ID: 949968365

View in Genome Browser
Species Human (GRCh38)
Location 3:9379513-9379535
Sequence GTTCTATGCAGATTAACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949968365_949968367 -7 Left 949968365 3:9379513-9379535 CCTTCTGTTAATCTGCATAGAAC 0: 1
1: 0
2: 0
3: 12
4: 135
Right 949968367 3:9379529-9379551 ATAGAACATTGTTCAGGCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 158
949968365_949968368 -6 Left 949968365 3:9379513-9379535 CCTTCTGTTAATCTGCATAGAAC 0: 1
1: 0
2: 0
3: 12
4: 135
Right 949968368 3:9379530-9379552 TAGAACATTGTTCAGGCCTAGGG 0: 1
1: 0
2: 0
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949968365 Original CRISPR GTTCTATGCAGATTAACAGA AGG (reversed) Intronic
906005495 1:42465805-42465827 GTTCTGTGCATATTAAGATATGG - Intronic
910411031 1:86944773-86944795 GTTCTATGCAGATTTAGGAACGG - Intronic
910582610 1:88845013-88845035 GTTATATGCAAATTCACACAAGG - Intergenic
912220916 1:107674494-107674516 GTTCTGTGCAAATTAGCAGTGGG - Intronic
917958099 1:180121124-180121146 GTTCTACACAGATTGACACACGG - Intergenic
918116445 1:181502217-181502239 GTTCTGGGCTGATCAACAGAAGG - Intronic
919051870 1:192521591-192521613 GTTCTATCCACATGAACATACGG + Intergenic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
921247409 1:213259109-213259131 AAACTATGCAGATGAACAGAAGG + Intronic
923311230 1:232737404-232737426 ATTCTATGCAGAGTCCCAGAGGG - Intergenic
924572910 1:245254412-245254434 ATTCTATGAAAATTAACAAAGGG + Intronic
924864497 1:247962976-247962998 GTTCTAGTCAGATTATCACAGGG + Intronic
1065450725 10:25853683-25853705 ATCCTTTGCAGATTAACAAATGG + Intergenic
1067680609 10:48435846-48435868 TTTCAATGCAAATAAACAGATGG + Exonic
1068468343 10:57425925-57425947 TTTCTATGCACATTAATAAATGG + Intergenic
1072258879 10:93647833-93647855 GTTCTATGAGAATTAAAAGAAGG + Intronic
1073227650 10:101937153-101937175 CTTCAATGCAGCTTTACAGAAGG + Intronic
1080127734 11:28756749-28756771 GTTCTGTGCAGATGAGTAGAAGG + Intergenic
1081063302 11:38506336-38506358 TTTTTATGAAGAGTAACAGAGGG + Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1082565580 11:54674355-54674377 GTACTATGCTGAATAACAGTGGG - Intergenic
1089822267 11:121239439-121239461 GGTCTTTTCTGATTAACAGAAGG - Intergenic
1091861740 12:3791616-3791638 GCCCTATGCAGTTTAACAGCGGG + Intronic
1092488445 12:8922914-8922936 GTTCTATGGTGATTAAGGGAAGG - Intronic
1093009974 12:14096370-14096392 ATCCTAAGCAAATTAACAGAGGG - Intergenic
1094076947 12:26487631-26487653 GTTCTATCCCTATTAACAGAGGG - Intronic
1099593795 12:84630700-84630722 CTGCTATGCAGATTAAGAAAAGG + Intergenic
1100010135 12:89942943-89942965 ATTCTATGCAAATTAAGGGATGG + Intergenic
1100356106 12:93831477-93831499 CTGCCATGCAGATTCACAGATGG - Intronic
1102953498 12:117045311-117045333 GTTTTATGCAGATCAGCAGCTGG + Intronic
1105562750 13:21510253-21510275 GTGTTATGCAAAATAACAGAAGG - Intronic
1106926583 13:34619378-34619400 TTTCTGTACAGATTAAAAGATGG - Intergenic
1108503256 13:51086892-51086914 GTTCTTTGCAGTTTCACAGAAGG - Intergenic
1108557503 13:51609296-51609318 GTTCTATTCAAAATAACAGCAGG - Intronic
1109214452 13:59572233-59572255 GTGCTGTGCAGATTAAGGGAAGG - Intergenic
1109788963 13:67222432-67222454 GTTCTTTGCAGGTTAACACAAGG + Intronic
1113172841 13:107525166-107525188 GTTCTATGAATTTTAACACATGG + Intronic
1114039078 14:18659667-18659689 TTTCTATGAAGAGGAACAGAAGG + Intergenic
1116267589 14:42713789-42713811 GTTCTATGCTTATTACCAGGTGG + Intergenic
1116628241 14:47294860-47294882 CTTCTATGCAGATTCTCAAATGG - Intronic
1119448750 14:74689540-74689562 GTTCTATGGAGATTCACATGAGG - Intronic
1119995037 14:79244230-79244252 GTACTATGCAGATAAGCACATGG + Intronic
1120945565 14:89992757-89992779 GGTCCCTCCAGATTAACAGATGG - Intronic
1127111040 15:55671076-55671098 GTTCTATGCAGTTTTCCAGATGG - Intronic
1127823802 15:62684837-62684859 ATGCTCTGAAGATTAACAGATGG + Intronic
1127989006 15:64097158-64097180 GTCCTGTGCAGATGAACGGATGG + Intronic
1131286548 15:91063818-91063840 GGTTTATGCATATTAAAAGATGG + Intergenic
1132103248 15:99043152-99043174 ATTCTATCCAGAGTTACAGAGGG + Intergenic
1133313189 16:4864556-4864578 CATCAATGCATATTAACAGAGGG - Intronic
1137626256 16:49910603-49910625 GAGCTATGGAGATTACCAGAGGG - Intergenic
1140053512 16:71504039-71504061 ATCCTAAGCAGATTAACACAGGG + Intronic
1143865292 17:9918795-9918817 GTTGTATGCAGAGTAACAGCCGG - Intronic
1146477509 17:33174790-33174812 GTCCTATGTAGATCAACAGCAGG - Intronic
1146734550 17:35227170-35227192 TTTCCATGCATATTAACAAATGG - Intergenic
1149382635 17:56109249-56109271 GTTCACTGCAGGTTAGCAGAAGG + Intergenic
1149411730 17:56415168-56415190 GTACTATGCTGAATAACAGTGGG - Intronic
1155370573 18:25096100-25096122 GTTAAATGAAGATTAACAAATGG - Intronic
1156488233 18:37480219-37480241 GATCTCTGCAGAGAAACAGAAGG + Intronic
1157928905 18:51797855-51797877 TTTGTATGCAGTTTAAGAGAAGG + Intergenic
1161875204 19:6903132-6903154 ATAATATGCAGATTAACAGGTGG + Intronic
1166127736 19:40725741-40725763 GTTATCTCCACATTAACAGATGG - Intronic
1168529531 19:57116826-57116848 TTTCTATGCAAATATACAGAAGG + Intergenic
928072122 2:28227494-28227516 GTTATATTCAGGTAAACAGAAGG - Intronic
928132678 2:28664463-28664485 CGTCTTTGCAGATGAACAGAGGG + Intergenic
928716091 2:34062672-34062694 GTTCTCTGAAGATTGAAAGAGGG - Intergenic
932848708 2:75161899-75161921 GTTCTGTGGAGAGAAACAGATGG + Intronic
934775693 2:96935934-96935956 GTTCTATGGATTTTAACAAATGG - Intronic
934881069 2:97979614-97979636 GTTCTATGAAGACTGAGAGAGGG - Intronic
938422922 2:131158164-131158186 GTGCTATGCATATTAGCATAAGG + Intronic
941356777 2:164503783-164503805 TTTCAATGCAGATTAATAAAAGG - Intronic
941607440 2:167617276-167617298 GTTCTTTTCAGATAAAAAGATGG - Intergenic
942395267 2:175540545-175540567 GTACTGTGGAGATTAAAAGAAGG - Intergenic
943809562 2:192167544-192167566 TTTCTATGCAAAATAACAGAAGG - Intronic
943983252 2:194583788-194583810 TTTCTTTGCATATTAACAGATGG + Intergenic
947308657 2:228776221-228776243 TTTCTATGCTGTTTAAAAGAAGG - Intergenic
948172546 2:235916661-235916683 GTTCTATGGAGAAGAACACACGG + Intronic
1173304144 20:41831810-41831832 CTTCTAGGCAGATTTATAGAAGG - Intergenic
1184028166 22:41873743-41873765 GCTTTATGCAGACTAACAAAGGG + Intronic
949968365 3:9379513-9379535 GTTCTATGCAGATTAACAGAAGG - Intronic
950618232 3:14179412-14179434 CTGGTATGCAGAATAACAGATGG + Intronic
951424530 3:22528330-22528352 ATTCTCAGCAGACTAACAGAAGG - Intergenic
956428219 3:69158458-69158480 GCTCCATGCAGATTAAGAGAGGG - Intergenic
956525646 3:70156918-70156940 GTTCAATAGAGTTTAACAGAGGG + Intergenic
957193682 3:77040576-77040598 GATCCATCCAAATTAACAGAGGG - Intronic
960040421 3:113144742-113144764 ATTCTATTCAGATTGACATAAGG + Intergenic
960567266 3:119146854-119146876 CTTCTGTGCAGATTGACAGTGGG + Exonic
962584913 3:136832490-136832512 GTACTATGCACATTAAAGGAAGG - Intronic
965425774 3:168520831-168520853 TTTCTATGCAGGTTAAAGGAAGG + Intergenic
967713454 3:192736240-192736262 ATGCTATGAAGATTAAGAGAAGG - Intronic
970350298 4:15195423-15195445 GTTCCATGCAGTTTCTCAGAAGG - Intergenic
974243118 4:59278085-59278107 GTACTATGCTGAATAAGAGACGG - Intergenic
976987690 4:91323221-91323243 TTTCAGTGCAGATAAACAGATGG + Intronic
978633814 4:110779876-110779898 GTAACAGGCAGATTAACAGAGGG - Intergenic
983042156 4:162942429-162942451 GTACTTAGAAGATTAACAGAAGG - Intergenic
989466140 5:41758054-41758076 GATCTATGCAGATGTAAAGAAGG + Intronic
990352097 5:54929120-54929142 GTTCTATTCAGAGGGACAGAAGG + Intergenic
993776427 5:92004066-92004088 GTCATAAGCAGATAAACAGAGGG + Intergenic
996115754 5:119616359-119616381 GTTCTGTGCAAAATAACAAATGG - Intronic
996387115 5:122920813-122920835 GTTCAATGCAGAAAAACTGAGGG + Intronic
997216127 5:132112463-132112485 GTTTTATCCAGATTATCAGTAGG - Intergenic
998202716 5:140138061-140138083 GTTCAATGCAGTTTACCAAATGG + Intergenic
998344254 5:141447465-141447487 CTTCTATGCAGTTTTACAGATGG - Intronic
998883152 5:146665444-146665466 GTTCTATGAAGGCTGACAGAGGG - Intronic
1000076206 5:157789605-157789627 GTTCTATAAAAATTATCAGATGG + Intronic
1000526600 5:162366690-162366712 ATCCTAAGCAAATTAACAGAGGG + Intergenic
1001467713 5:171983222-171983244 GTTCTAGACAGATGAACAGGTGG + Intronic
1002366958 5:178720580-178720602 ATTCTATGCAGAGTCTCAGAGGG + Intronic
1007825578 6:44598219-44598241 CATATATGCAGATTAACAGACGG - Intergenic
1008252522 6:49257785-49257807 CTTCTATGCAGATTAGCTGCTGG - Intergenic
1009654186 6:66518915-66518937 GTTTTCTGCAAGTTAACAGATGG + Intergenic
1009786545 6:68347613-68347635 GTTCTATGATGTTTACCAGATGG + Intergenic
1012705364 6:102521093-102521115 GCTCTATGCTGACCAACAGATGG + Intergenic
1013828277 6:114241918-114241940 GTACTATGGAGAATGACAGAAGG - Intronic
1014401417 6:120995057-120995079 GTTCTATGCAAACTCAGAGATGG + Intergenic
1016528695 6:145034526-145034548 GTTCAACTCTGATTAACAGAAGG + Intergenic
1016780024 6:147947117-147947139 ATTCTATGCAGAGCAAAAGATGG - Intergenic
1021150923 7:17149671-17149693 GTTCATTCCAGATGAACAGAAGG - Intergenic
1021775458 7:24050407-24050429 GTTCCATGCAGAGGAACAGTGGG + Intergenic
1022346100 7:29516089-29516111 GTTCAATGAAGGTTAACAGCTGG + Intergenic
1023413589 7:39911110-39911132 TTTTTTTGCAGATGAACAGAGGG + Intergenic
1024710376 7:52008860-52008882 TTTCTATGCAGAAAAACAGGAGG + Intergenic
1026400025 7:70000774-70000796 TTTCTACTCAGATTAGCAGATGG + Intronic
1032161663 7:129515643-129515665 CTACTACCCAGATTAACAGAGGG + Intergenic
1032440995 7:131943124-131943146 GTTATCTGCAGATTAAGAGTAGG - Intergenic
1034951540 7:155299936-155299958 GTTTGTAGCAGATTAACAGAGGG + Intronic
1036585452 8:10119090-10119112 AGTCTATGCAGATATACAGAAGG - Intronic
1041462770 8:58130224-58130246 GCAATTTGCAGATTAACAGAAGG - Intronic
1042009497 8:64225450-64225472 TTTCTATGCATATAGACAGAAGG - Intergenic
1043631341 8:82338686-82338708 GTCTAGTGCAGATTAACAGAAGG + Intergenic
1043675632 8:82949184-82949206 ATTCTATGCAGATGAACGGATGG - Intergenic
1044004331 8:86923303-86923325 GTCCTATGCAGATGAAGGGATGG + Intronic
1044118026 8:88358220-88358242 ATTCTATAAAGATAAACAGAAGG - Intergenic
1045581074 8:103481241-103481263 GTTGTTTGTAGATTTACAGATGG - Intergenic
1045603706 8:103748684-103748706 ATTATATAAAGATTAACAGATGG - Intronic
1047333214 8:123911497-123911519 TCTCTCTGAAGATTAACAGAGGG - Intronic
1048607539 8:135985132-135985154 GTGATATGCAGATTAAGACATGG + Intergenic
1050197290 9:3099598-3099620 TTTCTATGCAGTTTAACTGTTGG + Intergenic
1051070950 9:13166203-13166225 GTTCTATTCAGAGTAATGGAAGG + Intronic
1052528836 9:29656131-29656153 GGTCTTTTCTGATTAACAGAAGG + Intergenic
1052538364 9:29776562-29776584 GGTCTTTTCTGATTAACAGAAGG + Intergenic
1055875244 9:80934301-80934323 GTTGTTTGCTGTTTAACAGAGGG + Intergenic
1056182479 9:84099044-84099066 GTTCTATTCGAATTAACTGAAGG + Intergenic
1062131321 9:134895108-134895130 GTGCAATGCAGGTTTACAGAGGG - Intergenic
1188809843 X:34639903-34639925 TTTATATGAAGTTTAACAGAAGG - Intronic
1192162156 X:68796526-68796548 GTTCTTTGCAGTTTAACACAAGG - Intergenic
1194237228 X:91399402-91399424 GTAGTATGCAGAGGAACAGATGG - Intergenic
1199666327 X:150099377-150099399 GTTCTGTGGAGATAACCAGAGGG - Intergenic
1201892193 Y:18954855-18954877 GTCCTTTGCAGGTGAACAGATGG + Intergenic