ID: 949967760

View in Genome Browser
Species Human (GRCh38)
Location 3:9373181-9373203
Sequence GGATTTAAACCAATGCAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 272}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949967760_949967765 -4 Left 949967760 3:9373181-9373203 CCGTGCTGCATTGGTTTAAATCC 0: 1
1: 1
2: 1
3: 24
4: 272
Right 949967765 3:9373200-9373222 ATCCCAGAGGAGGCTGGGTGTGG 0: 1
1: 1
2: 20
3: 132
4: 855
949967760_949967764 -9 Left 949967760 3:9373181-9373203 CCGTGCTGCATTGGTTTAAATCC 0: 1
1: 1
2: 1
3: 24
4: 272
Right 949967764 3:9373195-9373217 TTTAAATCCCAGAGGAGGCTGGG 0: 1
1: 0
2: 1
3: 41
4: 295
949967760_949967768 26 Left 949967760 3:9373181-9373203 CCGTGCTGCATTGGTTTAAATCC 0: 1
1: 1
2: 1
3: 24
4: 272
Right 949967768 3:9373230-9373252 CACCTGTAATCCCAGCACTTTGG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
949967760_949967763 -10 Left 949967760 3:9373181-9373203 CCGTGCTGCATTGGTTTAAATCC 0: 1
1: 1
2: 1
3: 24
4: 272
Right 949967763 3:9373194-9373216 GTTTAAATCCCAGAGGAGGCTGG 0: 1
1: 0
2: 2
3: 17
4: 216
949967760_949967771 30 Left 949967760 3:9373181-9373203 CCGTGCTGCATTGGTTTAAATCC 0: 1
1: 1
2: 1
3: 24
4: 272
Right 949967771 3:9373234-9373256 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
949967760_949967769 27 Left 949967760 3:9373181-9373203 CCGTGCTGCATTGGTTTAAATCC 0: 1
1: 1
2: 1
3: 24
4: 272
Right 949967769 3:9373231-9373253 ACCTGTAATCCCAGCACTTTGGG 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949967760 Original CRISPR GGATTTAAACCAATGCAGCA CGG (reversed) Intronic
901118906 1:6874289-6874311 GGATTCGAACCAAGGCAGCCTGG - Intronic
901756516 1:11444643-11444665 GGATTTTAACCGATCCAGGAGGG - Intergenic
902796386 1:18803491-18803513 GGATTTGAACCCAGGCAGCCAGG + Intergenic
903017763 1:20372635-20372657 GGATTTAAACCCAGGCAGATGGG + Intergenic
904789049 1:33004569-33004591 GGTTTTAAAACAATACAGAATGG - Intergenic
905594679 1:39196196-39196218 GGATTTAAACCCAGGCAGACTGG + Intronic
906211389 1:44014182-44014204 GGAATTAAACCATAGCGGCATGG + Intronic
907269372 1:53281649-53281671 GGATTTGAACCCAGGCAGCCAGG - Intronic
907395995 1:54190234-54190256 GGATTTAAACCCAGACAGCCTGG - Intronic
907752585 1:57277225-57277247 GGATTTAAACCCAAGCAGTCTGG - Intronic
907870836 1:58441311-58441333 GGATTTAAACCCAGGCAGCCTGG + Intronic
909029278 1:70520646-70520668 GGATTCAAACTAATGTAGAATGG + Intergenic
909519471 1:76550590-76550612 GGATTCAAACTCAAGCAGCATGG - Intronic
911628512 1:100155729-100155751 GGATTTGAACCTAGGCAGCCTGG - Intronic
912769334 1:112448576-112448598 GGATTTAAACCCAGGCAACCTGG - Intronic
913657366 1:120974182-120974204 GGGATTAAACCAAGGCAGCCTGG - Intergenic
914647342 1:149665917-149665939 GGGATTAAACCAAGGCAGCCTGG - Intergenic
915808894 1:158885916-158885938 GGAGTTAAACAAAGGCAGTAAGG - Intergenic
917393313 1:174563408-174563430 GGATTTGAACCAAAGCAGTCTGG - Intronic
917454712 1:175176517-175176539 AGATTTAAGCCCATGCAGAAAGG - Intronic
917950068 1:180023002-180023024 GGATTTAAACAAAGGCAGTCTGG - Intronic
918250394 1:182698325-182698347 GGATTTAAACCAAGGCAGTCTGG - Intergenic
918643607 1:186875746-186875768 TGCTTTTAACCACTGCAGCATGG + Intronic
920758286 1:208756636-208756658 GGATTTAATCCACTGGAGCCTGG - Intergenic
921304825 1:213785500-213785522 AGATATAAAACAATACAGCAAGG + Intergenic
921437701 1:215145364-215145386 GGATTTAAACCAAGACACCTGGG + Intronic
921501806 1:215913489-215913511 GAATTAAAAGCAAGGCAGCAAGG + Intronic
924661460 1:246022421-246022443 GGATTTAAAGCAAGGCTGCGTGG - Intronic
1063051056 10:2448039-2448061 GGATTTTAACTGATGCAGAAGGG - Intergenic
1064867023 10:19892354-19892376 GGATTCAAACCCAAGCAGCCTGG + Intronic
1068267887 10:54677811-54677833 GGCTTTAAACTATTGCAACATGG - Intronic
1068489480 10:57705255-57705277 GGATTTGAACCAAAGCAGAATGG - Intergenic
1068790007 10:61018190-61018212 GGAGTTACACCAATGCAAAAAGG - Intergenic
1070430377 10:76332022-76332044 GTTTTTAAACCATTTCAGCAAGG - Intronic
1070805359 10:79267628-79267650 GGATTTGAACCCAGGCAGCCTGG + Intronic
1070944378 10:80376730-80376752 GGAATTAAACCAATGTATAAGGG + Intergenic
1071482291 10:86073906-86073928 GGTTTTAAACAAATGCACCCAGG + Intronic
1072625467 10:97108246-97108268 GCATGTAAACCCAGGCAGCAAGG - Intronic
1072750707 10:97976334-97976356 GGATTTGAACCCAGGCAGCCTGG - Intronic
1072783749 10:98267145-98267167 GGATTCAAACCCAAGCAGCCTGG + Intronic
1073118997 10:101110053-101110075 GGATTCAAACCCAGGCAGCATGG - Intronic
1075130458 10:119733787-119733809 GGACCTGAACCAATGCAGCCAGG - Intronic
1075281188 10:121139814-121139836 GGATTCAAACCTAGGCAACATGG - Intergenic
1075641545 10:124068180-124068202 GCATGTAAACCACTGCAGCGTGG - Intronic
1077653708 11:3998269-3998291 GGATTCAAACCCAGGCAGCCAGG + Intronic
1078336475 11:10467054-10467076 GGATGTAAACCAGTGCAAAAAGG + Intronic
1078484284 11:11707267-11707289 GGATTCATACAAAGGCAGCATGG + Intergenic
1078922091 11:15840384-15840406 GGATTTAAACCCATGTAGTTTGG + Intergenic
1079528300 11:21417035-21417057 GGACACAAACCAAGGCAGCATGG + Intronic
1079621373 11:22559167-22559189 GCATTTAATCTAATGCAGAATGG - Intergenic
1081745544 11:45470193-45470215 GGATTAGAACCTATGCAGCCTGG + Intergenic
1083261841 11:61527428-61527450 GGATTCAAACCCAGGCAGCCTGG + Intronic
1083786624 11:64952631-64952653 AGATCTGAACCAAGGCAGCAGGG + Intronic
1088943322 11:114483213-114483235 GGGTTTAAACCAAAGCAGTCTGG - Intergenic
1089219801 11:116861121-116861143 GGATGCAAACCAAAGCAGCTTGG + Intronic
1091000001 11:131902540-131902562 AACTTTAAACCAATGCATCAAGG - Intronic
1091011409 11:132004279-132004301 GGATTTAAAGCAATTCAAAATGG - Intronic
1091172789 11:133533025-133533047 GGTTTTAAACCAATGATGCAGGG + Intergenic
1092761072 12:11811845-11811867 GGATTTAAACCAGAGCTGCCTGG + Intronic
1092896057 12:13011395-13011417 GGATTTGAACCGAGGCAGCCTGG - Intergenic
1094078012 12:26499398-26499420 GGATTTAAACCCAGGCAGAGTGG - Intronic
1095279322 12:40331883-40331905 GGAATTAAACCAATATACCAAGG - Intronic
1095675497 12:44912862-44912884 GGATTTAAACCCAGGCAGGTTGG - Intronic
1095941581 12:47730805-47730827 GGATTCAAACCCAGGCAGCTTGG - Intergenic
1097924289 12:65110563-65110585 GGATTTAAACCTGGGCAGCTAGG - Intronic
1098372150 12:69771233-69771255 GCATTTAAAATAATCCAGCAGGG + Intronic
1098811873 12:75104814-75104836 GGATTCAAACCCAGGCAGTATGG + Intronic
1100235234 12:92654148-92654170 GGATTTGAACCCAGGCAGCTTGG + Intergenic
1100699051 12:97126728-97126750 GGAATCAAACCTAGGCAGCAGGG + Intergenic
1100726973 12:97418995-97419017 GTCATAAAACCAATGCAGCAGGG - Intergenic
1101525987 12:105531420-105531442 AGGTTTAAACCCACGCAGCATGG - Intergenic
1102589672 12:113947845-113947867 GAGTTGAAACCAATGCAGAAAGG - Intronic
1102636826 12:114331864-114331886 AGATTTAAATCCATGCAGCTTGG - Intergenic
1103743857 12:123109086-123109108 GGACTTAGCCCCATGCAGCAGGG + Intronic
1104709880 12:130977959-130977981 GGATTTGAACCCAGGCAGCCTGG - Intronic
1104843903 12:131837265-131837287 GGATTTGAACCTAGGCAGCCTGG + Intronic
1106562204 13:30856687-30856709 GGCTTTGCACAAATGCAGCAAGG - Intergenic
1107183759 13:37493379-37493401 GGATTTAAACCAAGGCAGCACGG - Intergenic
1108533113 13:51345903-51345925 GGATTTGAACCCAAGCAGCCTGG - Intronic
1109282995 13:60378818-60378840 GGATTTAAACCTATGTAAAAAGG + Intergenic
1110835712 13:80079784-80079806 GGATTCAAACCCATGCACCTGGG + Intergenic
1113235265 13:108265959-108265981 GGATTTAGACCAGTCAAGCATGG - Intronic
1113576655 13:111399826-111399848 AGATTCAGACCCATGCAGCAGGG - Intergenic
1113795203 13:113053218-113053240 GGATTTTAACAAATACAGGAAGG - Intronic
1114267026 14:21078733-21078755 GGATTCAAACCAAAGCAGTCAGG + Intronic
1114423359 14:22602899-22602921 GGATTTATAACCAAGCAGCATGG + Intronic
1114983992 14:28203147-28203169 AGATATGAAACAATGCAGCAAGG + Intergenic
1115668138 14:35576804-35576826 GGATTCAAACCAAGGCAGGCTGG + Intronic
1120982270 14:90300834-90300856 GCATTTAAACAAAGGCAGAAAGG + Intronic
1121173657 14:91874498-91874520 GGATTTGAACCTAAGCAGCCTGG - Intronic
1121814590 14:96919629-96919651 AGATTCAAACCCAGGCAGCATGG + Intronic
1121939026 14:98050488-98050510 AGATTTAGAACAATTCAGCAAGG + Intergenic
1123180760 14:106468065-106468087 GGATTTAAAGCCAAGCAGCAGGG + Intergenic
1202946138 14_KI270726v1_random:28593-28615 GGATTTAAAGCCAAGCAGCAGGG - Intergenic
1125409878 15:39395029-39395051 GCATATGAAACAATGCAGCATGG + Intergenic
1125860079 15:42990802-42990824 GGATTCAAACCCAGGCAGCTTGG - Intronic
1127009774 15:54610779-54610801 GGATTCAAACCCAGGCAGTATGG + Intronic
1128155741 15:65390604-65390626 GAATTTGAACCAAGGCAGCCTGG - Intronic
1128319141 15:66680523-66680545 GGATTTGAACCCCAGCAGCATGG + Intronic
1128764941 15:70245608-70245630 TGATTTAAACCACTGAAGAAAGG + Intergenic
1130863416 15:87910698-87910720 GGAGAGAAACCAATGGAGCAGGG + Intronic
1133795984 16:9046678-9046700 GGATTGAAACCCAGGCAGCCTGG - Intergenic
1135174886 16:20219205-20219227 GGATTTAAACCCAGGCAGTTTGG - Intergenic
1135528839 16:23235046-23235068 GGATTTAAGCCAAGGCAGTCTGG + Intergenic
1135971185 16:27073308-27073330 GGATTTGAACCCAGGCAGCCTGG + Intergenic
1137306758 16:47208194-47208216 GGATTTGAACCCAGGCAGCCTGG - Intronic
1137935752 16:52633799-52633821 GGATTTAAACCCAGTCAGCCTGG - Intergenic
1137947544 16:52749286-52749308 AGATTTAAAGCAATCAAGCATGG + Intergenic
1138187015 16:54984643-54984665 GGATTTGAACCTAGGCAGCCTGG + Intergenic
1139208243 16:65050322-65050344 GGCTTTAAACAAATGTGGCATGG - Intronic
1140832481 16:78764610-78764632 GGAATCAAACCATAGCAGCATGG - Intronic
1142565727 17:838960-838982 GGATTTGAACCCAGGCAGCCTGG - Intronic
1143033128 17:3978891-3978913 GTGTTTAAATCAATTCAGCAGGG + Intergenic
1146280545 17:31541586-31541608 GGATTCAAGCCCAGGCAGCAGGG + Intergenic
1146468124 17:33103400-33103422 GGATTTGAACCCAAGCAGCCTGG + Intronic
1149018695 17:51938249-51938271 GGATTTAAAACATTGGAGAAGGG + Intronic
1149590503 17:57826093-57826115 GGGTTTGAACCAAGGCAGCCTGG + Intergenic
1150508242 17:65720944-65720966 GGATTTGAACCTAGGCAGCCTGG + Intronic
1152108889 17:78346132-78346154 GGATCCAAACCTAGGCAGCAGGG - Intergenic
1153325376 18:3813774-3813796 GGATTTAAAAGAATCCAGAATGG - Intronic
1153439592 18:5101775-5101797 GGATTTATAACAAAGGAGCAGGG + Intergenic
1155052766 18:22163343-22163365 GGATTGAAACCCAGGCAGCCTGG + Intergenic
1155154529 18:23147589-23147611 GAAACTAAAACAATGCAGCAAGG - Intronic
1156741635 18:40337515-40337537 GGCTTAAAACAAATGAAGCATGG + Intergenic
1158331028 18:56362012-56362034 AGATTTCAACCAATGCAATAAGG + Intergenic
1159091687 18:63856361-63856383 GGATTTATCCCAAGGAAGCAAGG - Intergenic
1162533802 19:11251464-11251486 GGATTTGATCCAGTGCAGGAAGG - Intronic
1162774838 19:12973257-12973279 GGATTTGAACCCAGGCAGCCTGG + Intronic
1164010531 19:21199757-21199779 GGATTTGAACATATGCAGCATGG + Intergenic
1164043778 19:21515963-21515985 TGATAGAAACCAAAGCAGCATGG - Intronic
1165920771 19:39296696-39296718 GGGTTTAACCCAGTGCAGAAAGG - Intronic
1165976498 19:39681219-39681241 GGACTGGAACCAAGGCAGCATGG + Intergenic
1166554133 19:43686834-43686856 GGATTTGAACCCAGGCAGCCTGG - Intergenic
1167300540 19:48674988-48675010 GGATTTGAACCCAGGCAGTATGG - Intergenic
1167525291 19:49979746-49979768 GGATTTAAAGTAATTCAGCCGGG + Intronic
1168470521 19:56637263-56637285 AGATTTACAGAAATGCAGCATGG - Intergenic
926782368 2:16485364-16485386 GGTTTTAAACCAAAGCCGCCTGG + Intergenic
928599735 2:32892772-32892794 GGAGTGAAACCAATGAAGCAGGG - Intergenic
929109383 2:38393589-38393611 GGATTTTCAACCATGCAGCAAGG - Intergenic
929375738 2:41284566-41284588 AGATTTCTACCAATGAAGCAGGG - Intergenic
930338131 2:50076574-50076596 GGATTTGAACCCATGCAGTCTGG + Intronic
930845552 2:55899820-55899842 GGATTAAATGCAATGCAGAATGG + Intronic
931521500 2:63102515-63102537 GGATTTATACCAGTGATGCAAGG - Intergenic
931923768 2:67048600-67048622 GGATTTGAACCAAGGCAGACTGG - Intergenic
932880680 2:75499161-75499183 GGATTTAACCCAATCCAGGGAGG - Intronic
933159809 2:79011164-79011186 TGTTTTATAGCAATGCAGCAAGG - Intergenic
933288628 2:80411696-80411718 GGATTTAAACCAATATTGCTTGG - Intronic
933786331 2:85845606-85845628 GGATTGACACAACTGCAGCAGGG + Intronic
935467850 2:103420573-103420595 AGATTTAAACCAAGGCAGTTTGG - Intergenic
936715573 2:115183364-115183386 GCATTTAACCCAAAGCACCAAGG - Intronic
936771389 2:115917729-115917751 TGAATTAAACCACTGCAGGAAGG + Intergenic
937878346 2:126844197-126844219 GGGTCTTAACCAATGCAGTAAGG + Intergenic
938810218 2:134845986-134846008 AGAGTTAACCCAATGCAGCATGG + Intronic
939095561 2:137829768-137829790 GGATTTGAACCAAGGCAGTTAGG - Intergenic
939807919 2:146796264-146796286 GGAGTTCAACCAAGGCAGTAGGG + Intergenic
939828696 2:147046718-147046740 GCATTTAACCCAATGCTCCATGG - Intergenic
940281289 2:151992291-151992313 GGGTATAAGACAATGCAGCATGG + Intronic
940503045 2:154518727-154518749 GGTTTGAGACAAATGCAGCATGG + Intergenic
940624872 2:156161467-156161489 GGTTTTGCAGCAATGCAGCATGG + Intergenic
940914631 2:159240754-159240776 GGATTTAAACCCAAGCAGTGTGG + Intronic
941376247 2:164734665-164734687 GGATTGAAGCTAATGCAGAAAGG + Intronic
942297994 2:174535791-174535813 GGATTTGAACCTAGGCAGCCGGG + Intergenic
944955680 2:204805721-204805743 GGATTTATACCAATGATGCAAGG + Intronic
947334780 2:229070253-229070275 GGATTTGAGCCCAGGCAGCATGG - Intronic
947726905 2:232406811-232406833 TGATTTAAACCCAGGCAGCCTGG + Intergenic
948243264 2:236456357-236456379 GGATTTGAACCCAGGCAGCCTGG + Intronic
948380841 2:237548937-237548959 GGATTTAAACCAGACCTGCAGGG + Intronic
1168912772 20:1463089-1463111 GGATTTGAACCAACGCAGTCAGG + Intronic
1169842158 20:9951451-9951473 TGATTTAGACAAATGTAGCATGG - Intergenic
1171282773 20:23914839-23914861 GGATTTGACCCAAAGCAGCAGGG + Intergenic
1171287614 20:23954571-23954593 GGATTTGACCCAAAGTAGCAGGG + Intergenic
1171322733 20:24260631-24260653 GGATGTAAACTCATGCAGAAGGG - Intergenic
1173697895 20:45037024-45037046 GGATTTTAACCAAAGCAGTTTGG + Intronic
1173865659 20:46311165-46311187 GGATTCAAACCAAGGCAGGCTGG + Intergenic
1174459642 20:50673346-50673368 GGATTTGAACCCAGGCAGCCTGG + Intronic
1177490075 21:21812113-21812135 GGATTTAAACCAAAGTAGTCTGG - Intergenic
1177621910 21:23606523-23606545 GGATTTATACCAGGGCTGCAAGG + Intergenic
1182917094 22:34044162-34044184 GGATTTAAATCCAGGCAGCCTGG - Intergenic
1183738600 22:39657566-39657588 GGATTTGAACCCAGGCAGCCTGG - Intronic
1184389929 22:44197455-44197477 GGATTTGAACCCAGGCAGCTGGG + Intronic
1185362651 22:50417891-50417913 GCATGTGAACCAATGCTGCAGGG + Intronic
949941756 3:9160051-9160073 GGATTTGAACCCAGGCAGCCTGG - Intronic
949946250 3:9192355-9192377 GGAATCAAACCGATACAGCATGG - Intronic
949967760 3:9373181-9373203 GGATTTAAACCAATGCAGCACGG - Intronic
952123424 3:30271720-30271742 GGAGTCAAACCAATGAAGCTAGG + Intergenic
954173026 3:48820571-48820593 GGATTTGAACCCAAGCAGCCTGG - Intronic
954208355 3:49077635-49077657 GGATTTGAACCCAGGCAGCCTGG - Intronic
954322500 3:49841690-49841712 GGGTTCAAACAAAGGCAGCATGG + Intronic
954622856 3:52005664-52005686 CGATTAAAACCAGTGCTGCAAGG - Intergenic
955422408 3:58751742-58751764 GGATTTGAACCCAAGCAGCCTGG - Intronic
956297019 3:67726087-67726109 GAAATTAAACCAATACAGGATGG - Intergenic
956864036 3:73351952-73351974 GGATTCAAACCCAGGCAGCCTGG - Intergenic
956964443 3:74442910-74442932 GGACTTAAGCCCATACAGCATGG + Intronic
960147137 3:114215483-114215505 GGATTTGAACCCATGCAGTGTGG - Intergenic
963629276 3:147712904-147712926 GGGTTTAAACCACTGCAGCTCGG - Intergenic
964246417 3:154659335-154659357 GGATTTAATCCAAGACACCAAGG + Intergenic
964276450 3:155013303-155013325 GGATTCAAACCCAGGCAGCTGGG + Intergenic
965386475 3:168052039-168052061 GGATTTTAACCCAGGCATCAAGG - Intronic
967045698 3:185734831-185734853 GGATTTGAACCCAGGCAGCCTGG - Intronic
967536561 3:190610880-190610902 GGATTTAAACCATTGCAATTAGG - Intronic
967986234 3:195097619-195097641 GGATTTAAACCCAGGCAGCCTGG + Intronic
969852184 4:9966948-9966970 ACAATTAAAACAATGCAGCATGG - Intronic
970405982 4:15764931-15764953 GGATTCAAACCTATGCAATAGGG - Intergenic
970834927 4:20392204-20392226 GGCTTCAAACCCATACAGCATGG + Intronic
972649873 4:41006396-41006418 AGATTAAAATTAATGCAGCAGGG + Intronic
972923178 4:43968837-43968859 ACATTTAAGCCAATGCAACAGGG + Intergenic
973646240 4:52953939-52953961 GGATTTGAACCCAGGCAGCCTGG - Intronic
974685784 4:65226608-65226630 GGATTCATACCAATGCAGTCTGG - Intergenic
976508800 4:85883090-85883112 GGATTTAAAACAAGGCAGGGAGG + Intronic
976627807 4:87205867-87205889 GGATGTGAACCTAGGCAGCAGGG + Intronic
977003695 4:91537263-91537285 AGATTTAAACCAAGGCAGCAGGG + Intronic
977256127 4:94741954-94741976 GGATTTGAACCCAGGCAGCCTGG + Intergenic
978416547 4:108482713-108482735 GGATTTAAACCTAGGCAGTCTGG + Intergenic
979312886 4:119224808-119224830 GGATTTAAACTAAGGCAGTGTGG + Intronic
981508473 4:145528846-145528868 GGATTCAAACCTAGGCAGCCTGG - Intronic
981900507 4:149856365-149856387 GGAATTAAAGCAAAGAAGCATGG - Intergenic
981965339 4:150593464-150593486 GGATTTAAAAACAGGCAGCACGG + Intronic
982228689 4:153188553-153188575 GGATATAAACCCATGCCCCAAGG + Intronic
982627268 4:157782935-157782957 GCATTTAAACCAATCTAACAAGG - Intergenic
984210535 4:176841708-176841730 GGAGTAAAACCAATGCAAGAAGG - Intergenic
986249085 5:6039698-6039720 GGATTTGAACCAAGGCAGAACGG - Intergenic
986702589 5:10425531-10425553 GCATTTTAATCAATGAAGCAAGG - Intronic
987277668 5:16378771-16378793 GGATTTTAACCACTACAGCCCGG + Intergenic
989644496 5:43615276-43615298 GGCTTAAACCCAATTCAGCAAGG + Intronic
990542042 5:56782645-56782667 GGATTTAAACCTAGGCAGTCTGG + Intergenic
991452115 5:66763137-66763159 GGATTTGAACCCAGGCATCATGG + Intronic
992705274 5:79384810-79384832 GGATTTATACCAAGGAAACAAGG + Intronic
993360267 5:86966346-86966368 GGATTTTAATCAATGGATCATGG + Intergenic
994223699 5:97227522-97227544 GGATTTAAACCCAGGCAGTCTGG - Intergenic
995815835 5:116166887-116166909 GGAAAAAAACCAATGCAGAAAGG + Intronic
997588211 5:135057021-135057043 GGATTTGAACCTATGCAGCCAGG + Intronic
998770688 5:145541454-145541476 GGATTTAAACCCAGGCTACATGG + Intronic
998784495 5:145693975-145693997 GGATTTGAACCAAGGCAGTGTGG - Intronic
1000173879 5:158730714-158730736 AGATTTGAACCTATGCAGCATGG - Intronic
1001349620 5:170947461-170947483 AGATTTAAAATAATGAAGCAAGG + Intronic
1001485324 5:172115662-172115684 GGGTTCAAACCAAGGCAGCTGGG - Intronic
1004223723 6:13768452-13768474 GGGTTCAAACCAAGGCAGCCTGG + Intergenic
1004389909 6:15201419-15201441 GGATTTGAACCAAGACAGCCTGG - Intergenic
1005483594 6:26277874-26277896 GGACTTCAACATATGCAGCAGGG + Intergenic
1006139834 6:31921593-31921615 GGATTCAAACCCAGGCAGCATGG - Intronic
1007812822 6:44498305-44498327 GGATTTGAACCCAGGCAGCCTGG + Intergenic
1008025492 6:46631271-46631293 GGATTTGAACAAATGCAGTGAGG - Intronic
1008119959 6:47602023-47602045 GGGTTTAAAACAATGGAGGAGGG - Intronic
1009716584 6:67405503-67405525 GGAATTAAATCAATACATCATGG - Intergenic
1013401383 6:109800142-109800164 GGATTTAAACCCACACAGGATGG + Intronic
1014155006 6:118100158-118100180 GGATTTAGACCAAGGCAGTCTGG + Intronic
1014165686 6:118221776-118221798 GGATTCAAAACAATACAGGAAGG - Intronic
1014927524 6:127291328-127291350 GGATTTAAACCCAGGCAGGTTGG + Intronic
1016597650 6:145819316-145819338 GAATTTGAACCAAGGCAGCCTGG + Intergenic
1018027039 6:159814687-159814709 GGATTTAAACCCAGGAAGCCTGG - Intronic
1018605353 6:165591953-165591975 GAATTAAAACCAATGCTGCAGGG - Intronic
1021242916 7:18226739-18226761 GAATTTACAGCAATTCAGCATGG + Intronic
1022299675 7:29091382-29091404 GGATTTAAACCAAAGAGGGATGG + Intronic
1022647755 7:32247142-32247164 GGATTTTAACAAATGAAGAAAGG + Intronic
1022662787 7:32382119-32382141 GGATTTGAACCCAGGCAGCATGG + Intergenic
1023322837 7:39017980-39018002 GGATGTTAGCCAATACAGCAAGG - Intronic
1023452044 7:40296881-40296903 GGATTTAAATCAATGTAGTTTGG - Intronic
1023473994 7:40556612-40556634 GGATTTAAACCCAGGCAGTCTGG - Intronic
1026710473 7:72734291-72734313 CTATTGAAACCAAAGCAGCATGG + Intronic
1030660584 7:112214668-112214690 GGATTTAAACCTTTGCTTCATGG + Intronic
1030954820 7:115838956-115838978 GGATTGCAATCAATGCAGTAAGG - Intergenic
1034526167 7:151664207-151664229 AGATTTGAACCAAGGCAGCTGGG - Intronic
1038068909 8:23992106-23992128 GGTTTAAAATAAATGCAGCAGGG + Intergenic
1044673311 8:94704939-94704961 GGATTTAAACTAATACAGATTGG - Intronic
1044737504 8:95294389-95294411 GGATTTAAACCTAGGCAGCCTGG + Intergenic
1045400633 8:101813309-101813331 TGATTAAAACCACTGCAGCATGG + Intronic
1045575889 8:103419255-103419277 GGATTCAAACCAAGGCAGTATGG - Intronic
1046440739 8:114250582-114250604 AGATTTAAACCAATACAGGTAGG + Intergenic
1047314677 8:123721905-123721927 GGATTCAAACCCATGCAGTCTGG + Intronic
1051395706 9:16617911-16617933 GGATTCAAACCTAAGCAGCCTGG + Intronic
1051410770 9:16787420-16787442 GGATTTAAACTCAGGCAGCGTGG - Intronic
1053717114 9:40908078-40908100 AGATTTAGACCACAGCAGCAGGG - Intergenic
1055130942 9:72773827-72773849 GGATTTGAACCTAGGCAGAATGG - Intronic
1055663778 9:78533028-78533050 GGATTTATAACCAAGCAGCACGG + Intergenic
1056039018 9:82641278-82641300 GGATTTATACCAAGGATGCAAGG + Intergenic
1057610540 9:96539127-96539149 GGATTTTAGGCAATGCAGTATGG - Exonic
1057810182 9:98251606-98251628 GGATTTGAACCCAGGCAGCCTGG + Intronic
1058145169 9:101402253-101402275 GGATTTAAACCTAGGCAGTTAGG - Intronic
1058399689 9:104600371-104600393 GGACTTAAACCCAAGCAGTATGG + Intergenic
1058400148 9:104606583-104606605 GGACTTAAACCCAAGCAGTATGG + Intergenic
1058712696 9:107694660-107694682 ATACTTAAACCAATGGAGCATGG + Intergenic
1058750284 9:108032742-108032764 GGATTTAAACCCAGGCAGACTGG + Intergenic
1061483144 9:130907021-130907043 GGATTTGAACCCAGGCAGAAGGG + Intronic
1186659411 X:11653762-11653784 GGATTTAAACCTAGGCAGTCTGG + Intronic
1187190819 X:17033285-17033307 GGATTGAAACAAATGAGGCAGGG - Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188412686 X:29893495-29893517 TGATTTAAAACAATGATGCACGG - Intronic
1189802815 X:44707528-44707550 GTATTTAAACTAAGGCAGCCTGG - Intergenic
1190048934 X:47134807-47134829 GGATTTGAACCAAGGCAGTATGG + Intergenic
1190264631 X:48820609-48820631 GGACTTGAACCCATGCAGCCTGG + Intronic
1190334898 X:49256403-49256425 GGATTTGAACCCATGTAGCCAGG - Intronic
1194278503 X:91916975-91916997 GGTTTTATACCAATGATGCAGGG + Intronic
1194497093 X:94630140-94630162 ATATTTAAACCAATCCAGGAAGG + Intergenic
1194590133 X:95790163-95790185 AGATTCAAACCAAAGCAGGATGG - Intergenic
1194607673 X:96001663-96001685 GGAATTAAACAAATTTAGCATGG + Intergenic
1196149257 X:112354231-112354253 GGATTCAAACCCAAGCAGCCTGG - Intergenic
1196633211 X:117967279-117967301 GGATATAAAGCAATACATCATGG + Intronic
1198563055 X:137872233-137872255 GCATGTAAAGCAATTCAGCATGG - Intergenic
1200595837 Y:5139054-5139076 GGTTTTATACCAATGATGCAGGG + Intronic