CCCATCTCCCTCCCTTTCCTTGG - Intergenic
1100961912 12:99972113-99972135 TCCATCTCTCTCCCTCTCCTTGG + Intronic
1101879456 12:108616586-108616608 CCCATGATGCTCCCACTGCCTGG + Intergenic
1102018811 12:109666954-109666976 CCCATTTTTCCCCGTCTCCCTGG - Intergenic
1102213757 12:111145690-111145712 TCCATCTTGCTCTGTCACCCAGG + Intronic
1102257200 12:111423039-111423061 CCCATGCTGTTCCCTCTGCCTGG - Intronic
1102573203 12:113840274-113840296 ACCTTCTTGCCCCCTCTTCCTGG + Intronic
1102873259 12:116430562-116430584 AGGATCTCGCTCCCTCTCCCAGG + Intergenic
1102931554 12:116866130-116866152 GGAATCTTGCTCTCTCTCCCAGG - Intronic
1103615296 12:122148048-122148070 CCCATCTGGCGCCCTGTGCCTGG + Intergenic
1103897033 12:124279711-124279733 CACCTCTTGCTTCCTCCCCCAGG - Intronic
1103906043 12:124327674-124327696 CCCCTCTGGCTCCCCCTCCCCGG - Intronic
1103959907 12:124603010-124603032 CCCATGTTGCAGCCCCTCCCTGG - Intergenic
1104113615 12:125727357-125727379 CCTATCTCTCTCCCTCTCCTAGG + Intergenic
1104385021 12:128343006-128343028 CCCAGTTTGCTACATCTCCCTGG - Intronic
1104488472 12:129172917-129172939 CCCATCATTTTCCCTCTCCTCGG - Intronic
1104520619 12:129471492-129471514 TCCATCCTTCTCCCTCTCCTCGG + Intronic
1104552606 12:129771030-129771052 TCCATCTTGCTCCCCTTCCAGGG + Intronic
1104705258 12:130940546-130940568 CCCATCTTGTTTCCCCTGCCTGG - Intergenic
1104980845 12:132572563-132572585 CCCACCCTGCTCCCACACCCCGG + Exonic
1105337717 13:19489043-19489065 CCCATCTTTCTCCTTCTCCTTGG - Intronic
1105790843 13:23797298-23797320 CCCACCTTGCTCTGTCTCCTGGG + Intronic
1106456586 13:29933149-29933171 CCCATCTCTCTCCCTTTCCTTGG - Intergenic
1106522668 13:30511701-30511723 CCCATCTATCTCCCTTGCCCTGG + Intronic
1108181385 13:47843301-47843323 CCCATCTCTCTTCCTCTCCTTGG - Intergenic
1108337686 13:49463029-49463051 GAAATCTTGCTCTCTCTCCCAGG + Intronic
1108467969 13:50737692-50737714 CCCATCTCTCTCCCTTTCCTTGG + Intronic
1108633008 13:52304413-52304435 CCCATCTCTCTCCCTCTTCTTGG - Intergenic
1108653683 13:52508142-52508164 CCCATCTCTCTCCCTCTTCTTGG + Intergenic
1109482135 13:62969737-62969759 CCCATCTTGTTCCTTGTCCATGG + Intergenic
1109953258 13:69530493-69530515 CTCATCTCTCTCCCTCTCCTTGG + Intergenic
1111089399 13:83423486-83423508 CCCATGTTGCTCCCTATTCTGGG - Intergenic
1111640518 13:90963853-90963875 CCCATCTCTCTCCTTCTCCTCGG + Intergenic
1111936631 13:94564381-94564403 CCCATCTCTCTCCCTCTTTCGGG - Intergenic
1112091916 13:96091155-96091177 CTCCTCTTCCTCCCCCTCCCGGG - Exonic
1112282121 13:98072391-98072413 ACAATCTTGCTCTGTCTCCCAGG - Intergenic
1112388914 13:98964891-98964913 CCCATCCTGCTTCCTCTGCAAGG + Intronic
1112556235 13:100471183-100471205 CCCATCTCTCTCCCTCTCCTTGG - Intronic
1112622539 13:101066741-101066763 CCCAATTTGCTCCCTCTTCTTGG - Intronic
1112626824 13:101114468-101114490 CCCATCTTGCTTGCTTGCCCTGG + Intronic
1113914458 13:113862496-113862518 CCTAGCTTGGTCGCTCTCCCCGG - Intronic
1114537879 14:23434303-23434325 CCCACCTTCCTGCTTCTCCCTGG + Intronic
1114622304 14:24103489-24103511 CCCATCTTGCTTCCCCCCCAGGG + Exonic
1114815448 14:25952558-25952580 CCCATCTGTCTCCCTCTCTTTGG - Intergenic
1114921119 14:27330108-27330130 ACCATATTGCTCCGTCACCCAGG - Intergenic
1115448337 14:33517762-33517784 CCCATCTAGTTCCCGCCCCCAGG + Intronic
1115866054 14:37747710-37747732 TCCATCTTGCTCCCTGTCTCAGG - Intronic
1116431005 14:44845018-44845040 CAAATCTTGCTCCATCACCCAGG - Intergenic
1116828784 14:49697278-49697300 CCCCTCTCTCTCCCTCTCCTTGG - Intronic
1117764489 14:59066812-59066834 CCCATCTCTCACCCTCTCCTCGG - Intergenic
1117887019 14:60375069-60375091 TCCATCTCTCTCCCTCTCCTTGG + Intergenic
1118257527 14:64218167-64218189 CTCATCTGCTTCCCTCTCCCTGG + Intronic
1118677567 14:68204299-68204321 CCCATCTTTTTCCCACTCCTTGG - Intronic
1118757509 14:68855619-68855641 CCCAGCTTGCTCCCGTTTCCAGG + Intergenic
1118813731 14:69294145-69294167 CCCATCTCGCTCTGTCACCCAGG + Intronic
1118959907 14:70519632-70519654 CCCATCTCTTTCCCTCTCCTTGG + Intergenic
1119044399 14:71305129-71305151 CTCATGTTGCTCTCTCTGCCTGG - Intergenic
1119068488 14:71555788-71555810 CCCATCTGCCTCCCTCTCTTTGG - Intronic
1119170566 14:72532375-72532397 CCCATCTCTTTCCCTCTCCTTGG + Intronic
1119447134 14:74674866-74674888 CCCATCTTGCCTCCCTTCCCTGG - Intronic
1119615864 14:76098916-76098938 CCCCTTTTTCTCTCTCTCCCTGG - Intergenic
1121018743 14:90565830-90565852 GCCATCTTTTTCCCTCTCCTTGG - Intronic
1121036371 14:90707316-90707338 CCCATCTCTCTCCCTTTCCTTGG + Intronic
1121319225 14:92981389-92981411 AACATCCTGCTCCCTCTCCCTGG + Intronic
1121438694 14:93935296-93935318 CCCACCTGGCTGCCTCCCCCAGG + Intronic
1121575287 14:94980034-94980056 CTCATGTCCCTCCCTCTCCCTGG + Intergenic
1121647143 14:95526174-95526196 CCCTGGTTGCTCCCTCTTCCTGG + Intergenic
1121901392 14:97696498-97696520 CATGTCTTCCTCCCTCTCCCTGG + Intergenic
1122034122 14:98935182-98935204 CCTAAATTTCTCCCTCTCCCTGG - Intergenic
1122306324 14:100769005-100769027 CCCATCTTGTTTGCTCTTCCTGG + Intergenic
1122549440 14:102542008-102542030 CCCTTCTTGCTCTCTTGCCCTGG - Intergenic
1122599919 14:102916083-102916105 CAGATCTTGCTCTCTCGCCCAGG + Intergenic
1123053082 14:105556797-105556819 CTCATCTTCCACCATCTCCCAGG + Intergenic
1123077658 14:105677215-105677237 CTCATCTTCCACCATCTCCCAGG + Intergenic
1123118742 14:105907296-105907318 CCCATCTTGCTGGCTCTGGCTGG + Intergenic
1123701500 15:22917749-22917771 CCCCGCCTGCACCCTCTCCCTGG - Intronic
1124611765 15:31214405-31214427 CCCGGCTTCATCCCTCTCCCTGG - Intergenic
1124665495 15:31588421-31588443 CCCATCATGTTGCCTCCCCCTGG - Intronic
1124892352 15:33744970-33744992 CCAGTCTTGCTGCCTCTCCATGG - Intronic
1125099586 15:35895675-35895697 CCCATCTCTCTCCCTTTCCTAGG - Intergenic
1125236756 15:37523680-37523702 TCCCCCTTTCTCCCTCTCCCTGG - Intergenic
1125313209 15:38402874-38402896 CCCATCCTGCTCCATTCCCCAGG + Intergenic
1125599984 15:40910175-40910197 CCCGACTAGCTCCCTGTCCCAGG + Intergenic
1125617636 15:41029863-41029885 CCCATCTTGCTCCCTCACTGGGG + Intronic
1126645237 15:50869098-50869120 CCCATCCTTTTCCCTCTTCCTGG + Intergenic
1126685179 15:51242193-51242215 CCCATTTTTCTCCCACTACCAGG + Intronic
1126783715 15:52159817-52159839 CCCCTCTGGCTCCCTGACCCTGG - Intronic
1127153602 15:56105131-56105153 CCCATGTTGATTCCTCTACCTGG + Intronic
1127307610 15:57723417-57723439 CCCAACTCTCTCCCTCTCCATGG + Intronic
1127733357 15:61819863-61819885 TCCTCCCTGCTCCCTCTCCCCGG - Intergenic
1128173859 15:65536398-65536420 TCCATCTCTCTCCCTCTCCTTGG + Intronic
1128617436 15:69121176-69121198 CCCCTCTCCCTCCCTCCCCCGGG - Intergenic
1128620845 15:69148536-69148558 CCCACCTCGCTCCCTCTGCCTGG - Intergenic
1128648087 15:69391638-69391660 CCCATCTGGTTCGCTCTCCTAGG + Intronic
1128650748 15:69411132-69411154 CCAAACTTGCTCCCTCTCAGTGG - Intergenic
1128670720 15:69572925-69572947 ACCCTCTGGCTCCCTATCCCAGG + Intergenic
1128712983 15:69885850-69885872 TCCCACTTGCTCCCCCTCCCAGG - Intergenic
1128722578 15:69961588-69961610 CCCATCTCTCTCCCTCTCCTTGG + Intergenic
1128745625 15:70112057-70112079 CCCATGCTGCTCCCTCTACCTGG + Intergenic
1128797447 15:70476216-70476238 CCCACATGGCTCCCTCACCCTGG - Intergenic
1128848935 15:70931251-70931273 CCCATCTCTCTCCCTCTTCTTGG - Intronic
1128989108 15:72243784-72243806 TCCATCTTCATCTCTCTCCCTGG - Intronic
1129049174 15:72764007-72764029 CCCATCTCTCGCCCTCTCCTTGG + Intronic
1129108368 15:73323661-73323683 GCCATCTTCCGCCCTCCCCCAGG - Exonic
1129147396 15:73661090-73661112 GGCATCTTGCTCTGTCTCCCAGG - Intergenic
1129273164 15:74429910-74429932 TTCAGCTTGCTCCCTCTTCCAGG + Intronic
1129289813 15:74556257-74556279 TCCATCTTTCTCCCTCTTCTTGG - Intronic
1129385006 15:75191593-75191615 CCCATCAAGACCCCTCTCCCTGG + Intergenic
1129768369 15:78184916-78184938 CCCATCTGTTTCCCTCTCTCAGG - Intronic
1130252383 15:82307945-82307967 CCCTTCTTCCTGCCTCTCACTGG - Intergenic
1130950915 15:88587006-88587028 ACCTTCTTGCTCCCCCTTCCTGG + Intergenic
1131054679 15:89368359-89368381 CCCAACCCCCTCCCTCTCCCCGG - Intergenic
1131064078 15:89422150-89422172 CACCTCTTTCTCCCTGTCCCTGG + Intergenic
1131397992 15:92101954-92101976 CCCATCGCCATCCCTCTCCCTGG + Intronic
1132897133 16:2234426-2234448 CCCATCCTGCTCCCTGGCCGTGG + Intronic
1133091958 16:3411655-3411677 TCCATCCTGATACCTCTCCCTGG + Intronic
1133512983 16:6478721-6478743 CCCTGCTCGCTCCCTCTCCTTGG - Intronic
1134600215 16:15527966-15527988 TCCATCTTTCTCCATCTCCATGG + Intronic
1134615932 16:15650871-15650893 CCCACCCTGCTCCCTCCCTCCGG + Intronic
1135065386 16:19305281-19305303 CCCATGCTGTTCCCTCTACCTGG - Intronic
1135237045 16:20766983-20767005 CCCACTTTGCTCTCACTCCCAGG - Intronic
1135547959 16:23378424-23378446 CACTTCCTGCTCCCTCTGCCCGG - Intronic
1135819500 16:25669970-25669992 CCCAACTCTCTCCCTCTCCTTGG + Intergenic
1136025599 16:27466470-27466492 CCCATTTTCTTCCCTCTCCTGGG + Intronic
1136127025 16:28191380-28191402 CCCATCTGCTTCCCTTTCCCAGG + Intronic
1136403762 16:30031589-30031611 CACCACTTACTCCCTCTCCCAGG - Intronic
1137900930 16:52268183-52268205 CCCATCTCTCTCCCTCTCCTCGG + Intergenic
1138346451 16:56323162-56323184 TCCAACTTGCCCCCTCTCACGGG - Intronic
1139953443 16:70682554-70682576 CCCATCTTGTCCCCTCCCCATGG - Intronic
1140219393 16:73032975-73032997 CCCATCCTGCTCCTGCTGCCTGG - Intronic
1140549114 16:75844792-75844814 CCCATTTTTCTACCTCTCCTTGG - Intergenic
1141067700 16:80927348-80927370 CCCACCTTGTTCCCACTGCCTGG - Intergenic
1141108515 16:81253081-81253103 AACATCTTGCTCCGTCACCCAGG - Intronic
1141349627 16:83282078-83282100 CCCATCTCTCTCCCTCTCCTTGG - Intronic
1141431148 16:83970694-83970716 TACATGTTGCTGCCTCTCCCTGG + Intronic
1141619177 16:85227765-85227787 CCCATCAATCTCCATCTCCCAGG - Intergenic
1141857019 16:86690009-86690031 CCCATCTCTCTCCCTATCCTTGG - Intergenic
1142196776 16:88742635-88742657 CCCATCCTGCTGCCACCCCCAGG - Intronic
1142778325 17:2159996-2160018 CCCATCCTACTCCCTGCCCCAGG - Intronic
1142850323 17:2701583-2701605 ACCCTCTTCCTCCCTCCCCCAGG + Intronic
1143014452 17:3884203-3884225 GCCATCTTCCACCCTCCCCCTGG + Intronic
1143802470 17:9395550-9395572 ACAGTCTTGCTCCGTCTCCCAGG - Intronic
1145713996 17:27002345-27002367 CCCATCTCTCTCCCTCTCCTCGG - Intergenic
1145751943 17:27361511-27361533 TCCATCCTGCTGCCTCTCCTTGG + Intergenic
1145863319 17:28225482-28225504 CCCTTCCAGCTTCCTCTCCCTGG - Intergenic
1145997344 17:29112212-29112234 CCCACATTGCTCTCACTCCCTGG + Intronic
1146374263 17:32283956-32283978 CCTTTCTTCCTCCGTCTCCCTGG - Intronic
1146689002 17:34860172-34860194 CCCATCTGGCTCCCTCTGACTGG + Intergenic
1146992063 17:37283405-37283427 CCCATCTCCTTCCCCCTCCCAGG - Exonic
1147049375 17:37780054-37780076 CCCATCTCTCTCCCACTCCTCGG + Intergenic
1147632260 17:41939724-41939746 CTCCTCTTGGCCCCTCTCCCTGG - Intronic
1147927632 17:43955236-43955258 CCCTTCCAGCTTCCTCTCCCTGG + Intronic
1148260847 17:46181846-46181868 CCTATGTTGCTACCTCTACCTGG + Intronic
1148463213 17:47849980-47850002 CTCCTCTCCCTCCCTCTCCCAGG - Intronic
1148470158 17:47888241-47888263 AGGATCTTGCTCTCTCTCCCAGG + Intergenic
1148696224 17:49560680-49560702 CACATCTCTCTCCCTCTCCTTGG + Intergenic
1148854717 17:50572484-50572506 CCCTTCCTGGGCCCTCTCCCTGG + Intronic
1148983444 17:51599484-51599506 GGCAGCTTGCTCCCTGTCCCTGG + Intergenic
1149299413 17:55290593-55290615 CCCATTTCTCTCCCTCTCCTTGG + Intronic
1149686811 17:58540497-58540519 CCCCACTTGCCCCCTCTACCAGG + Intronic
1150041213 17:61863401-61863423 CCCTTCCTCCTCCCTCTTCCTGG + Exonic
1150302797 17:64060195-64060217 GCCCTCTTGCTCCCTCCACCTGG + Intronic
1150509349 17:65733182-65733204 CCCATCTCTCTCCATCTCCTTGG - Intronic
1150630953 17:66880186-66880208 TCCATCTTGCTTCCTCTTCCAGG - Intronic
1151027423 17:70694948-70694970 TCCATCTTTCTCCCTCTCCTTGG + Intergenic
1151194736 17:72423534-72423556 ACCATCTTGCTCCATCTCCCTGG + Intergenic
1151308264 17:73277805-73277827 TCAGTCTTGCTCCGTCTCCCAGG - Intergenic
1151391712 17:73791601-73791623 CCCCTCTTGCTCCCTGTCCATGG + Intergenic
1151952492 17:77362933-77362955 CCTATCCTGTTCCCTCTGCCTGG - Intronic
1152044985 17:77929788-77929810 CCCATCCTTCTTCCTCTCCCAGG + Intergenic
1152103865 17:78317852-78317874 CCCACCTGGCTCCTTCACCCAGG - Intergenic
1152246687 17:79188225-79188247 CCCCTCTGCCTCCCTCTGCCAGG + Intronic
1152399341 17:80055848-80055870 CGCATCTTGCTCTGTTTCCCAGG + Intronic
1152412976 17:80139162-80139184 CCTGTCTTGCTCCCTGTCCCAGG - Exonic
1152762326 17:82115263-82115285 CCCCTCTTGCCCCCTCTTCCCGG - Intronic
1152897927 17:82923978-82924000 ACCCTCTTGCTCCATCACCCAGG + Intronic
1153126513 18:1798509-1798531 CCCACCTCTCTCCCTCTCCTTGG + Intergenic
1153189757 18:2524538-2524560 AGCATCTCGCTCTCTCTCCCAGG - Intergenic
1153270637 18:3317864-3317886 CTCATCTCTCTCCCTCTCCTCGG - Intergenic
1153566415 18:6422727-6422749 CCCATCTCTCTCCTTCTCCTTGG - Intergenic
1154127817 18:11708329-11708351 CCCATCTCTCTCCCTTTCCTGGG - Intronic
1154227643 18:12521926-12521948 CCCATCTCTCTCCCTCTCCTGGG + Intronic
1154305792 18:13229861-13229883 CACATCTTCCTCTGTCTCCCTGG - Intronic
1155177428 18:23313049-23313071 CACTGCATGCTCCCTCTCCCGGG - Intronic
1155266165 18:24095938-24095960 CCCTTCTTTCTCCCTCTCCTTGG - Intronic
1155305969 18:24478696-24478718 AGCATCTTGCTCTGTCTCCCAGG + Exonic
1155514790 18:26613845-26613867 CACATATTGTTCCCTCTGCCTGG + Intronic
1155626382 18:27839725-27839747 CCCATCTCTCTCCCTCTCTTTGG + Intergenic
1155824634 18:30424278-30424300 CCCATCTCTCTCCCTTTCCTTGG + Intergenic
1156147172 18:34197728-34197750 CCTATGTTGTTCCCTCTGCCAGG - Intronic
1156224521 18:35090704-35090726 CGAATCTTGCTCTGTCTCCCAGG - Intronic
1156284693 18:35680194-35680216 CTGATTTTGTTCCCTCTCCCTGG + Intronic
1156494916 18:37519334-37519356 CCCGACTTGCTGCATCTCCCAGG + Intronic
1157154822 18:45255197-45255219 CCAGACTTTCTCCCTCTCCCAGG + Intronic
1157575383 18:48739857-48739879 CCCGTCTTCCTCCCTTTCCCTGG + Intronic
1158009906 18:52716645-52716667 CCTATCTTCATCCCTCTTCCAGG - Intronic
1158677940 18:59539246-59539268 GCCATCTTGCTGGCTCTCCCTGG + Intronic
1158919188 18:62170557-62170579 CCCATCTCTCTCCCTCTCCTTGG + Intronic
1158937306 18:62376366-62376388 CCCCTCTTGCCTCCTCTCCTCGG - Intronic
1158978145 18:62731488-62731510 CCCATCTTTTTCCCTCTCCTGGG + Intronic
1159161434 18:64647153-64647175 GCCTTCATGCTCCCACTCCCTGG - Intergenic
1159175624 18:64829838-64829860 CCCATCTCTCTACCTCTCCCTGG - Intergenic
1159445013 18:68531493-68531515 CCTGTCTTGCTCTGTCTCCCAGG - Intergenic
1159925745 18:74267892-74267914 CCCACCTTTCTCCCTCTCTCTGG - Intronic
1160091798 18:75834083-75834105 CCCCTCTTCCTTCCTGTCCCTGG + Intergenic
1160476587 18:79195271-79195293 CTCATCTTGCTGTCTCGCCCAGG + Intronic
1160541634 18:79627218-79627240 CCCAGCTTGCTCGCTAGCCCCGG - Intergenic
1160692961 19:468338-468360 TCCATCTTGCTCCGTCGCCCAGG - Intronic
1160874590 19:1291149-1291171 CCCACCTTCCTGCCCCTCCCAGG - Intronic
1161013406 19:1970811-1970833 CCCATCCTGCGCTCTTTCCCAGG - Intronic
1161088431 19:2345532-2345554 CCCCTCTTTCTCATTCTCCCCGG + Intronic
1161088451 19:2345608-2345630 CCCATCTTCCTCATTCTTCCTGG + Intronic
1161088461 19:2345646-2345668 CCCCTCTTTCTCATTCTCCCCGG + Intronic
1161088482 19:2345722-2345744 CCCGTCTTTCTCATTCTCCCTGG + Intronic
1161088492 19:2345760-2345782 CCCCTCTTTCTCATTCTCCCTGG + Intronic
1161088504 19:2345798-2345820 CCCGTCTTTCTCATTCTCCCTGG + Intronic
1161195606 19:2984491-2984513 CGGATCATGCTCCGTCTCCCAGG + Intronic
1161309976 19:3588467-3588489 CCCATACAGCTCACTCTCCCTGG - Intronic
1161451065 19:4345684-4345706 CCCACCATGCCCTCTCTCCCGGG - Intronic
1161797613 19:6396327-6396349 CCCATCTCCCTCACTCTTCCTGG + Intergenic
1162554834 19:11380427-11380449 CCCATGCTGTTCCCTCTGCCTGG - Intronic
1162562371 19:11424089-11424111 CCTATCTGGATCCCCCTCCCCGG - Intronic
1162965694 19:14155038-14155060 CCCAAAGTCCTCCCTCTCCCAGG + Intronic
1164098982 19:22037318-22037340 CTCATCTTGCTCTGTCGCCCAGG - Intergenic
1164168282 19:22701274-22701296 TCCCTCTTCCTCCCTCTCCACGG - Intergenic
1164477650 19:28587416-28587438 CCCACCTTGCTGCCTCCCCAAGG - Intergenic
1164589564 19:29499137-29499159 CCCATCTTGCTCCACCTCTGTGG - Intergenic
1164678283 19:30117617-30117639 CCAATATTTCTCCCTGTCCCCGG - Intergenic
1165040165 19:33063388-33063410 GGCATCTTCCTCCTTCTCCCAGG - Intronic
1165087282 19:33359606-33359628 CCCATCTCTCTCCTGCTCCCAGG + Intergenic
1165506972 19:36239343-36239365 CCCATCTTGCTCTGTTGCCCAGG + Intronic
1165668624 19:37655586-37655608 CCCCTCTGGCTCCGTCTCCCCGG - Intronic
1165893881 19:39130207-39130229 CCCACCCTGATCCCTCTGCCTGG - Intronic
1166093246 19:40523664-40523686 CCCATCTTCTGCCCCCTCCCTGG - Intronic
1166333620 19:42092274-42092296 CCCATCTTTCTGTCTCTCTCTGG - Intronic
1166746016 19:45142224-45142246 CACATCCTGCTCACCCTCCCGGG - Intronic
1166751271 19:45165009-45165031 CCTGTCTTCCTCCCTCTTCCTGG - Intronic
1167326054 19:48826466-48826488 ACAATCTTGCTCCATCACCCAGG - Intronic
1167609172 19:50498256-50498278 CCCATCTCTCTGTCTCTCCCTGG - Intergenic
1167685063 19:50950864-50950886 ACAGTCTTGCTCTCTCTCCCAGG - Intronic
1168346243 19:55651478-55651500 CTCACCTCGCTGCCTCTCCCGGG - Exonic
1168354151 19:55691685-55691707 CCCAGCTTGGTCCCTGTCCCAGG + Intronic
1168499490 19:56881367-56881389 GTCATCTTGCTCTGTCTCCCAGG + Intergenic
925104176 2:1275598-1275620 CTCATCTCTCTTCCTCTCCCTGG + Intronic
925280969 2:2684195-2684217 GTCCTCTTCCTCCCTCTCCCTGG + Intergenic
925287913 2:2727727-2727749 CCCACCTGGCTCCCTCCTCCAGG - Intergenic
925606288 2:5663927-5663949 CCCATCTTGCTTGTCCTCCCGGG - Intergenic
925695043 2:6567606-6567628 CCCATCTTGTTCTCTCTCCCAGG + Intergenic
925767173 2:7247297-7247319 CCCTTCTTCCTGCCTCTCTCAGG + Intergenic
925871443 2:8274978-8275000 CTCATCTCTCTCCCTCTCCTAGG - Intergenic
925948336 2:8887400-8887422 CCCATCCTGTGCCCACTCCCCGG - Intronic
926057479 2:9782867-9782889 CTTCTCTTTCTCCCTCTCCCTGG + Intergenic
927810618 2:26178561-26178583 ACCATCTTGCTCTGTCTCCCAGG - Intronic
927839353 2:26429239-26429261 AGGATCTTGCTCCATCTCCCAGG + Intronic
927966506 2:27273230-27273252 ACCATGTTGTTCCCTCTGCCTGG - Intronic
928607557 2:32957451-32957473 CTCATCTCTCTCCCTTTCCCTGG - Intronic
929892467 2:45929711-45929733 CCCATCTTCCCCCCACCCCCAGG + Intronic
930068525 2:47346563-47346585 CCCAACTCCCTCCCTGTCCCAGG + Intronic
930092659 2:47542502-47542524 CCCTTCTTGCTCCCTTTCATGGG + Intronic
930917302 2:56708985-56709007 CCCACCTTCCTCCCTTTCCATGG - Intergenic
931275022 2:60736938-60736960 AAAATCTTGCTCCATCTCCCAGG + Intergenic
931407046 2:61989202-61989224 GCCATCTTGCTCTGCCTCCCAGG + Intronic
931417034 2:62091240-62091262 CCCATCCTTTTCCCTCTTCCTGG + Intronic
932337984 2:70941934-70941956 CCCACCTTCCACCCTCTCCTTGG - Exonic
932492716 2:72132089-72132111 CCTCCCTTGCTCCCCCTCCCTGG - Exonic
932650143 2:73546728-73546750 CCCATCTTCTTCCCTCTCGCCGG - Intronic
932805707 2:74780939-74780961 CACATTTTGCTCCCTCTTCCTGG - Intergenic
932955228 2:76344100-76344122 CCCAACTTTCTCCCTGTCTCAGG + Intergenic
933630113 2:84646289-84646311 CCCATCTCTCTCCTTCTCCTTGG + Intronic
933805573 2:85996391-85996413 CCTGTCTGCCTCCCTCTCCCAGG + Intergenic
933899501 2:86839576-86839598 CCCAGCCTGCTCCAGCTCCCTGG + Intronic
934068238 2:88359887-88359909 CCCCTATTCCTCCCTCACCCAGG - Intergenic
935538422 2:104321643-104321665 CCCATCTGTTTCCCTCTCACTGG + Intergenic
935608236 2:104992422-104992444 CTCATCTCTCTCCCTCTCCTTGG + Intergenic
935781061 2:106509650-106509672 CCCAGCCTGCTCCAGCTCCCTGG - Intergenic
936920180 2:117680546-117680568 CCCATCTCTCTTCCTCTCCTTGG + Intergenic
937181676 2:120002202-120002224 AGCATCTTGCTCTGTCTCCCAGG + Intergenic
937637552 2:124173185-124173207 CCTATCTCACTCCCTCTCCTTGG + Intronic
937754042 2:125515070-125515092 CCCATCTTCCTCTCTGTCCTTGG - Intergenic
938223438 2:129593545-129593567 CAAATCTTGCTCTGTCTCCCAGG - Intergenic
938386459 2:130870451-130870473 CCCTTCCTGCCCCCTCTCCTGGG - Intronic
938405479 2:131030675-131030697 CCCTTCTTACTGCCTCTCTCAGG - Intronic
938579211 2:132631086-132631108 CCCTTCTTTTTCCCTCTCCCTGG - Intronic
938678641 2:133665408-133665430 CCCATCTCTCTCCCTATCCTTGG - Intergenic
938685673 2:133735264-133735286 ACCATCACGCTCACTCTCCCAGG - Intergenic
939424695 2:142019810-142019832 CCCAAGTCACTCCCTCTCCCTGG + Intronic
939653366 2:144791390-144791412 CCCACCTCTCTCCCTCTCCTTGG - Intergenic
939868574 2:147502761-147502783 CACCTCTTGTTCCCTCTTCCTGG + Intergenic
939931341 2:148237468-148237490 CCCGTCTCTCTCCCTCTCCTTGG - Intronic
939967392 2:148623805-148623827 CCCAACTTCTTCACTCTCCCCGG - Intergenic
940184814 2:150972201-150972223 CTCATCTCTCTTCCTCTCCCTGG - Intergenic
940493344 2:154393043-154393065 TCCAACTTGCTCCATCTCCAAGG - Intronic
941591886 2:167430203-167430225 TCCATTCTGCTCCCTCTCTCTGG - Intergenic
942113739 2:172707268-172707290 CCAACCTTCCTCCCGCTCCCAGG - Intergenic
942258972 2:174138329-174138351 CCCATCTTTCTCCCTCTCCCGGG - Intronic
942614878 2:177781187-177781209 CCCATCTCTCTCCCTTTCCTTGG - Intronic
942908211 2:181208548-181208570 CCCATCTTTCAGCCTCTCCCAGG + Intergenic
942944300 2:181656712-181656734 CCGCGCTTCCTCCCTCTCCCCGG - Intronic
942956566 2:181781041-181781063 CCCAACTTCTTCCCTCTCCTGGG - Intergenic
943531667 2:189089881-189089903 CCCATCTCTCTTCCTCTCCATGG + Intronic
943695105 2:190918852-190918874 CCCATCTCTCTCCCTCTCCTTGG - Intronic
943740832 2:191406581-191406603 CCCATCTCTCTCCCTCTCCTCGG - Intronic
944048155 2:195437582-195437604 CGGATCTTGCTCCGTCGCCCAGG - Intergenic
944098661 2:195997487-195997509 TCCATCTTGCTCTGTCACCCAGG - Intronic
944623131 2:201539696-201539718 CCCATCTTTCTTCCTCTCCTTGG + Intronic
945160848 2:206888994-206889016 CCCATGTTATTCCCTCACCCTGG - Intergenic
945646788 2:212506240-212506262 CCCATCTCTCTCCCTCTCCTTGG + Intronic
946091648 2:217230448-217230470 CCCACCTCTCTCCCTCTCCCAGG - Intergenic
946337223 2:219046004-219046026 CCCTTCTTGATCCTCCTCCCTGG + Intergenic
946389770 2:219408492-219408514 CCGACCTTGCTCCTTCTCCAAGG - Intergenic
946555349 2:220850276-220850298 ACCATCTTGGTCTCTCTCCTGGG - Intergenic
947035491 2:225849243-225849265 CCCATTTTTCTCCCTCGCCTTGG - Intergenic
947238650 2:227970619-227970641 CCCCTCTTGCTCCAACTCCCTGG - Intergenic
947325552 2:228971996-228972018 CCCAAGTTTCTCCATCTCCCTGG + Intronic
947554012 2:231073092-231073114 CCCATCTCTCTCCTTCTCCTTGG - Intronic
947641212 2:231708839-231708861 CCGCTGTTGCTCCCTCTCGCGGG + Intronic
947654658 2:231816512-231816534 TCCATCTCTCTCCCTCTCCTTGG - Intergenic
947733267 2:232442472-232442494 CCCATGTGGCTTCCTGTCCCAGG + Intergenic
947754180 2:232549941-232549963 CCCATCTCTCTCCCTCTTCTTGG - Exonic
947911646 2:233804574-233804596 CCCATCTTTCTCCTCCTCCCAGG - Intronic
948173789 2:235927775-235927797 CTTCTCTTGCTCCTTCTCCCTGG - Intronic
948438251 2:237967928-237967950 CCCATCCTGCCCCCACTTCCAGG - Intronic
948681970 2:239641193-239641215 CCCATGGTTCTACCTCTCCCTGG - Intergenic
948782395 2:240329764-240329786 CCCATATTGGTCCCTGCCCCAGG - Intergenic
948796140 2:240402868-240402890 CCCCTCCTGCCCCCGCTCCCAGG + Intergenic
949042899 2:241857703-241857725 CCCACCTCGGCCCCTCTCCCGGG - Intronic
1169001638 20:2172224-2172246 CCCTCCCTGCTCCCTCTGCCTGG + Intronic
1169020206 20:2325450-2325472 CACAGCTTTCTCCCTCTGCCTGG - Intronic
1169193046 20:3669784-3669806 CCCTTCCTGCTCCCTCTTCAGGG + Intronic
1169322216 20:4642589-4642611 CCCATCTATCTCCCTCTACTGGG + Intergenic
1169408927 20:5350482-5350504 CACATGTTGCTGCGTCTCCCTGG + Intergenic
1169696017 20:8387367-8387389 CTTATCTTTCTCCCTCTCCTGGG - Intronic
1170280589 20:14642639-14642661 CCCATCTCTCTTCCTCTCCTTGG - Intronic
1170642703 20:18169592-18169614 CCCATGTTTCTCCCTCTCCTTGG + Intronic
1171235132 20:23518616-23518638 CCCATCTTGATGCATGTCCCAGG - Intergenic
1171251341 20:23651016-23651038 CCCATCTCTCTCCCTCTCCTCGG - Intergenic
1171313174 20:24162500-24162522 CCCGTCTCTCTCCCTCTCCTCGG + Intergenic
1171364280 20:24613221-24613243 GCCAACTTACTCCCTGTCCCAGG + Intronic
1171956555 20:31468261-31468283 CCCTTGATGCTCCCTCTACCTGG + Intronic
1172514126 20:35521427-35521449 CACACCTTGCTCCCTCTGCCTGG - Intergenic
1172600219 20:36178060-36178082 CCCACCCTGCTCCCTAGCCCAGG - Intronic
1172916863 20:38449818-38449840 CTCATGTTGCTACCCCTCCCTGG - Intergenic
1173497452 20:43529834-43529856 CCCACTTTGCTCCTTCTGCCTGG - Intronic
1174093103 20:48065575-48065597 GCCATCTCGCTCCACCTCCCAGG + Intergenic
1174138389 20:48396184-48396206 CCCATTTTATTCCCTCTACCTGG - Intergenic
1174187674 20:48718246-48718268 CACCTCTTGCTCCCACTTCCAGG + Intronic
1174194957 20:48766516-48766538 CCCAGCTTGCTCCTGCCCCCAGG + Intronic
1174322510 20:49753071-49753093 TCTTTCTTGCTGCCTCTCCCTGG - Intergenic
1174386384 20:50190573-50190595 CCCCTCTCGCTCCCAATCCCGGG + Intergenic
1174478747 20:50816049-50816071 CAGATCTTGCTCTGTCTCCCAGG + Intronic
1174692535 20:52521892-52521914 CCCATCTTTCTCCCTCTCTTCGG - Intergenic
1174755348 20:53153019-53153041 CACATGCTGCTCCCTTTCCCTGG - Intronic
1175167578 20:57055773-57055795 GCCTTCATGTTCCCTCTCCCAGG - Intergenic
1175465692 20:59190045-59190067 CCTCTCTTGCTCCCTCCCCTAGG + Intergenic
1175670713 20:60900614-60900636 CCCATCCTCCTCTCTCTCCTTGG - Intergenic
1175893771 20:62327126-62327148 CCCATGGAGCTCCCCCTCCCTGG + Intronic
1176156647 20:63625621-63625643 GCAATCTTGCTCCGTCACCCAGG + Intronic
1176194903 20:63832301-63832323 GCCACCTCGCTTCCTCTCCCCGG + Intergenic
1176270595 20:64233872-64233894 TCTCTTTTGCTCCCTCTCCCTGG - Intronic
1176735848 21:10546348-10546370 CCCATCTCTCTCCTTCTCCTTGG + Intronic
1177109340 21:17005789-17005811 TCCATCTCTCTCCCTCTCCATGG + Intergenic
1177265496 21:18778326-18778348 AGCATCTTGCTCTGTCTCCCAGG + Intergenic
1177527013 21:22306430-22306452 CCCTTCTTTCTTTCTCTCCCTGG - Intergenic
1178795727 21:35742552-35742574 CCCAGTTTCCTCCCTCCCCCAGG + Intronic
1179442906 21:41407969-41407991 CCCTTCTTTCTCCCTCTTCCAGG + Exonic
1181309817 22:21938519-21938541 CCCACCTTGTTCCTTTTCCCCGG + Intronic
1181646314 22:24233278-24233300 TCCAGCCTGGTCCCTCTCCCTGG + Intronic
1181934284 22:26428229-26428251 CCCACCTCCCTCCCTGTCCCAGG - Intergenic
1182028812 22:27141288-27141310 TCCATGCTGCTCCCTCTGCCTGG - Intergenic
1182219103 22:28743588-28743610 CCCATCTTGCTCCCACCTCGAGG + Intronic
1182425086 22:30267440-30267462 CCCATCGTGCACCCTCTGCCAGG + Intergenic
1182594090 22:31404645-31404667 AGCATCTTGCTCTGTCTCCCAGG + Intronic
1183356246 22:37361378-37361400 CCCACCTTCCTCCCACCCCCAGG + Intergenic
1183516976 22:38272564-38272586 TCCATCCGCCTCCCTCTCCCGGG + Intronic
1183533303 22:38376522-38376544 CCCATCTCTCTCCTTCTCCTTGG - Intronic
1183735564 22:39643001-39643023 CCCTTCCTGCTCCCTCATCCCGG - Intronic
1183875401 22:40775974-40775996 CACATCATGCTCCCCCTGCCTGG + Intronic
1183987001 22:41575501-41575523 CCCCTCTTCCTGCCTCTCCATGG - Exonic
1184157313 22:42676557-42676579 CTCATCCTGTTCCCTGTCCCAGG - Intergenic
1184471272 22:44697678-44697700 TCCATCTCGCCCACTCTCCCCGG - Intronic
1184672954 22:46025182-46025204 ACCCTCTTGCTCCCTCTGCCTGG + Intergenic
1184672981 22:46025321-46025343 ACCCTCTTGCTCCCTCTCCCTGG + Intergenic
1184673001 22:46025426-46025448 ACCCTCTTGCTCCCTCTCCCTGG + Intergenic
1184673026 22:46025544-46025566 ACCCTCTTGCTCCCTCTCCCTGG + Intergenic
1184673046 22:46025649-46025671 ACCCTCTTGCTCTCTCTCCCTGG + Intergenic
1184831211 22:46989545-46989567 CCCATCTCTCTCCCTCTCCTCGG - Intronic
1185297152 22:50060013-50060035 CCCATCCAGCTGCATCTCCCAGG + Exonic
1185372523 22:50467646-50467668 CCCCTCTTCCTCCCTCTCTGTGG + Exonic
1185408897 22:50672678-50672700 CCCATCCTGCCCCCTCCCCTGGG + Intergenic
949966769 3:9363258-9363280 CCCATCTTGCTCCCTCTCCCAGG + Exonic
950050099 3:9981974-9981996 CTCATCTTGCTCTGTCACCCAGG + Intronic
950315009 3:11994273-11994295 CCCATCTTTCTCCCTCTCCTTGG - Intergenic
950369613 3:12517746-12517768 CCCACCCTGCTTCCTCTCGCGGG + Intronic
950468714 3:13171755-13171777 CAAATCCTCCTCCCTCTCCCTGG + Intergenic
950545675 3:13636625-13636647 CCCATCTCTCAGCCTCTCCCTGG - Intronic
950584920 3:13885475-13885497 CCCATTTAGCTCCCTCTGCCTGG + Intergenic
950649143 3:14396424-14396446 CCTGTCTTGCTCCCTGCCCCAGG - Intergenic
950884590 3:16352247-16352269 TCCATGTTTATCCCTCTCCCTGG - Intronic
950976357 3:17249773-17249795 CTCATCTTTCTCCCTTTCCTTGG - Intronic
951124179 3:18963866-18963888 CTGATCTTGCTCTGTCTCCCGGG + Intergenic
951527934 3:23671722-23671744 CCCACCTCGCCCCCTCTTCCTGG + Intergenic
952513212 3:34077652-34077674 CACATCTGGATCTCTCTCCCAGG + Intergenic
952667420 3:35923105-35923127 GTCATCTTGCTCTCTGTCCCAGG + Intergenic
952826635 3:37530099-37530121 CCCACCTTGCTTCCTCTCTTAGG - Intronic
952858946 3:37796145-37796167 CACATCATGTTCCCTCTCCTTGG + Intronic
952968108 3:38633394-38633416 CCCACCCTGCTCTCTGTCCCTGG - Intronic
953306313 3:41833319-41833341 GCCATCTTGCTCTGTCGCCCAGG + Intronic
953411816 3:42694714-42694736 CCCTTGTTGTTCCCTCTACCTGG + Intronic
954001712 3:47562761-47562783 CCCAACTTTTTCCCTCTTCCAGG - Exonic
954292600 3:49657706-49657728 CCCATCTGGCTCCGTCTGGCAGG - Exonic
954373212 3:50180584-50180606 CCCATCTCTCTCCCTCTTCTTGG - Intronic
954413316 3:50380730-50380752 CCCTTCTTGCTCGCTCACCAGGG + Exonic
954798980 3:53176101-53176123 CCCAACTGGCCCTCTCTCCCTGG + Intronic
954905489 3:54058981-54059003 TCCATGCTGCTCCCTCTTCCTGG + Intergenic
955036138 3:55269943-55269965 CCCATCCTTCTCTCTCTGCCTGG - Intergenic
955101814 3:55857715-55857737 CCCAGCTTTCTCTCTCTCCAAGG - Intronic
955352051 3:58200899-58200921 CCCTTCCTCCTCCCCCTCCCTGG + Intronic
955861294 3:63333282-63333304 CCCCTCCTGCTCCCTCTCTGGGG + Intronic
955905615 3:63804493-63804515 CACATGCTGCTCCCTCTGCCTGG + Intergenic
956942186 3:74176004-74176026 CCCATCTTTCTCCCTGTCTTGGG - Intergenic
959383856 3:105676883-105676905 CCCTGCTTGCTCACTCTCTCTGG + Intronic
959716734 3:109442167-109442189 GCCATCTTGCTCCACCTCCTTGG - Intergenic
959746508 3:109781362-109781384 CCCACCTTCCTCCCTCCACCCGG - Intergenic
959821210 3:110737458-110737480 CCCATTTTTCTTCCTCTCCTTGG - Intergenic
960644079 3:119858873-119858895 CCCATCTCTCTCCCTCTTCTTGG - Intronic
960965317 3:123100420-123100442 CCCAGCTTGCCCCTTCTCTCTGG + Intronic
960973281 3:123154268-123154290 CCCTTGATGCTCCCTGTCCCAGG - Intronic
961314620 3:126026139-126026161 CCCACCTTGTGCCCTCACCCAGG - Intronic
961315566 3:126033059-126033081 CACATCCTTCTCCTTCTCCCAGG - Intronic
961529873 3:127533894-127533916 CCCAGCTTCCTCCCTTGCCCTGG + Intergenic
962033479 3:131626098-131626120 CCCATCTCTCTCCCTCTCCTTGG + Intronic
962157433 3:132962950-132962972 CCCATCTATCTCCCTCTCCTTGG - Intergenic
962393222 3:134991735-134991757 CCAATATTGATCCCTCTGCCTGG + Intronic
962551043 3:136491965-136491987 ACAATCTTGCTCTGTCTCCCAGG - Intronic
962827136 3:139108236-139108258 CCCAGCCTGCTCTCTCTGCCAGG + Intronic
962902525 3:139773835-139773857 CACATGTTGTTCCCTCTGCCTGG - Intergenic
963231999 3:142917152-142917174 GGCATCTTGCTCTGTCTCCCAGG + Intergenic
963530773 3:146470520-146470542 CGAGTCTTGCTCTCTCTCCCAGG - Intronic
963773256 3:149411164-149411186 CCCATCTCTCTCCCTCTCCTTGG - Intergenic
964400398 3:156291788-156291810 CCCTCCTTGCTCCCCCTTCCTGG - Intronic
965010722 3:163085951-163085973 TTCATATTGCTCCCTCTTCCTGG + Intergenic
965255673 3:166406654-166406676 TCCATCTCTCTCCCTCTCCTAGG - Intergenic
966023963 3:175252474-175252496 GCCATCTCCCTCCCTCTCCTGGG + Intronic
966086283 3:176070665-176070687 CCTTACTTGCTCCCTCTCTCCGG + Intergenic
966206925 3:177414419-177414441 CCCAGCATGCTCCTACTCCCTGG + Intergenic
966746419 3:183281459-183281481 CCCTATTTGCTCCATCTCCCTGG + Intronic
966837512 3:184060192-184060214 CCCATCTGGCTCGGTCTCTCTGG - Exonic
966840629 3:184084116-184084138 CCCATCTAGCTCAGTCTCTCCGG - Intergenic
966995824 3:185279343-185279365 CCCATCTCTGTCCCTCTCCTAGG - Intronic
967228152 3:187312735-187312757 GCCATCTCTCTCCCTCTTCCAGG + Intergenic
967902565 3:194471377-194471399 AGCATCTTGCTCTGTCTCCCAGG + Intronic
968056800 3:195697890-195697912 CCCATGTCTCTCCCTCTTCCTGG + Intergenic
968062546 3:195737020-195737042 CCCATCATGATTCCTCCCCCTGG + Intronic
968293543 3:197556188-197556210 CGCACCTGGCTCCATCTCCCTGG - Intronic
968584768 4:1411118-1411140 CGCGGCTGGCTCCCTCTCCCGGG + Intergenic
968947604 4:3673809-3673831 CCCATGTTGCTCCCACACCGAGG + Intergenic
969347278 4:6577216-6577238 CCCATCCTGCTCCCGCACCAGGG + Intronic
969375466 4:6760712-6760734 CCCATCCTGCTCCACCTCCTGGG + Intergenic
969612557 4:8235521-8235543 CACAGCTTTCTCCCGCTCCCAGG - Exonic
969648806 4:8450744-8450766 CCCATCTTCCTCCCCGTCCTAGG + Intronic
970351101 4:15202562-15202584 CTCACCTTGTTCCCTCTCCAGGG - Intergenic
970372303 4:15420173-15420195 CCCAGCTTTCTCACTCTCCAAGG + Intronic
970465718 4:16321114-16321136 CCCATCTTGCTCCCTTGGCTTGG - Intergenic
970998177 4:22291868-22291890 CACATCTTGCTCCTCCTCTCAGG + Intergenic
971892163 4:32538748-32538770 CCATTCCTGCTGCCTCTCCCAGG - Intergenic
972189349 4:36571162-36571184 CCCATCTCTCCCCCTCTCCTTGG - Intergenic
972768963 4:42178219-42178241 CCCATCTCTCTCCCTCTCCTTGG - Intergenic
973901195 4:55473902-55473924 CCCATCCCTCTCCCTCTCCTTGG + Intronic
974594121 4:63995178-63995200 CCCATCTTTTTCCCTCTTCCTGG + Intergenic
974627319 4:64442047-64442069 CCCATCTTTTTCCCTCTTCCTGG + Intergenic
974791735 4:66699398-66699420 CCCATCTCTCTCCCTTTTCCAGG - Intergenic
975138588 4:70898318-70898340 CACTTCTTCCTCCGTCTCCCAGG + Intergenic
975250720 4:72175100-72175122 CCCATCCTTTTCCCTCTTCCTGG - Intergenic
975906947 4:79224657-79224679 AACATATTGCTCCCTCTCTCTGG - Intergenic
976234070 4:82877197-82877219 AGCGTCTTGCTCCCTCTGCCAGG - Intronic
976591232 4:86851536-86851558 GTCACCTTTCTCCCTCTCCCAGG - Intergenic
976794263 4:88914504-88914526 CCCTTCTTATTCCTTCTCCCTGG + Intronic
977852847 4:101850907-101850929 CCCATCTCTCTCCCTCTGCTTGG + Intronic
978079782 4:104578068-104578090 CCCACCTTGCTCTCTGTCCCCGG - Intergenic
978238862 4:106492027-106492049 CCCATCCTGTTCCTCCTCCCTGG - Intergenic
978294768 4:107192116-107192138 CCCATATTGCTCTCTATGCCTGG + Intronic
978724611 4:111955815-111955837 GCCATCTTGCTCCCACCACCAGG + Intergenic
979307727 4:119166934-119166956 CCCATCTCTCTCCCTTTCCTGGG + Intronic
979323735 4:119354617-119354639 CCAATCTTGCTCTGTCTCTCAGG + Intergenic
979729452 4:124006393-124006415 CCCATCTCTCTCCCTCTCTTTGG - Intergenic
979823238 4:125200548-125200570 CCCGTCTCTCTCCCTCTCCTCGG + Intergenic
980381955 4:132033671-132033693 ACAGTCTTGCTCCATCTCCCAGG + Intergenic
980616349 4:135230481-135230503 CCCATTTTTCTCCATCTCTCTGG + Intergenic
981191392 4:141868979-141869001 CTCATCTCTCTCCCTCTCCTTGG - Intergenic
981462117 4:145025484-145025506 CCCATCTCCCTCCCTCTCCTTGG - Intronic
981677012 4:147353956-147353978 CCCATCTTGCTCTGTCTCATGGG + Intergenic
981924492 4:150123358-150123380 CTCATCTCTCTCCCTCTCCTTGG - Intronic
982021712 4:151211345-151211367 CCCATCTTTTCCCCTCTCCTTGG + Intronic
982490664 4:156025417-156025439 AGCGTCTTGCTCCGTCTCCCAGG - Intergenic
982681692 4:158438771-158438793 CCCATCTCTCTTCCTCTCCTCGG + Intronic
983609993 4:169632202-169632224 CCTTTGTTGCTCCCTCTGCCTGG - Intronic
983906203 4:173184615-173184637 CCCCTCCCTCTCCCTCTCCCTGG - Intronic
984596023 4:181668796-181668818 CCCTTGCTGCTCCTTCTCCCTGG + Intergenic
984952526 4:185018026-185018048 CCCCTCCTGCTCCCTCTTCGCGG - Intergenic
985430244 4:189872243-189872265 CCCATCTCTCTTCCTCTCCTTGG + Intergenic
985789364 5:1916886-1916908 CCCATGTCCCTCCCTCTCCAGGG - Intergenic
986029479 5:3881511-3881533 CCAATCATGCTTCCTCTCTCTGG - Intergenic
986172644 5:5326685-5326707 CCCACCCTGTGCCCTCTCCCTGG + Intergenic
987206788 5:15635585-15635607 CCTATATTGCTCCCTCTTCATGG - Intronic
987293892 5:16533416-16533438 CCCATCCTTCTCCATCTCCCAGG + Intronic
987808652 5:22804381-22804403 CCCATCCTTCTCTCTCTCACAGG - Intronic
988239518 5:28591414-28591436 ACCATCTTGCTCTGTCACCCAGG - Intergenic
988440384 5:31226643-31226665 CCCTTTTTGCCTCCTCTCCCAGG + Intronic
989014446 5:36913414-36913436 ACTGTCTTGCTCCGTCTCCCAGG + Intronic
989128575 5:38081005-38081027 CCCATCTTTCTCCCTCTCCTTGG + Intergenic
989303487 5:39923035-39923057 CCCATCTGTCTCCCTCTCCTTGG - Intergenic
989814721 5:45722268-45722290 TTCATCTTGCTCTGTCTCCCAGG + Intergenic
990145435 5:52754660-52754682 CCCATGCTGCTCACTCTTCCTGG - Intergenic
990697488 5:58436879-58436901 CCCATCTCTCTCCCTCTCCTTGG - Intergenic
990716724 5:58645804-58645826 CTCATTCTGCTCCCTCTGCCTGG - Intronic
990885933 5:60593488-60593510 CCCATCACTCTCCCTCTCCTTGG + Intergenic
991251184 5:64563035-64563057 TCCTGCTTGCACCCTCTCCCTGG + Intronic
991336238 5:65550421-65550443 CCCATCTCTCTCCCTCTCCTTGG - Intronic
991479547 5:67062370-67062392 ACCATCTTGCTCTGTCGCCCAGG - Intronic
993307798 5:86292207-86292229 TCCCTCTTGCTCACTTTCCCTGG + Intergenic
993596288 5:89860193-89860215 CCCATCTCTCTTCCTCTCCTAGG - Intergenic
994625953 5:102219246-102219268 CCCATCTATCTCCCTGTCCTCGG - Intergenic
994894102 5:105679215-105679237 CCTATATTTCTCCCTGTCCCCGG - Intergenic
995741605 5:115361639-115361661 CCCATCTCTTTCCCTCTCCTTGG - Intergenic
996974301 5:129412251-129412273 GGCATCTTGCTCTGTCTCCCAGG + Intergenic
997274296 5:132571011-132571033 CCCGTCTCTCTCCCTCTCCTTGG - Intronic
997577241 5:134989998-134990020 TCCATCTCTCTCCCTCTCCTGGG - Intronic
997786404 5:136717847-136717869 CACATGCTGTTCCCTCTCCCAGG - Intergenic
998146775 5:139733655-139733677 CACAGCTTGTTCCCTCTGCCTGG - Intergenic
998365500 5:141628187-141628209 CCCATCTTTGGCCCTCTCCCAGG - Exonic
998458532 5:142292431-142292453 CACATGCTGCTCCCTCTGCCTGG - Intergenic
998597168 5:143544042-143544064 CCCATTCTGCTCCCTCTGCTTGG + Intergenic
998719118 5:144923164-144923186 TCCATCTCTCTCCCTCTCCTAGG + Intergenic
998814547 5:145999628-145999650 CCCATCTCTCTCCCTCTCCTTGG - Intronic
998863658 5:146472572-146472594 CCCATCTCTCTTCCTCTCCTCGG + Intronic
999129321 5:149271269-149271291 CCTCTCTTTCTCCCTTTCCCAGG + Intergenic
999361834 5:150992214-150992236 CCTCTCTTCCTCCCTCACCCTGG - Intergenic
999524653 5:152391383-152391405 CCCATCTTGGTCCCTCTCCATGG - Intergenic
999670998 5:153959184-153959206 TCTATGTGGCTCCCTCTCCCAGG - Intergenic
999892704 5:155996277-155996299 CCCATCCTTCACCCTCACCCAGG + Intronic
1000141535 5:158409155-158409177 CCCAGTTTGATACCTCTCCCTGG + Intergenic
1000389261 5:160706009-160706031 CCCATCTCTCTCCCTCTTCGTGG - Intronic
1000434853 5:161195921-161195943 CCCATCTGGTTCTCTCTCCATGG + Intergenic
1000542529 5:162557991-162558013 CCCATCTCCCTCCATCTCCCGGG - Intergenic
1001008002 5:168072045-168072067 CCCAGTTTGCTCCCTCTTCTTGG + Intronic
1001183274 5:169541255-169541277 CCCATCTCTCTTCCTCTCCTTGG + Intergenic
1001273642 5:170334274-170334296 CTCATCTTTCTCCCTGTCCGCGG - Intergenic
1001557070 5:172643898-172643920 CACTTCCTGATCCCTCTCCCCGG + Intronic
1001570668 5:172728532-172728554 CCTCTCTTGCTCTCTCTGCCTGG - Intergenic
1001843790 5:174903305-174903327 CCCTTCTTTCTCTCTATCCCTGG + Intergenic
1002295227 5:178227019-178227041 CCCCTCTGGCTCGCTCTCCCAGG - Intronic
1002791631 6:441552-441574 CCCATCTTGCCAGCTCACCCAGG + Intergenic
1003659883 6:8050363-8050385 CCCATCTCTTTCCCTCTCCTTGG + Intronic
1004371587 6:15057264-15057286 CCCATCTCTCTCCCTCTCTTTGG - Intergenic
1004566803 6:16805548-16805570 CACATCATGCTGCCTCTCTCTGG + Intergenic
1004934156 6:20491422-20491444 CCCATCGTGCTTCCATTCCCAGG + Exonic
1005078584 6:21933790-21933812 GGAATCTTGCTCTCTCTCCCAGG + Intergenic
1005312319 6:24570560-24570582 CGGATCTTGCTCTGTCTCCCAGG - Intronic
1006444220 6:34069830-34069852 CACATGCTGCTCCCTCTGCCAGG + Intronic
1006507188 6:34496972-34496994 CTCATCTTGCTCTGTCACCCAGG + Intronic
1006671470 6:35732066-35732088 CCGGTCTTGCTCTCCCTCCCCGG - Intergenic
1006684511 6:35821276-35821298 TCAGTCTTGCTCTCTCTCCCAGG - Intronic
1007344944 6:41222454-41222476 CCCAGCCTGCTCCCTCCTCCTGG - Intergenic
1007366547 6:41398130-41398152 CCCTTATTGCTCCTTCTCCTTGG - Intergenic
1007856788 6:44865882-44865904 CCCATCTTGAGTCCTCTCCTTGG - Intronic
1008087817 6:47262787-47262809 CTCCTCTTGGTCCCTCTCCCTGG - Intronic
1008390749 6:50948615-50948637 CCCATCTTTCTCCCTCTTATGGG + Intergenic
1010288831 6:74112048-74112070 TTCATCTTTCTCCTTCTCCCTGG + Intergenic
1010357334 6:74949176-74949198 CTTATGTTGCTCCCTTTCCCTGG - Intergenic
1011029414 6:82905483-82905505 CCTGTCTTTCTCCCTCTCCTAGG + Intronic
1011644622 6:89446003-89446025 CCCATCTCTCTCCCTCTCTTTGG + Intronic
1011653595 6:89529785-89529807 CCCTTCTCTCTCCCTCTCCTTGG - Intronic
1011657531 6:89565298-89565320 CCCATCCTGCTCCTGCTCACTGG - Intronic
1011771359 6:90676861-90676883 CCCATCTCACTGCCTCTCTCTGG - Intergenic
1011794410 6:90936925-90936947 CCCGTCTAGCTCCCAATCCCTGG - Intergenic
1011935605 6:92772790-92772812 CCCATCTTTCTCACTCTCTTTGG - Intergenic
1011955130 6:93016686-93016708 CCCATGTTGGTCCCTCCCCTGGG + Intergenic
1011976910 6:93312883-93312905 CCTATCTCACTCCCTCTCCTTGG - Intronic
1012365858 6:98439184-98439206 CCCATCTTTTTCCCTCTGCTCGG - Intergenic
1012392601 6:98759990-98760012 TCCATCTTTCTCCCTCTTCTTGG + Intergenic
1012704306 6:102501769-102501791 TCCTCCTTGCTCCCTATCCCTGG + Intergenic
1012720618 6:102737824-102737846 ACCATCTTGCTCTCTAGCCCAGG + Intergenic
1012988762 6:105903442-105903464 CCCAGCCTGCTCCATCACCCAGG + Intergenic
1013172639 6:107650685-107650707 CCCATCTTTCTCCTTCTCCTTGG + Intronic
1013493488 6:110674234-110674256 CCCATCTTTCTCCCTCTCTTCGG + Intronic
1013665740 6:112346450-112346472 ACAATCTTGCTCTGTCTCCCAGG - Intergenic
1013819061 6:114133913-114133935 CCAGTCTTGCTCCCTCTGCCTGG - Intronic
1013823763 6:114186076-114186098 CCTATCTCGCTTCCTCTCCTTGG + Intronic
1014083858 6:117318793-117318815 ACCATCTTTCCTCCTCTCCCTGG + Intronic
1014509012 6:122297375-122297397 CCCATCTCTCTCCCTCTCCTTGG - Intergenic
1014742439 6:125161626-125161648 CCTATCTCTCTCCCTGTCCCTGG - Intronic
1015337023 6:132051031-132051053 CCCATCTCGCTCCCTCTCCTTGG + Intergenic
1016220364 6:141661705-141661727 CCCATCTCTCTCCCTCTCCTTGG - Intergenic
1016754482 6:147668800-147668822 ACAGTCTTGCTCCATCTCCCAGG - Intronic
1017140461 6:151184934-151184956 GCAATCTTGCTCCATCACCCAGG - Intergenic
1017326037 6:153142356-153142378 ACGATCTTGCTCCCGCTCCCAGG - Intergenic
1017509933 6:155105183-155105205 CCTGTCTTGCTCTGTCTCCCAGG + Intronic
1017799570 6:157881349-157881371 CTCGTCTTTCTCCCTCTCCTTGG + Intronic
1018076595 6:160221698-160221720 CCCATCTCTCTCCCTCTCCTTGG - Intronic
1018271458 6:162082786-162082808 CACATCTCTCTCCCTCTCCTTGG - Intronic
1018468041 6:164069725-164069747 GTCATCTTGTTCCCTCTCCAGGG - Intergenic
1018881407 6:167885494-167885516 CCCATCTCTCTACCTCTCCTTGG - Intronic
1019230675 6:170559123-170559145 CCCATCTCTCTCCCTCTGCTTGG + Intronic
1019780762 7:2938460-2938482 CCCACATTGCTCCCACCCCCAGG + Intronic
1020084120 7:5301492-5301514 CACATGCTGCTCCCTCTTCCTGG - Intronic
1020090877 7:5339940-5339962 CTCATCTCTCTCCCTCTCCTTGG + Intronic
1021472234 7:21017083-21017105 CCCATCTTTCTCCCTCTCCTTGG - Intergenic
1021528842 7:21620375-21620397 CTCCTCTTGCCCCCTCCCCCCGG + Intronic
1021682956 7:23153345-23153367 ACTATCTTTCTCCCTCACCCAGG - Intronic
1022175760 7:27870310-27870332 CCCAACTTGCTCACTGCCCCTGG + Intronic
1022417557 7:30191036-30191058 CCCACGCTCCTCCCTCTCCCTGG - Intergenic
1023026079 7:36050960-36050982 CCCATCTCTCTCCCTCTCCTTGG + Intergenic
1023476893 7:40590214-40590236 CCCATCTCTCTCCCTCTCATTGG + Intronic
1023727438 7:43158715-43158737 CCCACCCAGCTACCTCTCCCTGG + Intronic
1024249045 7:47492495-47492517 CCCAGGCTGCTCCCTCTGCCTGG + Intronic
1024336702 7:48215267-48215289 CCCATCTCTCTTCCTCTCCTCGG - Intronic
1024514242 7:50231146-50231168 TCCATCGTACTCCCTCTGCCTGG + Intergenic
1024865659 7:53903128-53903150 GCCATCTTGCTCCGACTTCCGGG + Intergenic
1025702666 7:63834284-63834306 TCCCTCATGGTCCCTCTCCCAGG - Intergenic
1025968736 7:66301652-66301674 CCCATCTCTCTCCCTCTCCTTGG - Intronic
1026171882 7:67961071-67961093 CTCCTCATGGTCCCTCTCCCAGG - Intergenic
1026365025 7:69639669-69639691 TCCGTCTTGCTCCCTTTTCCTGG + Intronic
1026390001 7:69891134-69891156 CCCTTCTTCCTATCTCTCCCAGG + Intronic
1026575888 7:71571263-71571285 CCCTTCTTTCTCCCTCCCTCAGG + Exonic
1026642154 7:72136804-72136826 CCTATCTGTCTCCCTCTCCTTGG - Intronic
1026806502 7:73432649-73432671 CCCATCTTGCCCCATCAGCCTGG - Intergenic
1026873190 7:73865555-73865577 CCCATCTGTCTCCCTGTTCCAGG + Exonic
1027135972 7:75624234-75624256 CCCAGCTTGTTCTCACTCCCTGG - Intronic
1028064941 7:86372083-86372105 CCCATCTCTCTCACTCTCCTCGG + Intergenic
1028241416 7:88425539-88425561 CACCTCTTGCTCCCTGTCCCAGG - Intergenic
1028796253 7:94907624-94907646 TCCCTCTCTCTCCCTCTCCCGGG + Exonic
1029023294 7:97387958-97387980 CCCATTTTGCTCCCTACCCATGG - Intergenic
1029456864 7:100675973-100675995 CCAATCTTCCTCCCGCCCCCCGG - Intronic
1029604162 7:101588591-101588613 CACACTTTGCTCCCTCTGCCAGG - Intergenic
1029607475 7:101607894-101607916 CTCATGCTGCTCCCTCTACCTGG - Intergenic
1030076112 7:105738336-105738358 CCCATGTTGCTCCCACCACCAGG + Intronic
1030363709 7:108623101-108623123 CACATCATGCTCTCTTTCCCAGG + Intergenic
1030755760 7:113285871-113285893 CCCATCTTACTCACTCTCTCTGG - Intergenic
1032448100 7:132001969-132001991 CACATGCTGCTCCCTCTGCCTGG - Intergenic
1032451468 7:132035396-132035418 CCCGTCCTGCACCCACTCCCAGG + Intergenic
1032769045 7:135029887-135029909 CCCATCTTTCTCCCTTTCCTTGG - Intronic
1032861758 7:135886454-135886476 CCCATCTCTCTCCCTCTCCTTGG + Intergenic
1033219611 7:139519795-139519817 ACCATCTGGCTCTATCTCCCAGG + Intergenic
1033571703 7:142635814-142635836 CGGATCTTGCTCTGTCTCCCAGG - Intergenic
1033912413 7:146281015-146281037 GCCATCTTGCTCCCTCTGTGAGG + Intronic
1034054699 7:148022023-148022045 CTTATCTTGCTCTCTCTCCCTGG + Intronic
1034404453 7:150892988-150893010 CACATCTATCTCCCTCTCCTTGG + Intergenic
1034436789 7:151066389-151066411 CCCTCCTAGCTCCCACTCCCGGG - Intronic
1034488917 7:151382470-151382492 CCCAGGTGGCTGCCTCTCCCTGG + Intronic
1035480037 7:159174950-159174972 CCCATCTCTCTCCCACTCCTTGG - Intergenic
1035655826 8:1303879-1303901 CCCATCTCCCTCCACCTCCCAGG - Intergenic
1035825702 8:2642343-2642365 ACAATCTTGCTCTCTCACCCAGG + Intergenic
1035897992 8:3425560-3425582 CGAATCTTGCTCTCTCTCCCAGG - Intronic
1037303721 8:17482423-17482445 CCCATCTTTCTCCCTCTCCTTGG + Intergenic
1037609613 8:20465083-20465105 TCTTTCTTGCTCCCTCTCTCAGG - Intergenic
1037905492 8:22713836-22713858 GCCTTCTCGCTCCCGCTCCCGGG + Intronic
1037914270 8:22763028-22763050 CGGGTCTTGCTCTCTCTCCCAGG + Intronic
1038423672 8:27451151-27451173 CCCAACTTGCTCCTACCCCCAGG + Intronic
1038472585 8:27837890-27837912 CCGTTCCTCCTCCCTCTCCCAGG + Exonic
1038845083 8:31221664-31221686 CCCATCATAATCTCTCTCCCTGG - Intergenic
1039603422 8:38861453-38861475 TCCATCTCTCTCCCTCTCCTTGG + Intergenic
1039805008 8:40990285-40990307 CTCCTCTTGCTCCCTCTGCCTGG - Intergenic
1040582491 8:48708842-48708864 CCCTCCTTGCCCTCTCTCCCAGG - Intergenic
1040737284 8:50523540-50523562 CCCATCTCTCTCCCTCTCCTTGG - Intronic
1040841071 8:51785721-51785743 CCCATCTCTCTCCCTCTCCTTGG + Intronic
1041372558 8:57178086-57178108 CCCATCTCGCTCCCTCTTTTGGG - Intergenic
1041465160 8:58151029-58151051 TCCTCCTTGCTCCCTCTCCTTGG - Intronic
1041476007 8:58266702-58266724 TCCATCTCTCTTCCTCTCCCCGG - Intergenic
1044361749 8:91293671-91293693 CCCATCTTCCTCCAAATCCCAGG + Intronic
1044639954 8:94368796-94368818 CCCATCTCTCTCCCTCTCCTTGG + Intergenic
1044668981 8:94659451-94659473 CCCATCTCTCTCCCTCTCCTTGG + Intronic
1044707232 8:95020581-95020603 CCCCTCTTGCTCCCTTAGCCAGG + Intronic
1045563540 8:103289976-103289998 CCCATCTCTCTCCCTCTCCTTGG - Intergenic
1046534098 8:115486327-115486349 CTCATCTCTCTCCCTCTCCAAGG + Intronic
1046784038 8:118246827-118246849 CACATGTTGTTCCCTCTACCTGG - Intronic
1046841168 8:118858635-118858657 CACTTGCTGCTCCCTCTCCCTGG + Intergenic
1046849453 8:118955737-118955759 CCCACCTTGCTTCCTCCCACTGG - Intergenic
1047362786 8:124184349-124184371 CTCCTCTTGATGCCTCTCCCTGG - Intergenic
1047888792 8:129283451-129283473 ACCATCTCTCTCCCTCTCCTTGG + Intergenic
1048046267 8:130776041-130776063 CCAATCTTGCTGCTTCTCCTTGG - Intergenic
1048440030 8:134452996-134453018 CCCATGTAGCCCACTCTCCCTGG - Intergenic
1048902469 8:139051947-139051969 CCCATCTCTCTCCATCTCCTTGG + Intergenic
1048923838 8:139253289-139253311 CCCCTCCTCCTCCCTGTCCCTGG + Intergenic
1049239658 8:141530716-141530738 CGCAGCTTTCACCCTCTCCCTGG - Intergenic
1049284767 8:141768603-141768625 GGCATCTTGCCCCCTCTCACAGG + Intergenic
1049314184 8:141951268-141951290 CCCATCTCTCTCCCTCTCCTAGG + Intergenic
1049419796 8:142511468-142511490 CTCCTCCTCCTCCCTCTCCCTGG - Intronic
1049432628 8:142572301-142572323 ACCACCTGCCTCCCTCTCCCTGG + Intergenic
1050687849 9:8191315-8191337 CCCATCTTGCCCCCTCACCCAGG + Intergenic
1051143755 9:14005645-14005667 CCCTTCTTGCACCATCTGCCAGG + Intergenic
1051147201 9:14040002-14040024 TCCATCTTTCTCCCTCTCCCTGG - Intergenic
1051601696 9:18881440-18881462 CCCATCTTGCTTCCTCTCCTGGG - Intronic
1051834055 9:21314765-21314787 CCCATCCTCCTACCCCTCCCAGG - Intergenic
1051906345 9:22099151-22099173 TACATGTTGTTCCCTCTCCCTGG - Intergenic
1051921642 9:22274040-22274062 ACCATCTTGCTCTGCCTCCCAGG - Intergenic
1052758718 9:32567795-32567817 CCCACCTCTCTCCCTCTCCTTGG + Exonic
1052867638 9:33474529-33474551 CCCTGCATCCTCCCTCTCCCAGG + Intergenic
1052884231 9:33628048-33628070 CGGATCTTGCTCTGTCTCCCAGG - Intergenic
1052994104 9:34540719-34540741 CCCACCCTGCTCCCACTCCTGGG + Intergenic
1053132529 9:35624956-35624978 CCTGTCTTGCTCCCTCTCCTTGG + Intronic
1054873842 9:70074888-70074910 CCTGTCTTGCTCTCTCTCACTGG + Intronic
1054915946 9:70495328-70495350 CACTTCCTGCTCCCTCTACCAGG + Intergenic
1054998897 9:71425913-71425935 CACATGTTGCTCCCTCTACCTGG + Intronic
1055477890 9:76681476-76681498 CCTATCTTGTACCCTTTCCCAGG - Intronic
1056274280 9:84978029-84978051 GCCATCTCTCTCCCTTTCCCTGG + Intronic
1056644314 9:88397645-88397667 CCAGTCTTGCTCTGTCTCCCAGG + Intronic
1056979250 9:91293120-91293142 CCCATCTCTCTCCCTTTCCTTGG + Intronic
1057191828 9:93092703-93092725 ACCATCCTCCTCCCTCACCCGGG - Intergenic
1057696756 9:97328630-97328652 CTCATCGTGCTCCCTCTGCTGGG + Intronic
1057960395 9:99450377-99450399 CGCTTCTTGTTCCCTCTCCCTGG + Intergenic
1058467526 9:105244521-105244543 CCTCTCCCGCTCCCTCTCCCGGG - Intergenic
1058628150 9:106957263-106957285 CCCATCTGCTTCCCTCTCCTTGG - Intronic
1058785373 9:108381547-108381569 CTCATACTGTTCCCTCTCCCTGG - Intergenic
1058860968 9:109117453-109117475 ACCTTCTTTCTCCCACTCCCAGG + Intronic
1058883214 9:109303369-109303391 AGCATCTTGCTCTGTCTCCCAGG + Intronic
1058891433 9:109364606-109364628 GCCTTCTTGCTCCCTCTGACAGG - Intergenic
1058931856 9:109728398-109728420 ACCATCTTGCTCCTACTTCCAGG + Intronic
1059249723 9:112877743-112877765 GCAATCTTGCTCTCTCACCCAGG + Intronic
1059425166 9:114216402-114216424 CCCATCTGCTTCCCTCTCTCTGG - Intronic
1059492012 9:114675868-114675890 CACATCCTGTTCCCTCTACCTGG + Intergenic
1059510367 9:114839591-114839613 CCCATCTGCCAGCCTCTCCCAGG + Intergenic
1059917491 9:119119615-119119637 CCCATCTCTTTCCCTCTCCTTGG + Intergenic
1059945632 9:119405746-119405768 CCCCAGTGGCTCCCTCTCCCTGG - Intergenic
1060003858 9:119982406-119982428 CATATGTTGCTCCCTCTTCCTGG - Intergenic
1060276448 9:122186550-122186572 CCCAGCTTGCCGCCTCTCCCTGG + Intronic
1060313189 9:122482851-122482873 CTCATCCTGCTCACCCTCCCAGG - Intergenic
1060733737 9:126053349-126053371 CCCATGCTGTTCCCTCTGCCTGG + Intergenic
1061221426 9:129254217-129254239 CCTATCTCTCTCCCTCTCCAAGG - Intergenic
1061297513 9:129685010-129685032 ACCATCTTGTCCCCTCTACCAGG + Intronic
1061748213 9:132755487-132755509 CCCTCCATGGTCCCTCTCCCAGG - Intronic
1061754764 9:132804645-132804667 CCCATCTTGCTTCTTCTGTCGGG + Intronic
1061868478 9:133507489-133507511 TAGATCTTTCTCCCTCTCCCTGG + Intergenic
1062039942 9:134399901-134399923 CCCCTCTTGCTTCCTCTCCCAGG - Intronic
1062186721 9:135222250-135222272 CCCATCCTGCCCCCTCTCCTGGG + Intergenic
1186193117 X:7085471-7085493 CCCTTCTTGGTCACTCTCTCAGG - Intronic
1186554859 X:10547247-10547269 AACATCTTGCTCTGTCTCCCAGG - Intronic
1187026653 X:15442357-15442379 TCCATCTCTCTCCCTCTCCTTGG + Intronic
1187163676 X:16786331-16786353 CCCATCTCGCTCCGTCCCCTCGG + Intergenic
1188007166 X:25023129-25023151 CCCAGCCTGCGCCCTCTCGCGGG - Intergenic
1188329909 X:28856746-28856768 CCTATCTTTCTCCCTCTTCTTGG + Intronic
1188469140 X:30517679-30517701 CCCATCTCTCTCCCTCTCTTCGG + Intergenic
1188705390 X:33322364-33322386 CACATCTGTCTCCCTCTCCTTGG - Intronic
1188833564 X:34930502-34930524 CCCATCTGTCTCCCTCTCCTTGG + Intergenic
1189014536 X:37083147-37083169 CCCATCTCTCTCCCTCTCATAGG + Intergenic
1189263708 X:39697214-39697236 CCCATCTCTCTCCCTCTCCTTGG - Intergenic
1189942608 X:46141174-46141196 TCCATCTCTCTCCCTCTCCTTGG + Intergenic
1190144330 X:47876926-47876948 TCCATCTCCCTTCCTCTCCCAGG - Intronic
1190212056 X:48456825-48456847 CACCTGTTGCTCCCTCTGCCTGG + Intergenic
1190312077 X:49123718-49123740 GCCATCTTGCTCCTTTTCCCAGG + Exonic
1190879418 X:54482407-54482429 CCCATCTCCCTCCCCCGCCCCGG + Intronic
1191720496 X:64224705-64224727 TCCATCTTCCTCCCTCTCCTGGG - Intronic
1191740527 X:64432530-64432552 CCCATCCTGCCCCCTCTGCCTGG + Intergenic
1192005992 X:67212966-67212988 CCCAGCTTGCAGCTTCTCCCTGG + Intergenic
1192159619 X:68774476-68774498 CAGATCTTGCTCTGTCTCCCTGG - Intergenic
1192334725 X:70208478-70208500 CCCACCTTTGTCCCTATCCCTGG + Intergenic
1192336358 X:70223597-70223619 CCCATGTTGTTCCCTCTACCTGG - Intergenic
1192388614 X:70700542-70700564 CCCATCTCTCTCCCTTTCCTTGG + Intronic
1193317190 X:80077536-80077558 CCCATCTGGCTTCTCCTCCCTGG - Intergenic
1194588572 X:95769036-95769058 CCCATCTCTCTCCCTCTCCTTGG + Intergenic
1195105898 X:101601116-101601138 CCCAGCCTGCTGCCTCTCCTAGG + Intergenic
1195106985 X:101612651-101612673 CCCAGCCTGCTGCCTCTCCTAGG - Intergenic
1195628384 X:107028395-107028417 TCCATCTCTCTCCCTCTCCTTGG - Intergenic
1195749654 X:108151065-108151087 CCCATCTTCCTCCCTGTGCCTGG - Intronic
1195908228 X:109865746-109865768 CAAATATTGCTCCCTCTGCCTGG + Intergenic
1196054428 X:111339893-111339915 GCCACTTTTCTCCCTCTCCCTGG + Intronic
1196139849 X:112249070-112249092 CCCATCTTTATTTCTCTCCCTGG - Intergenic
1196504772 X:116428468-116428490 CCCATCTCTCTCCTTCTCCTTGG + Intergenic
1196547939 X:116986504-116986526 ACCATCTCTCTCCCTCTCCTCGG - Intergenic
1196564049 X:117183804-117183826 CTCATCTCTCTCCCTCTCCTCGG + Intergenic
1196607736 X:117674860-117674882 CCCATCTGCCAGCCTCTCCCAGG + Intergenic
1196820135 X:119694606-119694628 CCCTTCTTCCTCTCTCTCCCTGG - Intergenic
1197423283 X:126264642-126264664 CCCATCTTTGTCCCTCTCCATGG - Intergenic
1197724564 X:129768031-129768053 CCCAGCTTACTCCCATTCCCGGG + Intronic
1197842378 X:130762554-130762576 AGCATCTTGCTCTCTCACCCAGG - Intronic
1198503751 X:137280736-137280758 TTCCTCTTGCTCCCTCTGCCTGG - Intergenic
1198601338 X:138287268-138287290 TCTTTCCTGCTCCCTCTCCCAGG + Intergenic
1198743149 X:139862399-139862421 CCAAAATTGCCCCCTCTCCCAGG - Intronic
1199571587 X:149272143-149272165 CCCATCCTGCTCCCTGGACCTGG + Intergenic
1200170523 X:154070242-154070264 CCCATCTCTCTCTCTCTCCTTGG + Intronic
1201143725 Y:11049991-11050013 CCCATCTCTCTCCCTCTCCTTGG + Intergenic
1202594137 Y:26519506-26519528 CCCATCTTTCTCCTTCTCCTGGG + Intergenic