ID: 949980848

View in Genome Browser
Species Human (GRCh38)
Location 3:9500892-9500914
Sequence ACGCCCCCACAGTGGGTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 127}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949980841_949980848 -3 Left 949980841 3:9500872-9500894 CCCTGCCAAGGGGAAGGGAGACG 0: 1
1: 0
2: 2
3: 20
4: 206
Right 949980848 3:9500892-9500914 ACGCCCCCACAGTGGGTGGAGGG 0: 1
1: 0
2: 1
3: 8
4: 127
949980843_949980848 -8 Left 949980843 3:9500877-9500899 CCAAGGGGAAGGGAGACGCCCCC 0: 1
1: 1
2: 1
3: 43
4: 270
Right 949980848 3:9500892-9500914 ACGCCCCCACAGTGGGTGGAGGG 0: 1
1: 0
2: 1
3: 8
4: 127
949980842_949980848 -4 Left 949980842 3:9500873-9500895 CCTGCCAAGGGGAAGGGAGACGC 0: 1
1: 0
2: 1
3: 21
4: 173
Right 949980848 3:9500892-9500914 ACGCCCCCACAGTGGGTGGAGGG 0: 1
1: 0
2: 1
3: 8
4: 127
949980838_949980848 3 Left 949980838 3:9500866-9500888 CCTGCTCCCTGCCAAGGGGAAGG 0: 1
1: 0
2: 3
3: 35
4: 305
Right 949980848 3:9500892-9500914 ACGCCCCCACAGTGGGTGGAGGG 0: 1
1: 0
2: 1
3: 8
4: 127
949980835_949980848 8 Left 949980835 3:9500861-9500883 CCTCACCTGCTCCCTGCCAAGGG 0: 1
1: 0
2: 3
3: 62
4: 458
Right 949980848 3:9500892-9500914 ACGCCCCCACAGTGGGTGGAGGG 0: 1
1: 0
2: 1
3: 8
4: 127
949980832_949980848 19 Left 949980832 3:9500850-9500872 CCAGGAGTCTCCCTCACCTGCTC 0: 1
1: 0
2: 3
3: 32
4: 358
Right 949980848 3:9500892-9500914 ACGCCCCCACAGTGGGTGGAGGG 0: 1
1: 0
2: 1
3: 8
4: 127
949980833_949980848 9 Left 949980833 3:9500860-9500882 CCCTCACCTGCTCCCTGCCAAGG 0: 1
1: 0
2: 2
3: 44
4: 424
Right 949980848 3:9500892-9500914 ACGCCCCCACAGTGGGTGGAGGG 0: 1
1: 0
2: 1
3: 8
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949980848 Original CRISPR ACGCCCCCACAGTGGGTGGA GGG Exonic
900256018 1:1698507-1698529 CCGGCCCCACACTCGGTGGATGG + Intronic
900264686 1:1751117-1751139 CCGGCCCCACACTCGGTGGATGG + Intergenic
900572095 1:3363663-3363685 AAGCCCCCACAGTGGCCGGGGGG + Intronic
901027352 1:6285608-6285630 CCGCCTCCACATTTGGTGGAGGG - Intronic
901336531 1:8454095-8454117 ACTCCACCAGAGTGGGAGGAAGG - Intronic
901770039 1:11525339-11525361 CCGCCACCACTGTGGGTGGTGGG + Intronic
901879987 1:12188213-12188235 ACATACCCACAGGGGGTGGAAGG + Intronic
903694845 1:25199168-25199190 AGGCGCCCACAGTGTGTGGCTGG - Intergenic
908000994 1:59678917-59678939 ACACTCACACAGTGGGAGGAAGG - Intronic
915089890 1:153416914-153416936 CTGCCCCCACAGAGGGAGGAGGG + Intronic
917504657 1:175616651-175616673 ACGCCCAGACAGTGGGAGCATGG - Intronic
920226092 1:204440311-204440333 TCGTCCCCACACTGGATGGAGGG + Exonic
920558958 1:206925310-206925332 GCCCCCCGACAGCGGGTGGAGGG + Intergenic
920843550 1:209575036-209575058 ACCTCCCCACAATAGGTGGAGGG - Intergenic
923767009 1:236901699-236901721 ATGTTCTCACAGTGGGTGGAGGG + Exonic
1062835251 10:631309-631331 CCGCTGCTACAGTGGGTGGAAGG - Intronic
1066376024 10:34858272-34858294 AAGCCCGCACAGTCAGTGGAGGG - Intergenic
1067544973 10:47186244-47186266 TCTCCCACACTGTGGGTGGAAGG - Intergenic
1069436468 10:68388595-68388617 AGGAGGCCACAGTGGGTGGATGG + Intronic
1070649170 10:78222547-78222569 TCGCCCCCACTGTGGGGTGAGGG + Intergenic
1073440513 10:103549881-103549903 AAGGCCACACAGTGGGTGGAAGG - Intronic
1075967403 10:126624800-126624822 TAGCCCCCACAGTGGGGGGCAGG + Intronic
1077134907 11:993676-993698 ACGCCCCCGCGGGGGGGGGACGG - Intronic
1081926713 11:46835766-46835788 CCACCCCCAAAGTGGGTGAAGGG - Intronic
1084393059 11:68891089-68891111 CCGCCGCCACATGGGGTGGAGGG + Intergenic
1089877989 11:121744511-121744533 AAGCCACCATAGTGGTTGGAGGG - Intergenic
1092030193 12:5277433-5277455 ACGGCTCCACAGTGGGTGGCGGG - Intergenic
1092604265 12:10101610-10101632 AAGCTACCACGGTGGGTGGAGGG - Intronic
1092920864 12:13230620-13230642 AGGAGCCCACAGTGGGAGGAGGG + Intergenic
1098041996 12:66361896-66361918 AGGCCCCGAGGGTGGGTGGAGGG - Intronic
1101726943 12:107395700-107395722 TGGCCCCCACTGGGGGTGGATGG - Intronic
1103661885 12:122526781-122526803 ACGTTCCAACAGTGGGTGAACGG - Intronic
1106257086 13:28031717-28031739 AAGGCCCCACAGTGGGTGGGAGG + Intronic
1107058629 13:36131725-36131747 AGGCCCCCACCGTCGGGGGAGGG + Intergenic
1110695070 13:78478368-78478390 ATCCCCTCACAGTGGGTGGCTGG - Intergenic
1118721194 14:68594960-68594982 AAGCTGCCACAGTGGGTGGCGGG - Exonic
1122312226 14:100804486-100804508 AGGGCTCCACTGTGGGTGGATGG - Intergenic
1125246462 15:37646888-37646910 ACGTCCCAACAGTGGCTAGAAGG + Intergenic
1127388556 15:58486952-58486974 ACGGGCCCACAGTGGGTGTGAGG + Intronic
1131252563 15:90839947-90839969 ACGTCCCTGCAGTGGGGGGAGGG - Intergenic
1132656158 16:1042839-1042861 ACGGTGCCACAGTGGGAGGAAGG + Intergenic
1133141404 16:3747349-3747371 AGGCCCCTAGAGTGGGTGGTTGG - Intronic
1134683675 16:16144028-16144050 AGGTCCCCACAGTGGGAGAAGGG + Intergenic
1138180510 16:54937615-54937637 AAGGCCCCACGGTGGGTGGGGGG - Intergenic
1138353236 16:56357846-56357868 GTTCCCCCACAGTGGGAGGATGG + Intergenic
1141505890 16:84478304-84478326 ACGCTCAGACAGTGTGTGGAGGG - Exonic
1142756117 17:2017406-2017428 TCGCCCTCACAGGGGGTGGGTGG - Intronic
1145199102 17:20924505-20924527 AAGCCCCCAGAGTGGAGGGAGGG - Intergenic
1145271719 17:21408388-21408410 AGGGCCCCACAGGAGGTGGAAGG - Intronic
1145987596 17:29057632-29057654 ACCACCCCAGGGTGGGTGGAGGG + Intergenic
1148748747 17:49932504-49932526 CGTCCCCCACGGTGGGTGGAGGG - Intergenic
1149275323 17:55027263-55027285 AAGCTACCAGAGTGGGTGGAGGG - Intronic
1149572379 17:57682324-57682346 ACCCCTTCACAGTGGGTGGGGGG - Exonic
1149655559 17:58308098-58308120 ACACCCCCACAGTGGGAGGGAGG + Intronic
1151656776 17:75499835-75499857 ACTCCCCCACAGAGGGAGGGAGG - Exonic
1152749932 17:82057973-82057995 AGGCCCCCAGAGTGGGCCGAAGG + Exonic
1153205582 18:2696313-2696335 CCGGCCCCACAGTGAGTGGTGGG + Intronic
1157494023 18:48142592-48142614 AGGCACCCACTGTGGGAGGAGGG + Intronic
1160778355 19:866893-866915 GCGGGCCCGCAGTGGGTGGACGG - Intergenic
1160778370 19:866944-866966 GCGGGCCCGCAGTGGGTGGACGG - Intergenic
1162659794 19:12160005-12160027 ACCCGCCCACAGTGGGTGTCAGG + Intergenic
1163410708 19:17152442-17152464 CGGCCCCCACAGTGGTTGGTTGG - Intronic
1163916475 19:20244948-20244970 ACCCCCCCACAGTGGTTGAGAGG + Intergenic
1164448275 19:28336408-28336430 AAGGCCCCACAGGGGATGGATGG - Intergenic
1166099827 19:40565406-40565428 ACGTCCCTGCAGTGGGTGGCAGG - Exonic
1166253072 19:41584766-41584788 ATGCCCTCTCACTGGGTGGATGG - Intronic
1168203999 19:54836068-54836090 ACACTCCCCCAGTGGGTGGTCGG + Intronic
925309819 2:2874644-2874666 ACAGTCCCACAGTGGGTGCAAGG + Intergenic
926224041 2:10954886-10954908 ACGCTGCCACACTGGGTGGCAGG - Intergenic
929215007 2:39403419-39403441 ACACTGCCACTGTGGGTGGATGG - Intronic
931198703 2:60076797-60076819 AATCCCCCACATTGGGGGGATGG - Intergenic
934056370 2:88254459-88254481 AAGCCTCCACAGTGGGCAGAGGG + Intergenic
939961389 2:148568985-148569007 ACCCCCCCAGAGGGAGTGGAGGG + Intergenic
947517790 2:230822486-230822508 CCGTCCCCACTGTGGCTGGAAGG + Intergenic
947870705 2:233436322-233436344 ATGCCCCACCAGTGGTTGGAAGG + Exonic
1172083299 20:32358892-32358914 ACCCCCCCACTGGGGGGGGAGGG + Intronic
1172102414 20:32493191-32493213 ACACCCCCACAGCCTGTGGAGGG - Intronic
1172822924 20:37754439-37754461 CTGACTCCACAGTGGGTGGATGG + Intronic
1175958525 20:62623454-62623476 ACCCCCTCTCTGTGGGTGGAGGG - Intergenic
1175968507 20:62672056-62672078 ACGGCCCTGCAGTGGGTGGGAGG + Exonic
1176111008 20:63410729-63410751 ACCCCACCACAGAGGGAGGAGGG + Intronic
1178819499 21:35962382-35962404 ACCCACCCACAGAAGGTGGAGGG - Intronic
1179808686 21:43856242-43856264 ACGCCCCCACAGGGGCTGGAAGG + Intergenic
1180801139 22:18632490-18632512 AGGGCTCCACAGAGGGTGGAAGG + Intergenic
1180801207 22:18632784-18632806 GAGACCCCACAGTGGGTGGATGG + Intergenic
1180852369 22:19028049-19028071 AGGGCTCCACAGAGGGTGGAAGG + Intergenic
1180852436 22:19028343-19028365 GAGACCCCACAGTGGGTGGATGG + Intergenic
1181220514 22:21362477-21362499 GAGACCCCACAGTGGGTGGATGG - Intergenic
1181220581 22:21362771-21362793 AGGGCTCCACAGAGGGTGGAAGG - Intergenic
1183227031 22:36557481-36557503 ATGCCACCACAGGGGGAGGAGGG - Intergenic
949980848 3:9500892-9500914 ACGCCCCCACAGTGGGTGGAGGG + Exonic
953417394 3:42730834-42730856 AGGCCCCCACAGGGCTTGGATGG - Intronic
953744933 3:45567031-45567053 ACGCTCCCACAGTGGAAGGTTGG + Intronic
961298254 3:125904170-125904192 AGGATCCCACAGTGGGTGGTGGG - Intergenic
961455050 3:127019862-127019884 ACCACCTCACAGCGGGTGGAAGG + Intronic
969549086 4:7852456-7852478 ACTACCCCACAGTGGGAGTAAGG + Intronic
972343391 4:38172287-38172309 AGGTTCCCAGAGTGGGTGGAGGG - Intergenic
972467065 4:39367191-39367213 AAGACCCAACAGGGGGTGGATGG - Intergenic
973228478 4:47814223-47814245 ATGCCCCCACAGTGTTTAGAGGG - Intronic
974582037 4:63815252-63815274 AGGCACCGAGAGTGGGTGGAAGG - Intergenic
976493154 4:85694652-85694674 ACACACACACAGAGGGTGGAGGG - Intronic
981135798 4:141209740-141209762 ACCCCCCCATTTTGGGTGGATGG - Intronic
987525575 5:19045307-19045329 AAGCCACCAGAGTGGGTGGTTGG - Intergenic
994986803 5:106944275-106944297 AAGCTCCCACTGTAGGTGGAGGG + Intergenic
995218379 5:109620847-109620869 TCACCCACACAGTGGGTTGAAGG + Intergenic
1001053084 5:168428232-168428254 TGGCCCCCACAGTGTGTGGGAGG + Intronic
1001308986 5:170597181-170597203 AGGCCCGCACGGTGGGTGGCTGG + Intronic
1002085800 5:176774682-176774704 AGGCCCCCACAGTGGCTTTAGGG + Intergenic
1002935766 6:1671032-1671054 AGGCCCCCACAGTCGCTGCAAGG - Intronic
1005926615 6:30450596-30450618 AAGGCCCCACAGTGTGAGGAAGG - Intergenic
1006084933 6:31588899-31588921 TTGACCCCAGAGTGGGTGGAAGG - Exonic
1006303116 6:33204519-33204541 ACGCCCCCTCGGTGGGAGGTCGG + Intergenic
1006687998 6:35853784-35853806 ACTTTCCCACAGTGGGAGGAAGG + Intronic
1012472889 6:99590785-99590807 AAGCTCGCACAGTGGGAGGAAGG - Intergenic
1013374775 6:109503889-109503911 ATGTCCCCAAAGTGGGGGGAGGG - Intronic
1017540395 6:155396508-155396530 TCGCCCCCTGAGTGTGTGGATGG + Intronic
1018478408 6:164166529-164166551 AAGCCCCAACACCGGGTGGAGGG - Intergenic
1018726361 6:166616052-166616074 ACCCACACACAGTGGGTGGCAGG - Intronic
1019122000 6:169811273-169811295 ACGCCCCCAAAGCCGGTGAAAGG - Intergenic
1019671504 7:2282283-2282305 ACTCCCACACATTGTGTGGAAGG - Intronic
1019739070 7:2663893-2663915 ACCCCACCTCAGTAGGTGGAGGG + Exonic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1036808948 8:11853988-11854010 AGGCCCCGGGAGTGGGTGGATGG - Intronic
1038608931 8:29041392-29041414 AGGCCCCCACACTGGGTTGGTGG + Intronic
1039863875 8:41484044-41484066 GCTATCCCACAGTGGGTGGAGGG + Intergenic
1043930852 8:86090050-86090072 AAGCCCCTGCAGTGCGTGGACGG - Intronic
1044998528 8:97859815-97859837 AGGCCACCACACTGGGTGCAAGG - Intergenic
1058281932 9:103127049-103127071 TGGCCCACACAGTGGGAGGATGG - Intergenic
1061010361 9:127950953-127950975 ACACCCCCACAGGGGTTGGGAGG + Intronic
1061560222 9:131397272-131397294 ACGCCCACACAGTGGGCTTAGGG - Intronic
1062282932 9:135760011-135760033 ACGCCCCCACTGAGGGTCTACGG + Intronic
1062482055 9:136757092-136757114 ACGGCCCCGAAGCGGGTGGAGGG - Exonic
1189633968 X:42985373-42985395 ACGTGCCCATAGTGGGTGGATGG + Intergenic
1190814865 X:53921068-53921090 ACACCACCTCAGTGAGTGGAGGG + Intergenic
1192210614 X:69125477-69125499 TCGCCCCCACAGTCTGTGGGGGG + Intergenic
1192374747 X:70548555-70548577 ATGCCCCAACAGTGGCTGCATGG + Intronic
1196187508 X:112760400-112760422 AAGTCCCCACAGTGGGCAGAAGG - Intergenic