ID: 949980050

View in Genome Browser
Species Human (GRCh38)
Location 3:9496775-9496797
Sequence TTTTAGAAAGAGCACTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 3, 2: 26, 3: 85, 4: 452}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949980050_949980053 21 Left 949980050 3:9496775-9496797 CCACCAGAGTGCTCTTTCTAAAA 0: 1
1: 3
2: 26
3: 85
4: 452
Right 949980053 3:9496819-9496841 TTCTGCTTCAAATCCTTCAGTGG 0: 1
1: 2
2: 26
3: 140
4: 672

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949980050 Original CRISPR TTTTAGAAAGAGCACTCTGG TGG (reversed) Intergenic
901148149 1:7082124-7082146 TTTTAGAAACATCACTCTGGTGG - Intronic
902810435 1:18885117-18885139 TGTTGGAAAGACCACTCTGAGGG + Intronic
904416883 1:30367680-30367702 ATTTAGAAAGAGAAATCTAGTGG - Intergenic
904490953 1:30858661-30858683 TTCCAGGAAGATCACTCTGGTGG - Intergenic
904709845 1:32421918-32421940 TTTTAGAAAGTGCACTATCTTGG + Intergenic
904970885 1:34418604-34418626 TTATAGAAACATCACTCTTGTGG - Intergenic
905027671 1:34862102-34862124 CTTTAGTCAGAGAACTCTGGAGG - Intergenic
905203024 1:36326609-36326631 TTTTGGAAAGATCCCTGTGGTGG + Intronic
905466697 1:38159797-38159819 TTTTAAAAAGATCACCTTGGTGG + Intergenic
905562676 1:38939967-38939989 TATTAGAAAGACCAGGCTGGGGG - Intronic
905608047 1:39321890-39321912 TTTTAGAAAAAGTATTCTGGTGG + Intronic
905744275 1:40400802-40400824 TTTTAGAAAGATTATTCTGGTGG + Intronic
906114895 1:43349769-43349791 TTTTAGAAAGATTATTCTGGTGG - Intronic
906344680 1:45007748-45007770 TTTTAGAAAGCTCTCCCTGGTGG - Intronic
906459491 1:46026540-46026562 GTTTAGAAAGCTCACTCTGCCGG + Intronic
906798279 1:48714620-48714642 TTTCAGAAGGACCACTCTGGTGG - Intronic
907035891 1:51215854-51215876 TTTTAGAAACAGCAATCTGGTGG - Intergenic
907105828 1:51881685-51881707 CTTTAAAAAGAGGTCTCTGGCGG + Intergenic
907325811 1:53638069-53638091 GTTTAGAGGGATCACTCTGGTGG + Intronic
907431497 1:54414691-54414713 TTTTGGAAAGAGCTCTGTGAAGG + Intergenic
907475612 1:54703268-54703290 TTTTAACAAGACCATTCTGGTGG - Intronic
907539000 1:55194992-55195014 TTTAAGGAAGATCATTCTGGTGG - Intronic
907695579 1:56724578-56724600 TTTTAGAAAAATGACTCTGCAGG - Intronic
907992893 1:59600012-59600034 TATTAGAAAGATCATTGTGGTGG + Intronic
908071732 1:60467895-60467917 TTTTAGAAAGATTATTCTGATGG + Intergenic
908095134 1:60729740-60729762 TTTTAAAAAGATAATTCTGGAGG - Intergenic
908238574 1:62170265-62170287 TTTTAAAAAGCCCACTGTGGTGG - Intergenic
908881712 1:68740132-68740154 ATTAAGAAAGAACACTTTGGGGG - Intergenic
908889549 1:68828826-68828848 TTTTACAAAGATAACTTTGGAGG + Intergenic
909498424 1:76305519-76305541 TTTTGGAAAGCTCAGTCTGGAGG + Intronic
909575365 1:77170096-77170118 TTTAAGGAAGATCACTCTGGGGG - Intronic
911489538 1:98546340-98546362 TTTAAGAAAATTCACTCTGGAGG - Intergenic
911721908 1:101200258-101200280 TTTTTAAAAGACCACTCTGGTGG - Intergenic
912359135 1:109080256-109080278 TTTTAAAAAGATCACTTTTGCGG + Intergenic
912515331 1:110213223-110213245 TTAAAGAAAGAAAACTCTGGGGG + Intronic
913203945 1:116518408-116518430 CTTTAGTAAGATCACTCTGCTGG - Intronic
913284551 1:117214563-117214585 TTTTAGAAAGATCATTCTAGTGG - Intergenic
914978445 1:152389577-152389599 TTTTAGAAAGTTCGTTCTGGAGG - Intergenic
915017845 1:152752809-152752831 TTTTAGGATGATCACTCTTGTGG + Intronic
915112163 1:153570883-153570905 TTTTAGAAAGGTTATTCTGGTGG - Intergenic
916628290 1:166583440-166583462 TTTTAGAAAGTCAACTCTGGTGG - Intergenic
916826307 1:168445179-168445201 TTCTAGAAAGATGACCCTGGTGG + Intergenic
916860776 1:168802678-168802700 TTTTGGAAAGAGCATTCTGGTGG - Intergenic
917264449 1:173205597-173205619 TGTTAGAAAAAGCACTCTCAGGG + Intronic
918169593 1:181983829-181983851 TTTTAGAAAGAGGCCTCCAGAGG - Intergenic
918216101 1:182392501-182392523 TTTTACAGAGAGGATTCTGGAGG + Intergenic
918555307 1:185792132-185792154 TTTTAGAAGGATAACTCTGAAGG + Intronic
918743367 1:188165858-188165880 TTTTAGAAACATCACTTAGGTGG - Intergenic
918962862 1:191303051-191303073 TGTCAGCAAAAGCACTCTGGTGG + Intergenic
919166151 1:193896060-193896082 TTTTAGAAAGATTTCTCTGCCGG + Intergenic
919799486 1:201344800-201344822 ATTTAGAAAGATGACTCTAGTGG - Intergenic
919937858 1:202266478-202266500 GTTGAGAAAGACCACTCTGGTGG - Intronic
920447766 1:206032557-206032579 TTTGAGGAAGAGCCCTCTTGAGG - Intergenic
921602488 1:217121407-217121429 TTTTAGAAAAATCACTCTCCTGG + Intronic
922392523 1:225160018-225160040 TTTTAGGAAAACAACTCTGGTGG - Intronic
922398209 1:225224372-225224394 TTTTAGAAAGTGCAGCCTGGGGG - Intronic
922752617 1:228077694-228077716 TTTGAGTCAGAGCTCTCTGGGGG - Intergenic
922957047 1:229611767-229611789 TTTTAGAAAACTCAGTCTGGTGG - Intronic
923955458 1:239013368-239013390 TCTTATAAAGTTCACTCTGGTGG + Intergenic
924062813 1:240193815-240193837 TTTTAGAAAGATAACTCTGGAGG - Intronic
924367768 1:243313998-243314020 TTTTAGAAAGAGCTCTGGGCTGG - Intronic
924715389 1:246567998-246568020 TTTTAAAAAAAACACTGTGGTGG + Intronic
1063648267 10:7907819-7907841 TTTTAGAAAGACTCCTCTTGAGG + Intronic
1063815483 10:9766958-9766980 CTTTACAGAGAGCCCTCTGGTGG - Intergenic
1064038532 10:11936850-11936872 TTTCAGAAAGAGTATTATGGTGG - Intronic
1064040902 10:11962631-11962653 TTTTAGAAAGATTAGTATGGAGG - Intronic
1064664855 10:17640306-17640328 TATTAGAAAAATCATTCTGGCGG + Intergenic
1065508752 10:26456548-26456570 TTTTAAGAAGAAAACTCTGGTGG + Intronic
1065596214 10:27314406-27314428 TATTAGTAAGAGCATCCTGGTGG - Intergenic
1065739487 10:28784308-28784330 CTTTGGAAAGATCATTCTGGTGG + Intergenic
1066134143 10:32426630-32426652 TTTCAGAAAAAGCACCCTGGAGG + Intergenic
1066161202 10:32731642-32731664 TTTCAGGAAAAGTACTCTGGTGG + Intronic
1070333851 10:75437544-75437566 TTTTACAGACAGCACTCTGTGGG - Intronic
1070400244 10:76046873-76046895 TTTTAGAAACAGAACTATAGAGG + Intronic
1070693076 10:78542152-78542174 TTCTAGAAAGATCACTCTGTGGG - Intergenic
1071325323 10:84509996-84510018 TTTTAGAATGATCACTCCAGTGG - Intronic
1071546129 10:86531223-86531245 TTTTAGAAATATCATTCTGGGGG - Intergenic
1074082620 10:110179701-110179723 TTTTAGAAAGAGCATTCTCAAGG - Intergenic
1074092903 10:110279408-110279430 TTTTAGAAAGACTTCTCTTGAGG - Intronic
1074116898 10:110462992-110463014 GCCTAGAAAGATCACTCTGGCGG + Intergenic
1074808249 10:117075880-117075902 TTTTAGAAAGATAACTTTAGAGG + Intronic
1075652532 10:124138384-124138406 TTTGAGAAAGTCCACTGTGGAGG + Intergenic
1078324694 11:10369953-10369975 GGGTGGAAAGAGCACTCTGGAGG - Intronic
1078474238 11:11617914-11617936 TTTTAAAAAAAGCATCCTGGGGG - Intronic
1079151982 11:17908117-17908139 TTTTAGAAAGATCACTGTGATGG - Intronic
1079165194 11:18034341-18034363 TGTTAGAAAGAGCAATATGCTGG - Intronic
1079170732 11:18092867-18092889 TCTTAGGAAGATTACTCTGGTGG + Intronic
1079293407 11:19209542-19209564 GTTTTGAAAGATGACTCTGGTGG - Intronic
1079653188 11:22956770-22956792 TTTTAGAATGGGGAGTCTGGAGG - Intergenic
1079809329 11:24976175-24976197 TTGGAGACAGAGCACTTTGGGGG - Intronic
1080320500 11:31003813-31003835 TTTTAGAAAGAGCACAATGTAGG + Intronic
1081165311 11:39801566-39801588 ATTTAGAAATAACAATCTGGGGG - Intergenic
1083400155 11:62418027-62418049 TTTTAGGAAGATCATTCTGATGG + Intronic
1083597462 11:63925151-63925173 TTTTAGAAAGATCACCCTGGAGG - Intergenic
1083807270 11:65082184-65082206 TTTAAGAAAGACCCCTCTGGGGG - Intronic
1083848754 11:65352970-65352992 TTTTACACAGAGCCCTCTGCTGG + Exonic
1084851427 11:71944378-71944400 TTATAGAAAGATCATTCTTGGGG + Intronic
1085136935 11:74099479-74099501 TTTTACAAAGAGCACCTTTGTGG - Intronic
1085614456 11:77985225-77985247 TTTTAGAAATGTCACTCTGAGGG - Intronic
1086008814 11:82073346-82073368 TTTTAGAAAAGTCACTCTGCTGG - Intergenic
1087042158 11:93812154-93812176 TTTTAAAAACAGCACTCTTTTGG - Exonic
1087630243 11:100641740-100641762 TTTTAGTAAGTCCATTCTGGGGG + Intergenic
1087666700 11:101057513-101057535 TTTTAGAAAAATGATTCTGGGGG + Intronic
1087808897 11:102588836-102588858 TTTTTGAAAGATAACTCTAGTGG + Intronic
1087918974 11:103844459-103844481 TTTTATACAGAGCACGCTAGTGG - Intergenic
1089009620 11:115121907-115121929 TTTTAGAAAGGCCACTTTGATGG + Intergenic
1089204631 11:116749755-116749777 TTTCAAAGAGATCACTCTGGAGG + Intronic
1089680925 11:120118481-120118503 TTTTAGAAAGATAGCTTTGGTGG - Intronic
1089735639 11:120548629-120548651 TTTTGGGAAGAGACCTCTGGTGG + Intronic
1090415117 11:126535190-126535212 TTTTGGGAAGAGCAGTCAGGAGG - Intronic
1090533003 11:127610691-127610713 TTTTAGCAAAACCACTCTGCAGG + Intergenic
1090983318 11:131743482-131743504 TTTTAGGAAGAGTACTATGAAGG - Intronic
1090988257 11:131792694-131792716 TTTCAGAAAGAGCAGTGTGAAGG - Intronic
1091363255 11:134995034-134995056 TTTTAGACAGAGGACTTTTGGGG - Intergenic
1091998320 12:5013122-5013144 TTTTAGGAAGATTACTGTGGTGG + Intergenic
1095536502 12:43254589-43254611 TTTTTGAAAAAGCACTTTAGTGG - Intergenic
1095689904 12:45075892-45075914 TTTTAAAAGGACCACTCTTGTGG + Intergenic
1096715698 12:53489989-53490011 TTTTAGAAAGATCCTTCTGAAGG - Intronic
1097079579 12:56420324-56420346 TTTTAAAAAGATAAATCTGGAGG + Intronic
1097652348 12:62316301-62316323 TTTTAGAAAGATGACTCTATGGG - Intronic
1098318071 12:69212915-69212937 TTTTAAAAAGAATACTTTGGTGG - Intergenic
1098340692 12:69447907-69447929 TTTTAAAAGGCGCACTCTTGGGG + Intergenic
1098430286 12:70411904-70411926 TTTTAGAAAGATGAGTCTAGTGG + Intronic
1098437309 12:70481649-70481671 TTTTAGATAAATCATTCTGGTGG + Intergenic
1099329089 12:81258988-81259010 CTTTAGAAATAGCACTGTGATGG - Exonic
1099788881 12:87304474-87304496 TTTTAGAAAGATCGATCTGTAGG - Intergenic
1099866415 12:88287945-88287967 TTTTAGAAATATCTTTCTGGTGG - Intergenic
1100075228 12:90772870-90772892 ATGTAGACAGAGAACTCTGGGGG - Intergenic
1100488267 12:95052708-95052730 TTTTAGAAATTGTACTCAGGAGG - Intronic
1100528763 12:95445192-95445214 TTGAAGAAAGGGCACTCTGATGG - Intergenic
1100908693 12:99333048-99333070 TTTTAGAAACATCACTCTGGAGG + Intronic
1100951943 12:99860539-99860561 TTTTAGAAAGATCCCTCTGGAGG + Intronic
1101221549 12:102646621-102646643 TTTTAGAGAGACCACTCTGGAGG + Intergenic
1101546367 12:105717077-105717099 TTTTGGAGAGATCACTCTGGTGG + Intergenic
1101956414 12:109216180-109216202 TTTTAGAAAGGACACTGAGGTGG - Intronic
1102226923 12:111235351-111235373 TTCCAGAAAGATCTCTCTGGAGG + Intronic
1102643076 12:114383561-114383583 TTTTACAAAGATCTCTTTGGTGG + Intronic
1102975314 12:117202726-117202748 TTTTAGGAAGGGCACTCTGGGGG + Intergenic
1103320550 12:120090495-120090517 TTTTCCAAAGAGCACTGTGCTGG + Intronic
1103910333 12:124348574-124348596 TTGCAGACAGAGCACCCTGGAGG - Intronic
1104286548 12:127429862-127429884 TTTTACACTGAGCACTTTGGTGG - Intergenic
1104353178 12:128062370-128062392 TTTTCGACAGAGGACCCTGGGGG - Intergenic
1104589759 12:130074947-130074969 TTTTCTAAAGAGATCTCTGGTGG - Intergenic
1105796630 13:23860642-23860664 TTTTAGACAAATCCCTCTGGTGG + Intronic
1105808805 13:23975599-23975621 TTTTAGAAAGAGAAGGTTGGAGG - Intergenic
1106618195 13:31349892-31349914 CTTTAGAAAGATTACTCTGGGGG - Intergenic
1107054711 13:36090549-36090571 TCTTAGAAAGAGCTCTCTGGAGG + Intronic
1107113083 13:36718694-36718716 TTTTAGAAAGTTCAGGCTGGAGG - Intergenic
1107621744 13:42239700-42239722 TTTTAGAGAGACCACTCTGGTGG - Intronic
1107635792 13:42390920-42390942 TTTTAGAAAGTGCACGTTGTTGG - Intergenic
1107809724 13:44188723-44188745 TTCCAGAAAGATCACTCAGGTGG - Intergenic
1108421442 13:50253772-50253794 CTTTCTAAAGAGCACTCTGGAGG - Intronic
1108495651 13:51022267-51022289 GTTTAGAATGATCACTCTGGAGG - Intergenic
1110729656 13:78865863-78865885 TGTTAAAAAAAACACTCTGGAGG + Intergenic
1111838146 13:93414613-93414635 TTTTAGGAAGAGACTTCTGGTGG + Intronic
1112176162 13:97027249-97027271 CATCAGAAAGTGCACTCTGGAGG + Intergenic
1112426707 13:99308982-99309004 TTGTTGAAAGACCATTCTGGTGG + Intronic
1113044636 13:106142223-106142245 TTGTAGAAAGTGCATTCTTGCGG - Intergenic
1113283877 13:108824250-108824272 TTTTAGCAGTAGCATTCTGGAGG - Intronic
1114070322 14:19100070-19100092 CTTTAAACAGACCACTCTGGAGG + Intergenic
1114091939 14:19299932-19299954 CTTTAAACAGACCACTCTGGAGG - Intergenic
1114310840 14:21465594-21465616 ATTTTAAAAGATCACTCTGGAGG - Intronic
1115394757 14:32895669-32895691 TTGTAAAAAGATCACTCTGATGG - Intergenic
1115678687 14:35711770-35711792 TTTTAAAAAGAGGACTTGGGTGG - Intronic
1117520384 14:56545778-56545800 TTTTGGAAAGACCCCTCAGGTGG + Intronic
1117873680 14:60227046-60227068 TTTTAGAAAGATTACACTGATGG - Intergenic
1118799698 14:69178316-69178338 TTTTAGAAAGATAAGTCTGGAGG + Intergenic
1119136772 14:72228509-72228531 TTTGAGAAAGATAATTCTGGTGG + Intronic
1119409345 14:74420006-74420028 TTTTAGACAGAGCACTCTGATGG + Intronic
1119919990 14:78437949-78437971 TTTTAGAAAGATCTTTCTGGTGG + Intronic
1120017341 14:79488822-79488844 TTTTAGAATGATCTCTTTGGGGG + Intronic
1120067027 14:80054511-80054533 TTTTAGGAAGAGGACTTTGTGGG + Intergenic
1120525374 14:85570899-85570921 TTTTAAAAAAACAACTCTGGTGG + Intronic
1120860151 14:89247719-89247741 TTTTATAAAGATGACTCTGCAGG - Intronic
1121303222 14:92888498-92888520 TCTTAAAAGGACCACTCTGGCGG + Intergenic
1121346309 14:93138211-93138233 TTTCTGGAAGAGCATTCTGGTGG + Intergenic
1121474756 14:94187850-94187872 TTTTAGGAAGAGTACCATGGTGG + Intronic
1124859436 15:33424371-33424393 TTTTAGAAAAATAACTCTGCAGG - Intronic
1124944285 15:34249097-34249119 TTTTAGAAAAGTCATTCTGGTGG + Intronic
1125270746 15:37936075-37936097 TGTTAGATTGAGCACTTTGGAGG + Intronic
1125422535 15:39519037-39519059 TTTTCAAAAAAACACTCTGGAGG - Intergenic
1126351439 15:47748832-47748854 TTTTAGAAAGATCATTCTGGTGG + Intronic
1126354954 15:47785550-47785572 TTTTAGAAAGATTATTCTGATGG - Intergenic
1126634521 15:50767778-50767800 TTTTAGAAAGCTCTCTATGGTGG + Intergenic
1127341001 15:58044042-58044064 GTTTAGAAAAAGCACTGAGGTGG - Intronic
1127550018 15:60027990-60028012 TTTAAAAAGGATCACTCTGGTGG - Intronic
1128971204 15:72108311-72108333 TTTTGGCAAGAACACTCTGTAGG - Intronic
1129202658 15:74014106-74014128 TTTTAGAAATACCATGCTGGTGG + Intronic
1130436594 15:83905633-83905655 TTTTTGAAAGATCCCTCTGGTGG + Intronic
1131843869 15:96468379-96468401 TTTTAGAAAGATTAACCTGGAGG + Intergenic
1132158494 15:99514335-99514357 TTACAGAGAGAGCACTGTGGAGG - Intergenic
1135636479 16:24080088-24080110 CTTTTGAAAGATCACTTTGGTGG + Intronic
1135707736 16:24689302-24689324 CTTTAGGAAGAGCCCTCTGGTGG + Intergenic
1135828980 16:25756307-25756329 GTTTAGTAAAATCACTCTGGTGG + Intronic
1137947371 16:52746950-52746972 TTTTAGAAAGATTACTCTGATGG - Intergenic
1138409790 16:56829843-56829865 TTTTAGAAAGAGTCCTGTTGAGG + Intronic
1138462921 16:57163256-57163278 TTTTAAAAAGAAGAGTCTGGGGG - Intronic
1139064353 16:63293463-63293485 GTTTAGAAAGATCTCCCTGGTGG - Intergenic
1140271934 16:73473879-73473901 TTTTAAACAGAGCACTCCGTTGG + Intergenic
1141118256 16:81330223-81330245 TTCTAGAAACATCACTCTGGCGG - Intronic
1143283744 17:5773919-5773941 TTTTAGAAAGATGTCTCTGCTGG + Intronic
1143287684 17:5802376-5802398 TTTTAGAAAGATCCCTTGGGGGG - Intronic
1144531982 17:16048361-16048383 TTTTAGACAAATCACTCAGGTGG + Intronic
1146458035 17:33022247-33022269 TTTTAGAAAGATCCTTCAGGCGG - Intronic
1146585623 17:34079119-34079141 TTTTAGAAGTATCACTCTGGTGG - Intronic
1146974074 17:37096176-37096198 TTTTAGAAAGACCACTAAGGGGG - Intronic
1148745038 17:49913320-49913342 TTCCAGAAAGAGCAGGCTGGAGG + Intergenic
1149219634 17:54401693-54401715 GCTTAGAGAGACCACTCTGGAGG + Intergenic
1149462032 17:56836605-56836627 TTTTAGAAAGATCATTTGGGTGG - Intronic
1149550667 17:57537219-57537241 CTTTAGAATGAGCCCACTGGAGG - Intronic
1150610024 17:66726484-66726506 TTTCAGGAAGACCACTGTGGAGG + Intronic
1151066206 17:71152930-71152952 TTATGGAAAGAGCACACTGGTGG + Intergenic
1151245736 17:72793136-72793158 TTTTAGGAAGATAATTCTGGGGG + Intronic
1153896935 18:9571900-9571922 TTTTAGAAAGACCATTCTGGAGG + Intronic
1155025746 18:21939197-21939219 TATTAGAAATATCACTCTGCTGG - Intergenic
1155535151 18:26809300-26809322 TTTTAGAAAGACAATTCTGGGGG + Intergenic
1155865982 18:30965290-30965312 TTTAAGAAAGATCACTCTATTGG - Intergenic
1155876261 18:31093067-31093089 TTTTAGAATGATAACTCTGTTGG - Intronic
1155888294 18:31235563-31235585 CTTTAGCAAGAGAACTCTTGGGG + Intergenic
1156088264 18:33435174-33435196 TTTTAAAAAGAGCAATTTTGGGG + Intronic
1156284665 18:35679983-35680005 TTTAAAAAAGCTCACTCTGGAGG - Intronic
1157912093 18:51625775-51625797 TTTTAGGAAGAACACTATGAAGG - Intergenic
1159881742 18:73864831-73864853 TTTTAGAAAAATTACTTTGGTGG - Intergenic
1160487524 18:79308032-79308054 TTTTAAAGAGAGGAGTCTGGTGG + Intronic
1160927734 19:1555230-1555252 TTTTTTAAAGATCACCCTGGAGG + Exonic
1161741127 19:6021823-6021845 TTTTAGCAGGATCACTCTGGTGG + Intronic
1162200750 19:9018343-9018365 TTTTTGAAAGGTCACTCTGTTGG - Intergenic
1163247607 19:16106829-16106851 TTTTAGAATAAGCACACTGCAGG + Intergenic
1164891271 19:31825740-31825762 TTTCAGCAAGATTACTCTGGGGG - Intergenic
1165242501 19:34480118-34480140 TTTTGGGAAGAGCAGTTTGGCGG - Intergenic
1166938655 19:46350094-46350116 TTTTAGGAACACCCCTCTGGAGG + Intronic
926122326 2:10250659-10250681 TTACAGAAGGAGCACTCAGGGGG - Intergenic
926733216 2:16053067-16053089 TTTTGGAAAGATCACTTTGGTGG + Intergenic
926741651 2:16116238-16116260 TTTTAGAAAGCTCACCCTGGAGG + Intergenic
926931180 2:18042654-18042676 TTTTAGAAAAGTCACTCTTGGGG - Intronic
926983242 2:18593846-18593868 TTTTAGAAAGATCTCTTTAGTGG - Intergenic
927464154 2:23324503-23324525 TTTATGGAAGATCACTCTGGAGG - Intergenic
928466101 2:31524046-31524068 TTTTAGAAAGCGCCCTCTTGTGG + Exonic
929311654 2:40432781-40432803 TTTTAGAAGGATCTCTCTGCTGG + Intronic
930166629 2:48209757-48209779 TTTTAGAAAAAGCACTCTGAGGG + Intergenic
931514695 2:63041780-63041802 TTTTGTAAAGAGCACATTGGGGG - Intronic
932132136 2:69197283-69197305 TTTTACAAGGAGCACTGTGGTGG - Intronic
932564665 2:72898364-72898386 TTTTACACAGAGCAGGCTGGTGG + Intergenic
932749251 2:74361014-74361036 TTTTAGAAACAGCATTCTTCTGG + Exonic
933121974 2:78549802-78549824 TTTTATAAAGTACAATCTGGAGG - Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933781685 2:85807017-85807039 TTTTGGAAAGATCACTTTGGTGG + Intergenic
935051680 2:99530055-99530077 TTTTACAAAGAGGAGTCTGGAGG + Intergenic
935619705 2:105118060-105118082 CTTTAGAAAGAGCTCCCTGCTGG - Intergenic
936022450 2:109005249-109005271 TTTTAGAAAGATTAGTCTGGAGG - Intergenic
936509410 2:113133061-113133083 CATTAGAAAGACCATTCTGGAGG - Exonic
936647037 2:114384100-114384122 TTTCAGAAAAATCACCCTGGGGG + Intergenic
936702879 2:115034925-115034947 TTTTAGCAAGATAACTCTGTAGG - Intronic
938035389 2:128030508-128030530 ATTTAGAAAAAGAATTCTGGAGG - Intergenic
938150122 2:128875270-128875292 TTTAAGAAAGAGCACAATGTGGG - Intergenic
939221967 2:139313860-139313882 TTTTGGAAAGAACACTCTTGTGG - Intergenic
939792975 2:146602947-146602969 TTTTAGAAAGCTAACTCTGAAGG + Intergenic
939894911 2:147779837-147779859 TTTCAGAAAGAGCAATCTGGTGG - Intergenic
940008881 2:149034653-149034675 CTTTTGAATGAGCACTCCGGGGG - Intergenic
940212602 2:151271036-151271058 TTTTAGAAAGAGAACTCTGGTGG + Intronic
940286144 2:152034736-152034758 TGTTTAAAAGAGCACTGTGGGGG - Intronic
941361312 2:164554804-164554826 TTTTATGAAGAGCAGTCTAGGGG - Intronic
941492761 2:166163079-166163101 ATTTAGAAAGGTCTCTCTGGGGG - Intergenic
942542665 2:177031029-177031051 TCTTAGAAAGAGCACTCAGTTGG + Intergenic
942555907 2:177172093-177172115 ATTTAGAAAAGGCACTCTGCTGG - Intergenic
942914015 2:181280592-181280614 TCTTAGAAATAACACCCTGGTGG + Intergenic
943440365 2:187920380-187920402 TTTTAGAAAGAGTATTATAGTGG - Intergenic
944469856 2:200041476-200041498 TTTTAGACAAATCACTGTGGTGG - Intergenic
944804586 2:203268642-203268664 TCTTTGAAAGGCCACTCTGGTGG - Intronic
945325287 2:208474753-208474775 TTTTAAAAAGAAAACTCTAGAGG + Intronic
945476647 2:210290511-210290533 TTTCAGAAAGAAAACTCAGGAGG + Intronic
945728139 2:213498975-213498997 TTTTAGAAAGACTACTATGATGG - Intronic
946728242 2:222683370-222683392 TTTTAAAGAGAACACTCTGGTGG - Intronic
946766908 2:223049438-223049460 ATCTAGAAAGTGCACTCTGTCGG - Intergenic
947120868 2:226813387-226813409 TGTTAGATAGATCACTCTTGTGG + Intergenic
947315915 2:228858045-228858067 TTTTTGAAAGGTCACTCTTGTGG + Intronic
948063919 2:235062518-235062540 TTTTAGAAGGACCCTTCTGGGGG - Intergenic
948162752 2:235838340-235838362 TTTTAGCAAAATCACTTTGGAGG - Intronic
948433236 2:237934109-237934131 TTTTAAAAAGATTACTCTGAGGG - Intergenic
1169049734 20:2565660-2565682 TTTTAGAAATAGTAGTGTGGGGG + Intronic
1169410507 20:5365480-5365502 ATTTAGAAAGGGCACTCTATTGG - Intergenic
1169501525 20:6165365-6165387 TTTCAGAAGCAGCACCCTGGTGG - Intergenic
1170985221 20:21251662-21251684 TTTCAGAAAGAACACTATAGAGG - Intergenic
1172013005 20:31857284-31857306 ATTTAGAAAGATCCCCCTGGAGG - Intronic
1172875204 20:38160011-38160033 TGTTAGCAAGAGAACTTTGGGGG + Intronic
1173050912 20:39560886-39560908 GTTTAGAAAGATGATTCTGGTGG + Intergenic
1173113584 20:40218913-40218935 TTTTTTAAAGAGCACACTGATGG + Intergenic
1173230905 20:41196667-41196689 TTTTCAAAAGAGGACACTGGAGG + Intronic
1174464555 20:50707234-50707256 TTTTAGAAGGATCACTGTGGAGG + Intergenic
1174927929 20:54781502-54781524 TTTAAGAAAGAGAATTCTAGTGG + Intergenic
1175336299 20:58198518-58198540 TTTTGGAAAGATCACCCTGGTGG + Intergenic
1175529204 20:59662663-59662685 TTTTTAAGAGAGCCCTCTGGAGG + Intronic
1177155675 21:17499081-17499103 TTTTGGAAAGAAAACTCTAGAGG - Intergenic
1177666171 21:24162521-24162543 GTTTAGATAGGTCACTCTGGTGG - Intergenic
1177763482 21:25429993-25430015 TTTTAGAAATATCACTTTGGAGG - Intergenic
1178193759 21:30318830-30318852 AATTAGAAAGAACATTCTGGTGG + Intergenic
1179153075 21:38825603-38825625 TTTAACAATCAGCACTCTGGGGG - Intergenic
1180488793 22:15822632-15822654 CTTTAAACAGACCACTCTGGAGG + Intergenic
1180639427 22:17286514-17286536 TTTTTGAAAGAGCTCCGTGGTGG + Intergenic
1181991500 22:26840269-26840291 TTTGATAAAGACCATTCTGGGGG + Intergenic
1182200149 22:28560347-28560369 TTTTGGAAAGGTCATTCTGGTGG - Intronic
1182745919 22:32605417-32605439 CTTTAGGAAGAGTTCTCTGGAGG + Intronic
1182995615 22:34809286-34809308 TTTTAGAAATATCACCCCGGTGG - Intergenic
1183593657 22:38796592-38796614 TTGTGGAAAGATCACTCTGGTGG + Intergenic
1184153554 22:42652148-42652170 TTTTAAAGAGGGAACTCTGGGGG + Intergenic
949449693 3:4171991-4172013 TTTTAGAAAGATCACATTGAAGG + Intronic
949980050 3:9496775-9496797 TTTTAGAAAGAGCACTCTGGTGG - Intergenic
950997559 3:17519078-17519100 CTTCAGAAAGAGCATTCTTGGGG + Intronic
954500036 3:51004218-51004240 TTTTGGATAAATCACTCTGGGGG + Intronic
954554075 3:51504659-51504681 TTTTAGAAAGACCATTCTACAGG + Intergenic
955072786 3:55585629-55585651 TGTTAGAGAGAGCTCTTTGGGGG + Intronic
955081245 3:55659570-55659592 CTTTAGAAGGACCCCTCTGGTGG - Intronic
955930775 3:64054644-64054666 TTTTAGAAAGATCTTTCTGGTGG - Intergenic
956285583 3:67606394-67606416 TTTTTTAAAGAGAATTCTGGAGG - Intronic
956309937 3:67867717-67867739 TTTAATAAAGACCACTATGGTGG - Intergenic
956324623 3:68037722-68037744 TTTTAGAGAGATCACTCCAGAGG + Intronic
956491575 3:69777942-69777964 TTACTGAAAGATCACTCTGGCGG + Intronic
956496468 3:69831791-69831813 CTTTAGAAAGATTAATCTGGGGG + Intronic
956555823 3:70521389-70521411 ATTTAGAAAGGGCATTCTGGTGG - Intergenic
956616083 3:71174221-71174243 TTGTAGAAAGATTACTGTGGAGG + Intronic
957717512 3:83948274-83948296 TTTTAAAAAGAGGATTCTTGTGG - Intergenic
958252772 3:91289572-91289594 TTTGAGAAAGAAAACACTGGAGG - Intergenic
958859409 3:99427988-99428010 TTGTAGGAAGAAAACTCTGGTGG - Intergenic
959134361 3:102398534-102398556 TTTTAGGAAGATGTCTCTGGAGG - Intronic
959243479 3:103830703-103830725 TTTTAGAATGATCACTGTGTTGG - Intergenic
959615486 3:108342593-108342615 TTTTAGAAAGATCACACCAGTGG - Intronic
960423567 3:117478542-117478564 TTTTAGAAACATAACTCTGATGG - Intergenic
961207978 3:125102496-125102518 TTTTAGAAAGATCATTCAGTGGG + Intronic
961315414 3:126032234-126032256 TTTTAGAAAGGCCACCCAGGTGG + Intronic
961617950 3:128198481-128198503 TTTCAGAAAGGGCACTCTTCCGG + Intronic
962016919 3:131450785-131450807 TTTTAGAAAATGCACACTGAAGG - Intergenic
962865166 3:139442466-139442488 TTTCAGAAAGACCCCACTGGTGG - Intergenic
962916710 3:139911142-139911164 TTTTAGAAACATCAATCTGCAGG + Intergenic
962943381 3:140145819-140145841 TGTTGGAAAGATCACTCTGCTGG - Intronic
963652247 3:147994572-147994594 TCTTAGAAGGAGCACTCTTGGGG + Intergenic
964541968 3:157789665-157789687 TTTTAGAAAGATGACCTTGGCGG - Intergenic
964559080 3:157973716-157973738 TTTTAAAAAGTGCACCCTGAAGG - Intergenic
965007473 3:163044107-163044129 TTTCTGAAAGAGGACTCTGATGG + Intergenic
965874576 3:173300609-173300631 AATTAGAAACAGGACTCTGGAGG + Intergenic
966566256 3:181384806-181384828 TTTTAGAAAGATCACTTAAGCGG - Intergenic
966605946 3:181821881-181821903 TTTTAGAAAGATCTCTCTGCCGG + Intergenic
966697189 3:182802310-182802332 GTTTAATAAGATCACTCTGGTGG - Intronic
968725216 4:2244272-2244294 TTATAGAAAGAGATCCCTGGAGG + Intergenic
968826136 4:2898848-2898870 TTTTTCAAAGAGTACTGTGGGGG - Intronic
969049217 4:4360744-4360766 TTTGCGAAAGAGCACTGAGGGGG + Intronic
969069494 4:4523765-4523787 TTTGAGAAAGATCATTCTGCTGG - Intronic
969652567 4:8476462-8476484 TTTTAAAAATACCAATCTGGTGG - Exonic
969867640 4:10086015-10086037 TATTAGGAAGAGCACTCTCAGGG + Intronic
971276640 4:25204613-25204635 TTTTAGAAAATGTACTATGGAGG + Intronic
971433158 4:26589920-26589942 ATCTACAAAGAGCACTCTGGTGG - Intronic
971798886 4:31262523-31262545 TTTTAGAAAGACCACTTTTGGGG + Intergenic
972294426 4:37723057-37723079 TTTTAATCAGATCACTCTGGTGG - Intergenic
972768323 4:42172220-42172242 TTTAAAAAGGATCACTCTGGTGG - Intergenic
973096660 4:46210463-46210485 ATTTAGAAAGACCACTCTGCTGG + Intergenic
973793201 4:54396974-54396996 ATCGAGAAAGATCACTCTGGTGG + Intergenic
974889879 4:67868767-67868789 TTTTAGAAAGGTTAATCTGGTGG + Intronic
975398009 4:73900124-73900146 TTTCAGAAAGAGTGCCCTGGAGG + Intergenic
976056644 4:81077081-81077103 GTTTTGAATGATCACTCTGGTGG - Intergenic
976774105 4:88688355-88688377 TTTTAGAAAGATTACTTTGGGGG + Intronic
976839552 4:89415361-89415383 TTTTAGAAAGATTACTCTAGTGG + Intergenic
977123716 4:93137815-93137837 TTTTGGAAACATCACTCTTGAGG - Intronic
977139877 4:93355731-93355753 TTTAAGAAAGAGAGCTCTGCAGG + Intronic
977724659 4:100281760-100281782 TTTTAAAAAGAGTGTTCTGGCGG - Intergenic
978037529 4:104014075-104014097 TTTTAGGAAGATAACTCTGGTGG + Intergenic
978114484 4:105003011-105003033 TTTTAGAAGGAGCCCTCAGTTGG - Intergenic
978779075 4:112531058-112531080 TGTTAGAAAAATCATTCTGGTGG + Intergenic
979381152 4:120008489-120008511 TTGAAGAGAGAGAACTCTGGGGG - Intergenic
980066842 4:128198736-128198758 TTTTAGGAAGATAACTTTGGTGG + Intronic
980686046 4:136229917-136229939 TTTTAAAAAGACCATTCTTGTGG - Intergenic
981401838 4:144322327-144322349 TTTCTGCAAAAGCACTCTGGTGG - Intergenic
982597219 4:157401932-157401954 TCTAAGAAACAGCACCCTGGAGG - Intergenic
983095159 4:163552731-163552753 TTTAAGAATGAGGGCTCTGGGGG + Intronic
984104762 4:175531587-175531609 TTATAGAAAGGTCACTCTTGTGG + Intergenic
984226914 4:177046135-177046157 TTTTAGAAAGATCATTCTAGAGG + Intergenic
984587381 4:181579348-181579370 TTTTTAAAAGATCGCTCTGGTGG - Intergenic
984833813 4:184000459-184000481 TTTCAGAAAGATGACTGTGGTGG - Intronic
984927512 4:184819625-184819647 TTCTAGAAAGCAAACTCTGGCGG - Intronic
985830819 5:2228066-2228088 CTTTAGAATGAGCCCACTGGAGG - Intergenic
986981812 5:13456865-13456887 TTTTAGAGAGATAACTCTGATGG - Intergenic
987173383 5:15282094-15282116 TTTTGGAAAGATAATTCTGGTGG + Intergenic
987840558 5:23218085-23218107 TCTGAGAAAAAGCACTCTTGTGG + Intergenic
988315422 5:29620475-29620497 TTTTATATAGAGAACTTTGGTGG + Intergenic
988526037 5:31988099-31988121 GTTTAGAAAGGTCCCTCTGGTGG - Intronic
989717998 5:44488750-44488772 TTTTAGAAATACAACTCTGTTGG + Intergenic
990528830 5:56654129-56654151 TTGTAGAAAGATCACTCTCATGG - Intergenic
992168514 5:74078354-74078376 TTTTAAAAAGAGCAGCCTGGTGG - Intergenic
992181349 5:74201164-74201186 TTTTGGAAAGTGCTCTCTGAAGG - Intergenic
992611939 5:78515601-78515623 TTTAAGAAGCAACACTCTGGAGG - Intronic
993059849 5:83026056-83026078 TTTTAGAACGATCATTCTGGGGG + Intergenic
993189303 5:84660993-84661015 TTTTATTAAGATCACTCTTGTGG - Intergenic
993300667 5:86205527-86205549 TTTTAGAAACAGCACTTTCCTGG + Intergenic
993611560 5:90060629-90060651 GTTTTGAAAGATCACTCTGGTGG - Intergenic
993809637 5:92459337-92459359 TTTCATAAAGGTCACTCTGGGGG + Intergenic
993935313 5:93993018-93993040 TTTTAGAAAGTAAACTCTGAAGG + Intronic
994304646 5:98188346-98188368 TTTTCTAAAGAACAGTCTGGAGG + Intergenic
994659829 5:102640498-102640520 TGTTAGAAATAGTAATCTGGGGG + Intergenic
995401218 5:111744141-111744163 TTTTGGAATGAGCACTTCGGGGG - Intronic
995671551 5:114609773-114609795 GGGAAGAAAGAGCACTCTGGAGG + Intergenic
996029520 5:118689440-118689462 TTTTGGAAAGATCACTCTGCTGG + Intergenic
997149562 5:131478381-131478403 TTTTAGGAAGACCTCTCTGATGG - Intronic
998106622 5:139473064-139473086 TTATAGAGAGAGCCCTGTGGTGG + Intergenic
998132613 5:139659038-139659060 TTTCAGGAAGAGCACAGTGGGGG + Intronic
998698101 5:144664157-144664179 TTTTAGAAAAAGACCTATGGAGG - Intergenic
999035266 5:148341854-148341876 GTTTAGAAATACCACTCTGAAGG - Intergenic
999266142 5:150268165-150268187 TTTTAAAAAGAGCTCCTTGGTGG - Intronic
999336064 5:150717982-150718004 TTTTAGAAGTATCACCCTGGTGG + Intronic
999614414 5:153406850-153406872 TTTGAGGAAGATTACTCTGGTGG + Intergenic
999622175 5:153484852-153484874 TTTTAAAAATTTCACTCTGGTGG + Intergenic
999676769 5:154012029-154012051 TTTTAGAAAGATCACTTTGGTGG + Intronic
999733869 5:154498048-154498070 TTGTAGGAAGAGCACCCTGGTGG - Intergenic
999803688 5:155062025-155062047 GTTTAGAAAGATAATTCTGGGGG - Intergenic
1000067368 5:157706305-157706327 TTCTAGTAAGAGCTCACTGGAGG - Intergenic
1000191485 5:158915168-158915190 CTTCAGAAAGTGAACTCTGGGGG + Intronic
1001090361 5:168735776-168735798 TTTTAGAAATACTACCCTGGAGG - Intronic
1002179777 5:177425208-177425230 TTTTAAAAATATCACTCTGGTGG - Intronic
1003127217 6:3364865-3364887 GTTTGGAAAGCTCACTCTGGCGG + Intronic
1003340378 6:5214516-5214538 TTTGAAAAAGATCACTGTGGTGG + Intronic
1003428551 6:6017426-6017448 TTTTGGAAAGAAGACTGTGGAGG + Intergenic
1003477730 6:6499616-6499638 TTTTAAAAACAGCACTGTGGAGG + Intergenic
1003867797 6:10379604-10379626 TTTCATAAAGAGGAATCTGGAGG + Intergenic
1003896207 6:10609996-10610018 TTATAGGAAGAGCCATCTGGTGG + Intronic
1004596547 6:17104680-17104702 TTTGAGAAAGATCCTTCTGGAGG - Intronic
1005049233 6:21667788-21667810 TTGTAGAAAAAGCATTTTGGGGG + Intergenic
1005822234 6:29607438-29607460 TTTTAGCAAGATCACCCTGGTGG - Intronic
1006252372 6:32798549-32798571 TTTTAGAAAGACTACTCTGATGG + Intergenic
1006281000 6:33053060-33053082 TTCTAGAAAGTGCAGTCTTGGGG - Intergenic
1007192195 6:40028939-40028961 AGTTAGAAAAAGCACTTTGGGGG + Intergenic
1007912210 6:45527359-45527381 TTTTTCAAAGCTCACTCTGGCGG + Intronic
1008600776 6:53091858-53091880 ATTTTAAAAGATCACTCTGGTGG - Intronic
1008992999 6:57625575-57625597 TTTTAGAAAAGGTACTCTTGTGG + Intronic
1009181613 6:60524680-60524702 TTTTAGAAAAGGTACTCTTGTGG + Intergenic
1009191711 6:60637349-60637371 TTTGAGAAAGAAAACACTGGAGG + Intergenic
1009307627 6:62110589-62110611 TTTGGGAGAGAGGACTCTGGAGG - Intronic
1009449881 6:63788557-63788579 TTTTTGATAAAGGACTCTGGTGG - Intronic
1010106553 6:72176201-72176223 TTTTAGAAATTGCACTATGCAGG - Intronic
1010255241 6:73749895-73749917 TTTTAGGAAGATCACTTTGGTGG + Intronic
1011016523 6:82762207-82762229 TTTCAGAAGGAGTACTATGGTGG + Intergenic
1011560357 6:88607687-88607709 GTTTTGAAAGATCACTCTGGTGG + Intergenic
1011793586 6:90927455-90927477 TTTTAGAAGGATCACTCTGGTGG + Intergenic
1012267519 6:97164030-97164052 TTTTAGGAAAAGTAATCTGGGGG + Intronic
1012267781 6:97167487-97167509 TTTTAGAAAGATGATTCTGGTGG - Intronic
1012479677 6:99652630-99652652 TTTTAGAAAGATCTCTCTGATGG - Intergenic
1013071356 6:106732159-106732181 TTTTAGAGATACAACTCTGGAGG - Intergenic
1013332540 6:109119258-109119280 TTTTAGGTAGATCACTCTAGGGG + Intronic
1014046615 6:116896027-116896049 TGATAAAAAGAGCAATCTGGAGG - Intronic
1014399890 6:120975329-120975351 ATTTAGAAATAGCACTCTGGTGG - Intergenic
1014773942 6:125487269-125487291 TTTTAGAAAAAACACTCCAGTGG + Intergenic
1014993727 6:128115009-128115031 TTTTAGGAATATCACCCTGGGGG - Intronic
1015199503 6:130563484-130563506 TTTTAGAAAGATTTCTCTGTTGG + Intergenic
1015256277 6:131183082-131183104 TTTTACACAGAGCCCTCTGCTGG - Intronic
1015785001 6:136913944-136913966 TATTAGAAAGAGCAGTCTTTTGG - Intergenic
1016488113 6:144565749-144565771 TTTTGGAAAGAGCAATTTGGAGG + Intronic
1016770946 6:147850365-147850387 TTTTAGATACAGCCCTCTGCCGG - Intergenic
1018167798 6:161115964-161115986 TTTTAGAAAGATCACTCTAGAGG + Intronic
1018496330 6:164349040-164349062 ATTTAGGAAGAGCACTGTGAAGG - Intergenic
1020928510 7:14363127-14363149 TTTTAGCAACAGTAATCTGGTGG - Intronic
1021848250 7:24783612-24783634 TTTTAGAAAAATCACTCTGGTGG + Intergenic
1021892369 7:25198339-25198361 TTTTAGAAAAATCTCCCTGGTGG - Intergenic
1022085125 7:27059676-27059698 TTTTAGAAATTTCACTCTGCAGG + Intergenic
1023351420 7:39323697-39323719 TTTTACAAAGATAATTCTGGTGG + Intronic
1023517581 7:41017468-41017490 TTTTAGAAAGATTTCACTGGAGG + Intergenic
1023751751 7:43379614-43379636 GATTAGAAAGAGGACTCTCGAGG - Intronic
1024092401 7:45955214-45955236 TTTTAGAAAGAACTCTTTGTAGG + Intergenic
1025026350 7:55519454-55519476 TTTAAGGAAGAGCACACAGGAGG + Intronic
1025837225 7:65105485-65105507 TTTTATGCAGAGCACCCTGGAGG - Intergenic
1025907006 7:65795010-65795032 TTTTACGCAGAGCACCCTGGAGG - Intergenic
1026216900 7:68357702-68357724 TTTTAGAAAGATCATTTTGTTGG + Intergenic
1026795137 7:73361515-73361537 CTTTAGAAAGACCATTCCGGGGG - Intergenic
1027406244 7:77864343-77864365 TTTAAGATAAATCACTCTGGTGG - Intronic
1027743186 7:82038774-82038796 TTTTAGAAATATCACTTTAGAGG + Intronic
1027903071 7:84143173-84143195 TTGTAGAAAGTTTACTCTGGGGG - Intronic
1028752716 7:94399384-94399406 TGTTAAAAAGAGGACTGTGGTGG - Intronic
1029571743 7:101374336-101374358 CTTTACATAGATCACTCTGGAGG - Intronic
1029805421 7:102990990-102991012 TCTGAGAAAGACAACTCTGGTGG + Intronic
1029882919 7:103835879-103835901 TTTTAGAAAGATCACTCTGGTGG - Intronic
1029919810 7:104251283-104251305 ATTAAGAAAAAGAACTCTGGAGG - Intergenic
1030664451 7:112259794-112259816 TTCTAGAAAGAGCATGCTAGAGG - Intronic
1030895168 7:115050766-115050788 TTTTAGAAAGATCATTCTAGTGG + Intergenic
1031063978 7:117084239-117084261 TGTTAGAAAGATGACTCAGGTGG + Intronic
1031848784 7:126838230-126838252 TTTTAGAAATAGCATCTTGGGGG + Intronic
1032345574 7:131113523-131113545 TTTTAGAAAGATCTCTCAGCTGG + Intronic
1032371006 7:131351730-131351752 TTTTAGAAAGACCACTCCCTAGG + Intronic
1032436420 7:131904718-131904740 TTTTAGACAGATCACCCTGTTGG + Intergenic
1032448013 7:132001267-132001289 TTTTAGAAAGATAATTCTGGTGG + Intergenic
1032809746 7:135400314-135400336 TTTTAGAAAGATTAATTTGGTGG + Intronic
1033002079 7:137517063-137517085 TTTTAGAAAGAATACTGTAGAGG - Intronic
1033258605 7:139822884-139822906 TTCTAGAAATATCACTCAGGAGG - Intronic
1033516439 7:142111291-142111313 TTATACCAAGAGAACTCTGGAGG + Intergenic
1034166898 7:149032197-149032219 TTTTATAAAGATCACTCTGGGGG + Intergenic
1036279453 8:7387317-7387339 TTTTAAGAATAGCACTTTGGAGG + Intergenic
1036342066 8:7924560-7924582 TTTTAAGAATAGCACTTTGGAGG - Intergenic
1036627743 8:10485560-10485582 TTTTTGATAGAATACTCTGGTGG + Intergenic
1039020673 8:33202238-33202260 ATATAGAAAGAACGCTCTGGTGG + Intergenic
1039222030 8:35342590-35342612 TTTAAGAAACACCACTCTAGAGG - Intronic
1040739064 8:50549513-50549535 TTTTAGAAATATCTCTCTGTGGG - Intronic
1040811255 8:51456140-51456162 TTTTAGAAAAATGTCTCTGGTGG - Intronic
1040832041 8:51688363-51688385 TTTTAGAAAGGGCATTCTGTTGG + Intronic
1040865929 8:52048981-52049003 ATTTAGGAAGAACAGTCTGGAGG - Intergenic
1041173766 8:55171924-55171946 TATCAGAAAGACCCCTCTGGAGG - Intronic
1041334238 8:56761872-56761894 TTTTACAAAGCTCAATCTGGAGG - Intergenic
1042026971 8:64434108-64434130 TTTTAGAAATATCACTCTCATGG + Intergenic
1042604057 8:70528491-70528513 TGTTAGAAAGGTCACTCTGGTGG + Intergenic
1042753044 8:72179266-72179288 TTTTATAATGACCACTGTGGTGG + Intergenic
1044468974 8:92542861-92542883 TTTTAGAAATAGTACTTTGAAGG - Intergenic
1044471580 8:92575355-92575377 TTTTAGAAATAGAACTCTGTTGG - Intergenic
1044880945 8:96721616-96721638 TTTCAAAAAGTTCACTCTGGAGG - Intronic
1045042327 8:98237497-98237519 TTTTAGAGCGATTACTCTGGTGG - Intronic
1045215849 8:100147591-100147613 TTTTAGAAAGTCCACTCTGGTGG + Intergenic
1045427158 8:102078377-102078399 TTTTTAAAAGATCACTGTGGTGG - Intronic
1046844708 8:118902944-118902966 TTTTAGAAAAATCATTCTAGAGG - Intergenic
1047304547 8:123642345-123642367 TTTTAAAAAGATCACTCTGGCGG + Intergenic
1047506179 8:125482569-125482591 TATTAGAATGAGCATTCTGCTGG + Intergenic
1048288489 8:133161741-133161763 TTTTTGAAAGATCACCATGGTGG + Intergenic
1050360796 9:4829224-4829246 TTTTAGGAAGATAATTCTGGAGG + Intronic
1050843054 9:10177487-10177509 TATTGGAAAGAACACACTGGTGG + Intronic
1051398460 9:16653544-16653566 TGTCACAAGGAGCACTCTGGGGG + Intronic
1051578141 9:18640899-18640921 TTTTAGGAAACGCACTCTGAAGG - Intronic
1053175277 9:35917885-35917907 TCCAAGAAAGAGCTCTCTGGCGG - Intergenic
1053391459 9:37739390-37739412 TTTGAGAAAGATCACTCTGGAGG + Intronic
1054952938 9:70873322-70873344 TTTTGGAAAGAACACACTGATGG - Intronic
1055704380 9:78981650-78981672 TATTAGAAAGAGCACTTGGATGG - Intergenic
1056089906 9:83195302-83195324 TTGGAGAGAGAGAACTCTGGAGG - Intergenic
1056112634 9:83410823-83410845 TTTTAGAAAGAGAATTTAGGAGG - Intronic
1056680689 9:88715039-88715061 GTTAAGATAGAGGACTCTGGGGG - Intergenic
1057424321 9:94936158-94936180 TTTTAAGGAGAGCTCTCTGGTGG - Intronic
1057855960 9:98600893-98600915 TTTTAGGGAGATCACTCTGAAGG - Intronic
1058113107 9:101053441-101053463 TTTTTGGAAGATAACTCTGGAGG - Intronic
1058117218 9:101098105-101098127 GTTCAGAAATATCACTCTGGAGG + Intronic
1058473229 9:105302882-105302904 TTTCAGGCAGATCACTCTGGAGG + Intronic
1058601055 9:106670729-106670751 TTTTAGTAAACTCACTCTGGTGG - Intergenic
1058698948 9:107585259-107585281 TTCTAGAAAGAGCTTTCTAGTGG - Intergenic
1058827454 9:108787740-108787762 TTTTAGAAAGATGACTCAAGTGG + Intergenic
1059226468 9:112677671-112677693 TTTTTAAAAGATCACTCTGGAGG + Intergenic
1059505537 9:114796283-114796305 CTTTAGAAAAAGCCCTCTGAAGG - Intronic
1059705730 9:116821574-116821596 ATTTAGAAATAGCACTCTGTTGG - Intronic
1060141737 9:121216276-121216298 TTGTAGAATGATCACTCTGATGG - Intronic
1060404170 9:123364948-123364970 TTTTAGAAGGTCCACTCTGGTGG - Intronic
1060807461 9:126586647-126586669 TTTTAGAAAGACCTCGCTGGAGG + Intergenic
1061995182 9:134179558-134179580 TTCTAGAAGGAGGAGTCTGGGGG + Intergenic
1186335498 X:8582608-8582630 TTTTAGAAGGATCACTCAGGTGG + Intronic
1186933146 X:14416913-14416935 TTTTAAAAAGAGAGCTCTGGAGG + Intergenic
1187558968 X:20382016-20382038 TTTTAGGAAAATCAGTCTGGAGG - Intergenic
1187828155 X:23353760-23353782 TTTTAGAAAAATAAGTCTGGTGG + Intronic
1188970609 X:36611119-36611141 TTTTTTAAATAGCACTTTGGAGG + Intergenic
1189075188 X:37906935-37906957 TTTTAGAAAAATCATTTTGGTGG + Intronic
1189338408 X:40185774-40185796 TTTTAGGAAGCTCACCCTGGGGG - Intergenic
1189397491 X:40635912-40635934 TTTTAGAAAGTTAACTCTTGTGG - Intronic
1189745718 X:44166974-44166996 TTTTAGAAAGAGCACTGTGGTGG - Intronic
1190937707 X:55011485-55011507 TTTTAGAAAAATCCCTCTAGTGG + Intronic
1191731310 X:64338657-64338679 TCTTTGAAAGATCACTGTGGTGG + Intronic
1192218641 X:69181390-69181412 TTTTAGAACCTTCACTCTGGGGG + Intergenic
1192765617 X:74137085-74137107 TTTTAGAAAGTGCACTATCTTGG + Intergenic
1192852040 X:74967209-74967231 TTTTAGGAAGATAACTCTGATGG + Intergenic
1193223445 X:78954171-78954193 TTTTAGAAAGATCAGGCTGCTGG - Intronic
1193729615 X:85086993-85087015 TTTTAAAAAGATCACTCGGCCGG - Intronic
1194653505 X:96543976-96543998 TTTTAGAAACAGTACTTTGTGGG + Intergenic
1195161677 X:102177793-102177815 TTTTAGAAAGCGCAGTCCTGGGG + Intergenic
1196235221 X:113272165-113272187 TTTTACAGAGAGGAATCTGGAGG - Intergenic
1196615910 X:117767080-117767102 TTTTAGAAATATCATTCTGGTGG + Intergenic
1196637277 X:118017077-118017099 TGCTAGAAAGATCACTTTGGTGG - Intronic
1197119909 X:122878875-122878897 ATTTAGTAAGATCACTCTGTTGG + Intergenic
1198253965 X:134908965-134908987 TTTTAGAAAGAGGAGGCTGCAGG + Intronic
1199177161 X:144802798-144802820 ATTTAGAAAGAGAGCTATGGTGG - Intergenic
1199883288 X:151993879-151993901 TTTTAGAAAGTGGACTCTGAAGG + Intergenic
1200085187 X:153600686-153600708 TTTTAGAAAGCTCGCTCTGGCGG - Intergenic
1200385902 X:155890677-155890699 CTTTAGAAAGATCACTCTGGTGG + Intronic
1201428055 Y:13875690-13875712 TTTTAGTAGGATCACTCAGGTGG - Intergenic