ID: 949973410

View in Genome Browser
Species Human (GRCh38)
Location 3:9431386-9431408
Sequence TTACATTTGCATAAAGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949973405_949973410 29 Left 949973405 3:9431334-9431356 CCTGGTTTCTGTGTATGTGTCCA 0: 1
1: 0
2: 3
3: 49
4: 388
Right 949973410 3:9431386-9431408 TTACATTTGCATAAAGTGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 242
949973407_949973410 9 Left 949973407 3:9431354-9431376 CCAATTCAGTGATAGGAGAAGAA 0: 1
1: 0
2: 2
3: 20
4: 173
Right 949973410 3:9431386-9431408 TTACATTTGCATAAAGTGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949973410 Original CRISPR TTACATTTGCATAAAGTGGT TGG Intronic
900508275 1:3041613-3041635 CTCCATCTGCAAAAAGTGGTAGG + Intergenic
902253117 1:15169039-15169061 TTACATTTTCATATATTGGGTGG + Intronic
904574967 1:31499629-31499651 TGACATGTGCCTAAGGTGGTCGG - Intergenic
907799794 1:57753213-57753235 CCACATTTGTATAAAGTTGTGGG - Intronic
909363733 1:74795937-74795959 TTACTTTTGCATAAAATGTAGGG + Intergenic
914421529 1:147532610-147532632 TTACATTTTTAAATAGTGGTTGG - Intergenic
917187651 1:172378654-172378676 TTACATTTGCATCATATGTTTGG + Intronic
917715518 1:177733280-177733302 TTACATTTGCATGAATTTATGGG - Intergenic
918832861 1:189420659-189420681 TTACTTTTGCATATAGTGTAAGG - Intergenic
923815441 1:237372533-237372555 AAACAGTTTCATAAAGTGGTTGG + Intronic
1063491314 10:6466231-6466253 TTAGATGTGGAGAAAGTGGTGGG + Intronic
1063906038 10:10781283-10781305 TTACATTTGCCTATAGTATTTGG + Intergenic
1067315066 10:45153664-45153686 TTAGATTTTCATTGAGTGGTAGG - Intergenic
1069206019 10:65686521-65686543 TTACATATGCATAAATTGCTAGG + Intergenic
1070157039 10:73841574-73841596 TTAAATTTGCATAAAGAATTGGG - Intronic
1070231995 10:74578126-74578148 TCACATTTGAACAAAGTGGAAGG + Intronic
1071854259 10:89607362-89607384 TTATATGGGCATAATGTGGTGGG + Intronic
1074067170 10:110026656-110026678 TTACATTGGTTTAAACTGGTTGG + Intronic
1074797061 10:116957589-116957611 TTACATTTGAATATAATAGTAGG - Intronic
1076648063 10:131967436-131967458 TTACATTTGGAGAATGTGGATGG - Exonic
1079482347 11:20894827-20894849 TAAGATTTGCATAAATTTGTGGG + Intronic
1079650764 11:22925986-22926008 TCACATTTGCAGAAAATGGTGGG - Intergenic
1081220993 11:40461292-40461314 TGACTTTTCCATAAACTGGTAGG + Intronic
1083447242 11:62716300-62716322 TTTCTTTTGCATAAAATGATAGG - Intronic
1084349513 11:68585410-68585432 AGAGATTTGCTTAAAGTGGTTGG + Intronic
1084709384 11:70834725-70834747 TTATCTTTGCACAAAGAGGTAGG + Intronic
1085804875 11:79626347-79626369 TTACATCAGCATCAAGTGTTAGG - Intergenic
1088320343 11:108549063-108549085 TCTCATTGGCATAAAGTGGATGG - Intronic
1089821617 11:121233037-121233059 TTAATTTTGAATAAATTGGTAGG - Intergenic
1089853689 11:121522030-121522052 TTACATTTGCACAAAGGTGTAGG - Intronic
1091051281 11:132375133-132375155 TTACATTTGCATCAGTTGGCTGG + Intergenic
1093127579 12:15348920-15348942 TTATATTTGTATAAATTTGTTGG + Intronic
1093733340 12:22590594-22590616 TTACATTTGCATAAAGAATTGGG + Intergenic
1094372542 12:29753651-29753673 TTACAGTTGTAAAAAGTGGTAGG - Intronic
1097649075 12:62273401-62273423 CTTCATATGAATAAAGTGGTTGG - Intronic
1099640174 12:85276597-85276619 TAACACTTGCAGGAAGTGGTGGG - Intergenic
1099911646 12:88841016-88841038 TGACATGTGCACAAGGTGGTAGG + Intergenic
1100169132 12:91953121-91953143 TTACATTTGCACAAAGGGTTTGG + Intergenic
1100710630 12:97252462-97252484 TAACATGTGCCTAAAGTGGTAGG - Intergenic
1101288262 12:103338780-103338802 GTGCATTTGCAGAAAGGGGTGGG + Intronic
1103181670 12:118917671-118917693 GTACATCTGCCTAAAGTTGTGGG - Intergenic
1103456200 12:121067918-121067940 ATGAATTTGGATAAAGTGGTTGG - Intergenic
1104659832 12:130603153-130603175 TTACATTTGCATATCCTGGATGG - Intronic
1104757112 12:131276222-131276244 TGACATGTGCCCAAAGTGGTCGG + Intergenic
1105720124 13:23105052-23105074 TTACATTTGCAAAATTTGGGTGG - Intergenic
1106350952 13:28930306-28930328 TTACCTTTGGAAAAAATGGTAGG - Intronic
1107327342 13:39258799-39258821 TTCCATTTGCACAATGTGGGTGG - Intergenic
1107340833 13:39403795-39403817 TTACATGTTTATACAGTGGTGGG - Intronic
1108320829 13:49288777-49288799 TTCCATTTGCATGGAGTGGAAGG - Intronic
1109483544 13:62988629-62988651 TTAAATTTGTATAAAGAGATTGG - Intergenic
1109663845 13:65503191-65503213 TTACATTTCCATAAATTGTGAGG + Intergenic
1110367468 13:74702954-74702976 TTATATTTATATAAATTGGTAGG - Intergenic
1110621555 13:77601545-77601567 TTTCATTTATATAAAGTGCTGGG + Intronic
1113528608 13:111002724-111002746 TGACATTTGCCCAAGGTGGTTGG + Intergenic
1114724775 14:24924228-24924250 TTACATTTCCATATAAGGGTGGG + Intronic
1116074592 14:40094370-40094392 TTATATTTGCATATTTTGGTAGG - Intergenic
1116307570 14:43277706-43277728 CTTCATTTGCATAAAGTGTAAGG - Intergenic
1116375435 14:44193360-44193382 TTATATGTGCAAAATGTGGTTGG + Intergenic
1117116033 14:52513368-52513390 TCACTTTTGGATAAAGTAGTTGG - Intronic
1117543635 14:56772446-56772468 TTCCCCTTGCATGAAGTGGTTGG + Intergenic
1120582311 14:86267919-86267941 TTACATTTCCATCAAGGGGGAGG - Intergenic
1120667586 14:87324965-87324987 TTCCATTTGCATGAAATGTTTGG - Intergenic
1121299607 14:92860027-92860049 TAATATTTCCATGAAGTGGTTGG + Intergenic
1125756230 15:42066932-42066954 TCACATTTGCCTAATGTGTTAGG - Intergenic
1127888298 15:63223495-63223517 TTACAGTTGCATACAGTATTTGG + Intronic
1130128493 15:81115441-81115463 CTACATTTGCGTAAAGAGGAAGG + Intronic
1130360880 15:83184838-83184860 ATACATTTCCATTAAGAGGTGGG + Intronic
1131221336 15:90587063-90587085 CTACATTTGCATTAACTGTTTGG - Intronic
1131978455 15:97970725-97970747 TTACCTCTGAATAAAGAGGTGGG - Exonic
1132180882 15:99752151-99752173 TGGCATTTGAATAAAGTGTTAGG + Intergenic
1135878176 16:26225387-26225409 TTATGTTTGCAGATAGTGGTGGG - Intergenic
1139067826 16:63340552-63340574 TTACATGTACATGAAGTGTTTGG + Intergenic
1141080012 16:81042276-81042298 ATGCATTTTCATAAAGTGCTAGG - Exonic
1141165095 16:81655041-81655063 TCTCATATGCATAAAGTGCTTGG + Intronic
1144046101 17:11456152-11456174 GCACATTTTCAAAAAGTGGTGGG + Intronic
1145290807 17:21544338-21544360 TTAGATGTTCAAAAAGTGGTGGG - Intronic
1145833948 17:27939678-27939700 ATACATTTGCATAAAGCTGATGG + Intergenic
1146324642 17:31875456-31875478 TTACATTTACATAGATTGTTTGG - Intronic
1148259180 17:46164922-46164944 TTATCATTTCATAAAGTGGTGGG - Intronic
1148496454 17:48055894-48055916 TTTCATTTGCATAAAGGGGTGGG - Intronic
1149105871 17:52963836-52963858 TAACATTTGTATAAAGTGTGAGG + Intergenic
1149327377 17:55545843-55545865 TTACATTTGCCTACAGTATTTGG + Intergenic
1149417549 17:56475633-56475655 TTATATTTGGATATAGTTGTGGG + Intronic
1156127704 18:33927047-33927069 TTACATTTTCATAGAGGAGTTGG + Intronic
1158779781 18:60633683-60633705 TTATATCTGTATAAAGAGGTAGG - Intergenic
1159435414 18:68410549-68410571 TTGCATTTGCATATAGTGCATGG - Intergenic
1160452665 18:78976238-78976260 TTTTTTTTGCATTAAGTGGTTGG + Intergenic
1164111667 19:22167257-22167279 TCACAGTTGCATAAAGTTATGGG - Intergenic
1164431528 19:28193277-28193299 GGACATGTGCCTAAAGTGGTCGG - Intergenic
1164939180 19:32238697-32238719 TTACAGATGCATAAAGTCTTAGG - Intergenic
1164959532 19:32415916-32415938 TTACATGTCCTCAAAGTGGTCGG - Intronic
1165780621 19:38431814-38431836 TTACATTTACATAAAGTTTTAGG + Intergenic
1167842325 19:52132097-52132119 TTACATTTACCTAAAATGGTAGG - Intronic
925801521 2:7606834-7606856 GTGCATTTTCATCAAGTGGTGGG - Intergenic
929015519 2:37489985-37490007 TTACTTTTAAATATAGTGGTTGG - Intergenic
930982610 2:57545925-57545947 TTACAGTCCTATAAAGTGGTGGG - Intergenic
931112065 2:59121997-59122019 TTACATTGACAGAAAGTGATAGG + Intergenic
931547488 2:63405755-63405777 TTACATATGAATAAAGTGAATGG - Intronic
933136166 2:78738355-78738377 TTACCTTTGTATAATGTTGTTGG + Intergenic
933196822 2:79399984-79400006 TGACATGTGCCCAAAGTGGTTGG + Intronic
933267145 2:80193262-80193284 TTACATGTACATCAAGTGTTTGG + Intronic
933358515 2:81246655-81246677 TTACATTCGGACTAAGTGGTAGG - Intergenic
935624580 2:105161121-105161143 TAACATTTGTATAAAGTGAAAGG - Intergenic
936832523 2:116665349-116665371 TTACATTTATATAAAGTAATAGG - Intergenic
937425024 2:121791482-121791504 TTACAATTGCAGAAAGTACTTGG + Intergenic
939231842 2:139437284-139437306 TTACATTTCCAAAATGTGTTTGG + Intergenic
939378466 2:141401765-141401787 TCACATTTTCATACAGTGGGGGG + Intronic
939596997 2:144137562-144137584 TTGCATTTACAATAAGTGGTGGG + Intronic
939702972 2:145417315-145417337 TTTCCTTTTCATAAAGTGGGGGG + Intergenic
941094860 2:161227504-161227526 TTACATGTGAAGAAACTGGTTGG - Intronic
941107064 2:161366256-161366278 TTACTTTTGTTCAAAGTGGTGGG - Intronic
941653159 2:168115374-168115396 TTACATATGTTTAAAGTGGGAGG - Intronic
942511306 2:176705066-176705088 TTATATATGAATAAGGTGGTTGG + Intergenic
945078226 2:206061789-206061811 TGTCACTTGCATAAATTGGTTGG - Intronic
946822693 2:223646747-223646769 TGACATGTGCTCAAAGTGGTTGG + Intergenic
1172306416 20:33883954-33883976 TTACATTTGCATAAAGAAACTGG - Intergenic
1174309804 20:49643398-49643420 CTACATTTGCATGGAATGGTAGG + Intronic
1174497845 20:50961327-50961349 TAACATTTTCATAAAATAGTAGG + Exonic
1177814527 21:25961320-25961342 TGACATGTGCCCAAAGTGGTTGG - Intronic
1178118014 21:29437069-29437091 TGACATGTGCCCAAAGTGGTTGG + Intronic
1178247440 21:30967599-30967621 GAACATGTGCCTAAAGTGGTTGG + Intergenic
1178868970 21:36355520-36355542 CTACATTTGCACAAAGCAGTAGG + Intronic
1178960747 21:37062417-37062439 TTAAATTTGCATGAACTGTTTGG + Intronic
1179056154 21:37936742-37936764 TTATTTTTGCATTTAGTGGTAGG - Intergenic
1179105037 21:38391935-38391957 TTACTTTTGGAAAAAGTGGGAGG - Intronic
1179319681 21:40278275-40278297 TAACATTTTCAGAAAGAGGTTGG + Intronic
1181824334 22:25502214-25502236 TTACATTTTAAGAAATTGGTTGG - Intergenic
1184092048 22:42297975-42297997 TCACATCTGTACAAAGTGGTGGG + Intronic
949973410 3:9431386-9431408 TTACATTTGCATAAAGTGGTTGG + Intronic
950210910 3:11122299-11122321 TTACATTTGTATAAAATACTTGG - Intergenic
950700437 3:14741838-14741860 TTACATATAGATTAAGTGGTGGG + Intronic
950979942 3:17291753-17291775 TAGCATTTGCCTAAAGTTGTAGG - Intronic
951665700 3:25121076-25121098 ATGCATGTGTATAAAGTGGTGGG + Intergenic
951916013 3:27801573-27801595 TTACAGTTGAAAAAAATGGTAGG - Intergenic
952191489 3:31027489-31027511 TTCCATTTGTATAAAGTTTTTGG + Intergenic
952197097 3:31087310-31087332 TTACTGTAGCATAAATTGGTGGG + Intergenic
952239215 3:31512489-31512511 TTTTATTTGTATAAAGTTGTGGG + Intergenic
955663880 3:61329730-61329752 CTACATTTGCATCAAGTCATGGG + Intergenic
960117645 3:113912304-113912326 TTACATCTACATAAAATGGTTGG - Intronic
960482477 3:118209908-118209930 TTACTTTTGCATTTAGTAGTTGG + Intergenic
961340983 3:126218120-126218142 TTAAAGTTGCAAAAAGTGTTAGG - Intergenic
962281154 3:134052947-134052969 CTACACTTTAATAAAGTGGTTGG + Intergenic
962534175 3:136312328-136312350 TTACAACTGCATACAGTGTTTGG - Intronic
963285774 3:143433109-143433131 TTAGATTTGCATAAAAGGGTTGG - Intronic
964011035 3:151892072-151892094 ATACACATACATAAAGTGGTCGG + Intergenic
964298155 3:155257072-155257094 GCATATATGCATAAAGTGGTAGG + Intergenic
964413092 3:156419669-156419691 TTATATTTGCATAACTTTGTAGG - Intronic
964630675 3:158806553-158806575 TTAGATTTGTATAACATGGTTGG + Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964707973 3:159640917-159640939 TTAAATTTGCATAATCTGGCAGG + Intronic
965612286 3:170557168-170557190 TTATTTTTGGATAAATTGGTTGG + Intronic
966469890 3:180277438-180277460 TTACAATTTGACAAAGTGGTTGG - Intergenic
966473533 3:180319263-180319285 TTCCATTTCTGTAAAGTGGTGGG - Intergenic
967511558 3:190319411-190319433 TTACATTTTCATAAACCGCTTGG + Intronic
968293708 3:197557220-197557242 TGACATGTGCCTAAGGTGGTTGG - Intronic
970266477 4:14293616-14293638 TTACATTTAAATAGAGTGCTGGG + Intergenic
970767347 4:19565863-19565885 TAACTTTTGCATAAAGGTGTAGG + Intergenic
970842810 4:20495099-20495121 TTCCATTTTGATAGAGTGGTAGG + Intronic
971143421 4:23949609-23949631 ATCCATTTGCTTAAAATGGTTGG - Intergenic
971612466 4:28743345-28743367 GTACATTTGGATAAAATTGTGGG + Intergenic
972104710 4:35468789-35468811 TTACATTCCCATAATGTGGGTGG + Intergenic
976479984 4:85530896-85530918 TTGCATTTGCATAATGTGCAGGG + Intronic
978525554 4:109661687-109661709 TTACATTTGCACAAAGACCTGGG + Intronic
980907957 4:138967084-138967106 TTTCATTTGCATTCAGTTGTAGG + Intergenic
981219846 4:142218890-142218912 CTTCAATTTCATAAAGTGGTTGG + Intronic
981261307 4:142722546-142722568 TTTCATTTGCAAAAAGTTCTTGG - Intronic
981498966 4:145426186-145426208 CTAAATTTGCATAAAATGTTTGG + Intergenic
982940923 4:161553082-161553104 TCACATTTTCATAAAATGTTAGG - Intronic
983256475 4:165405892-165405914 TTATATTGGCATAAAATGGCAGG + Intronic
983863951 4:172740989-172741011 TTACATTTCATTAAAGGGGTAGG - Intronic
985419166 4:189765919-189765941 TTACATTTGCATCCATTAGTGGG + Intergenic
986131883 5:4939704-4939726 TTTCATTTGCATAAAATTTTTGG - Intergenic
986966939 5:13285013-13285035 TAATATTTGTATATAGTGGTAGG + Intergenic
987168959 5:15232900-15232922 AAACATTTGTATAAAGTTGTGGG + Intergenic
987968696 5:24912098-24912120 TTATCTTGGCATACAGTGGTTGG + Intergenic
988701559 5:33680194-33680216 TTACATTTGCAAAACCAGGTTGG + Intronic
989830173 5:45907123-45907145 GAACATGTGCCTAAAGTGGTTGG + Intergenic
990197655 5:53336568-53336590 TATCATTTGCAGTAAGTGGTTGG + Intergenic
992170455 5:74096584-74096606 TTACTTTTGCATATATTTGTTGG + Intergenic
992390077 5:76322861-76322883 TTAATTTTGCATAAAGTGTAAGG - Intronic
992742518 5:79788342-79788364 GTCCATTTGTATTAAGTGGTGGG + Intronic
992975641 5:82116213-82116235 TTGCATTTCCATATAGTAGTTGG + Intronic
993001268 5:82383392-82383414 TTACATTTGCTTAAGGTATTTGG + Intronic
993273483 5:85825742-85825764 TTAAACTCGCATAAAGTGATTGG - Intergenic
993706406 5:91176691-91176713 TTACACTTGCATAAACTAGAAGG + Intergenic
994177386 5:96725814-96725836 TTATATTTGCATAAACTGAAAGG + Intronic
995625612 5:114072952-114072974 TTACCTATGCATAAAATGGCAGG - Intergenic
996718095 5:126603558-126603580 TTTCACTTGCAGAAAGTGCTAGG + Exonic
998063416 5:139137050-139137072 TTACATTTCCACAAAGTGGAAGG - Intronic
1001061794 5:168496865-168496887 TTAAATTTTCATAAAATTGTGGG + Intronic
1001184790 5:169559600-169559622 TTTCATTGTCATAAAGTTGTTGG + Intergenic
1001195622 5:169670918-169670940 TTGTATTTGCATAATGTAGTTGG + Intronic
1003095524 6:3140115-3140137 TTAAATTCGCATAAAATAGTAGG - Intronic
1003730636 6:8818958-8818980 TCAGATTTGCATAAAGTTGCAGG - Intergenic
1004761946 6:18677098-18677120 TTTCCTTTGCATAAAATGGTGGG + Intergenic
1007196515 6:40066266-40066288 ATACATTTGCTTAAATTGTTTGG - Intergenic
1007272377 6:40648226-40648248 TTACATTTGCACTAAGGGGTTGG - Intergenic
1008338377 6:50334471-50334493 ATACATCTGCATTAAGGGGTAGG + Intergenic
1008474859 6:51925406-51925428 TTACATTTAGCTAAAGTTGTGGG - Intronic
1009274674 6:61660480-61660502 TTACATTTGCTTAATGAGATAGG - Intergenic
1012509757 6:99989772-99989794 TTATATTTTCAAAAAGTGGAAGG - Intronic
1012556894 6:100524557-100524579 TTAAATGTACATAAAGAGGTAGG + Intronic
1012589831 6:100967598-100967620 TTTAATTTTCATAAAGTGGGAGG + Intergenic
1012857197 6:104516479-104516501 TTATTTTTGCATTAATTGGTGGG + Intergenic
1013860297 6:114627572-114627594 TAACATTTGCATAAAGCTGAGGG + Intergenic
1016048559 6:139505835-139505857 TGACATGTGCCTAAGGTGGTCGG + Intergenic
1016320438 6:142838534-142838556 TAACTTTTGCATAAAATGTTAGG - Intronic
1018311949 6:162518995-162519017 TTATATTTTCCTAAAGTGCTAGG - Intronic
1018928572 6:168224047-168224069 TTACATCTGCCTGGAGTGGTAGG - Intergenic
1020668537 7:11076223-11076245 TTACATTTGAACAGTGTGGTTGG + Intronic
1020765732 7:12318080-12318102 TCACATTTGCCTAAATTTGTGGG - Intergenic
1021067328 7:16192733-16192755 TTACTTTTGCATTAGGTGATAGG + Intronic
1021279096 7:18694797-18694819 TTCCATTTGCATAAACTGGAGGG - Intronic
1022191372 7:28019551-28019573 TAACATTTCCATGAAGTGGTTGG - Intronic
1022223010 7:28332686-28332708 TCTAATTTGCATAAAGTTGTGGG - Intronic
1022679930 7:32535219-32535241 TTACATTTCCATAAGGCGGAGGG - Intronic
1023473338 7:40549571-40549593 AGACATTAGCATAATGTGGTCGG + Intronic
1026607609 7:71829099-71829121 TGACATGTGCACAAGGTGGTTGG - Intronic
1026610887 7:71858855-71858877 TGACATGTGCCCAAAGTGGTCGG - Intronic
1028076564 7:86524098-86524120 TTAAATTTGCATATATTAGTAGG - Intergenic
1028939948 7:96510409-96510431 TTACAATTGCCTATAGTGTTTGG - Intronic
1030278058 7:107741202-107741224 TTACATTTAGATAAAGTAGTGGG - Intergenic
1030880449 7:114871755-114871777 TCACATTTGTAAAAAGGGGTCGG - Intergenic
1030940774 7:115646611-115646633 TTATAATTACATAAAGTTGTGGG + Intergenic
1032154563 7:129457311-129457333 TTACAATTGCATATGGTGTTCGG - Intronic
1033091987 7:138394257-138394279 ATACTTTGGCCTAAAGTGGTGGG - Intergenic
1033807341 7:144969767-144969789 TAACATTTACTTAAAGTTGTAGG - Intergenic
1036461524 8:8957677-8957699 ATACAATTGCAGAAAGGGGTTGG - Intergenic
1037136882 8:15473485-15473507 TTACATGTTCATAAAGTATTGGG + Intronic
1037167674 8:15850532-15850554 GAACATTTGCACAAAGTGATAGG - Intergenic
1037349338 8:17933502-17933524 CTACATTTAGAAAAAGTGGTTGG + Intronic
1038291890 8:26257152-26257174 TTAACTTTTCATAAAATGGTGGG + Intergenic
1038517496 8:28199774-28199796 ACACAGTGGCATAAAGTGGTAGG + Intergenic
1039722839 8:40183140-40183162 TTCTTTTTGCATAAGGTGGTGGG - Intergenic
1041249619 8:55921599-55921621 TGAGATTTGCATAAATGGGTAGG + Intronic
1046565115 8:115889414-115889436 GTACTGTTGCTTAAAGTGGTAGG - Intergenic
1046568564 8:115933047-115933069 TTTCATGTGCAGAAAGTGGTAGG + Intergenic
1047219361 8:122907218-122907240 TGACATGTGCCTAAGGTGGTTGG + Intronic
1048233301 8:132664802-132664824 TGACAGTTGCATGAAGTGATTGG - Intronic
1048520124 8:135146117-135146139 TGACATGTGCCTAAGGTGGTTGG + Intergenic
1050101264 9:2122562-2122584 TTACATTTCCAGAATCTGGTAGG - Intronic
1051885320 9:21886605-21886627 TGACTTTTGCATAAAGTGAGAGG + Intronic
1052114419 9:24632409-24632431 GCACATTTTCATAAAGTTGTTGG + Intergenic
1055360259 9:75482175-75482197 ATATATTTTCATAAAGTGGATGG - Intergenic
1055691845 9:78840654-78840676 TTTCATTTTCATTAAGTGGATGG - Intergenic
1056287245 9:85102389-85102411 TAACTTTTGCATAAAGTGTGAGG + Intergenic
1057977966 9:99627060-99627082 TTACATTTACATACAGATGTGGG + Intergenic
1058663879 9:107291355-107291377 TTAAATTGGCATGAATTGGTTGG + Intronic
1058714110 9:107708036-107708058 CTTCATTTGCAAAAACTGGTAGG - Intergenic
1059600620 9:115773944-115773966 AAACATTTGCACAATGTGGTGGG - Intergenic
1059974678 9:119702705-119702727 TTAGATTTTCATAGGGTGGTTGG - Intergenic
1062061412 9:134497518-134497540 TTTCATCTGAATAAAGTGGCAGG - Intergenic
1187409009 X:19031445-19031467 ATACATTTGCATAAAGAGCTAGG - Intronic
1187499424 X:19827071-19827093 TGATATTTGTTTAAAGTGGTTGG - Intronic
1188413361 X:29901475-29901497 TGACATTTGAATAAACTGCTAGG + Intronic
1188716457 X:33464776-33464798 GTACATGTGCACAACGTGGTGGG + Intergenic
1193667536 X:84340544-84340566 ATACATTTTCATAAACTGGAAGG + Intronic
1194792335 X:98166063-98166085 TCAAATTTCCATAATGTGGTTGG + Intergenic
1195292017 X:103438550-103438572 TGACATGTGCCCAAAGTGGTCGG - Intergenic
1195791292 X:108590532-108590554 TTTCATTTTCAAAAACTGGTTGG - Intronic
1195883376 X:109615767-109615789 TTACATTTGTATAAAATTGTAGG + Intergenic
1198265049 X:135001311-135001333 TTCCATATACATAAAGTAGTAGG + Intergenic
1198748611 X:139916481-139916503 TTACATTTGCATACTGTATTTGG - Intronic
1199451858 X:147986486-147986508 TTACTTTTGCATAAGGTGTAAGG + Intronic
1199513546 X:148650115-148650137 TTACATTTGGATAAATTGATGGG + Intronic