ID: 949982011

View in Genome Browser
Species Human (GRCh38)
Location 3:9508015-9508037
Sequence GGCTAAGCACCCTGTGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 133}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949982011_949982019 10 Left 949982011 3:9508015-9508037 CCAGGTCCACAGGGTGCTTAGCC 0: 1
1: 0
2: 2
3: 6
4: 133
Right 949982019 3:9508048-9508070 ATGACAGCAATGTAAAGTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 176
949982011_949982020 16 Left 949982011 3:9508015-9508037 CCAGGTCCACAGGGTGCTTAGCC 0: 1
1: 0
2: 2
3: 6
4: 133
Right 949982020 3:9508054-9508076 GCAATGTAAAGTGGGGGTGATGG 0: 1
1: 0
2: 3
3: 12
4: 213
949982011_949982016 7 Left 949982011 3:9508015-9508037 CCAGGTCCACAGGGTGCTTAGCC 0: 1
1: 0
2: 2
3: 6
4: 133
Right 949982016 3:9508045-9508067 TAGATGACAGCAATGTAAAGTGG 0: 1
1: 0
2: 3
3: 24
4: 245
949982011_949982018 9 Left 949982011 3:9508015-9508037 CCAGGTCCACAGGGTGCTTAGCC 0: 1
1: 0
2: 2
3: 6
4: 133
Right 949982018 3:9508047-9508069 GATGACAGCAATGTAAAGTGGGG 0: 1
1: 0
2: 2
3: 13
4: 199
949982011_949982017 8 Left 949982011 3:9508015-9508037 CCAGGTCCACAGGGTGCTTAGCC 0: 1
1: 0
2: 2
3: 6
4: 133
Right 949982017 3:9508046-9508068 AGATGACAGCAATGTAAAGTGGG 0: 1
1: 0
2: 0
3: 17
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949982011 Original CRISPR GGCTAAGCACCCTGTGGACC TGG (reversed) Intronic
900296978 1:1956822-1956844 CGCTGGGCACCCTGTGGGCCTGG - Intronic
900468461 1:2837710-2837732 GAGAAATCACCCTGTGGACCAGG + Intergenic
900649316 1:3723248-3723270 GGCTGGGCACCCTTTGAACCCGG + Intronic
900800724 1:4735475-4735497 GGCTCAGCACCCACTGCACCGGG + Intronic
900832293 1:4973811-4973833 GGGTCAGCACCCTGTGGAGCAGG - Intergenic
902301466 1:15505592-15505614 GGCCAAGCCCCCAGTGGGCCTGG + Intronic
906298530 1:44664035-44664057 GCCTCAGCACCCTGAGGAGCTGG - Intronic
906532555 1:46532092-46532114 GGCTAAGCACCCTGGGTTCTGGG - Intergenic
911585459 1:99685015-99685037 AGGTAAGCACCCTGTGGGACAGG + Intronic
911885375 1:103290989-103291011 GGCTAAGTGCCCTGTGTACTGGG - Intergenic
912241573 1:107915660-107915682 TGATGAGCACCCTGTGGACAGGG + Intronic
912515499 1:110214124-110214146 GGCAAAGCACCCTGGGTTCCTGG - Intronic
913050798 1:115115145-115115167 GGCTCAGCACCTTGTGAACGAGG + Intergenic
924706820 1:246509025-246509047 GGCTAATCACACTGTGGAGGGGG - Intergenic
1063931416 10:11032124-11032146 GGCTAAGCCCTATGTGGAGCTGG - Intronic
1064014752 10:11763274-11763296 TGCTAAGCAGCCCGTGGAGCAGG - Exonic
1065054913 10:21834681-21834703 GGCTTAGGACCCTCTGAACCAGG - Intronic
1071289296 10:84177013-84177035 GCCTGTGAACCCTGTGGACCTGG + Intronic
1074134281 10:110613457-110613479 GCCTAAGCACCCAGTGAAGCGGG + Intergenic
1076742468 10:132493545-132493567 GGGTAAGCACCCTGGAGCCCCGG - Intergenic
1077375018 11:2201696-2201718 GGCTAAGCCCCAGGTGGGCCAGG - Intergenic
1077524818 11:3057681-3057703 CGCTAAGCGCCGTGGGGACCAGG + Intergenic
1080637964 11:34140128-34140150 GGAAAAGCTCCCTGTGGCCCAGG - Intronic
1081383238 11:42441808-42441830 GCCTCAGCCCCCTGAGGACCTGG - Intergenic
1081716318 11:45252843-45252865 GGCTGACCACCCTGGGCACCAGG + Intronic
1083254778 11:61489407-61489429 GTCTTTGCACCCTCTGGACCTGG + Intronic
1083792014 11:64991898-64991920 GGAGCAGCACCCTGTAGACCAGG - Intronic
1084216363 11:67648890-67648912 GGCTGAGCCCCCAGTGGGCCGGG + Intronic
1088456388 11:110036860-110036882 CTCTAAGCCCCCTGTGGCCCAGG - Intergenic
1089202991 11:116736076-116736098 GGCTCAGCCCCCTGTGTAGCTGG - Intergenic
1090482166 11:127078400-127078422 GGCAGAGCTCCCTGTGGACTGGG + Intergenic
1095563051 12:43588244-43588266 GGCCAAGCAACCTTTGGACTTGG + Intergenic
1098107377 12:67083461-67083483 GGATTAACACCCTGTGGTCCTGG - Intergenic
1101539694 12:105653744-105653766 GGCAAAGCCCCATGTGGAGCTGG + Intergenic
1102617073 12:114163986-114164008 GACTCATCACCCTGTTGACCAGG - Intergenic
1104172633 12:126297053-126297075 GGGAAAGCACTTTGTGGACCTGG + Intergenic
1104975349 12:132549663-132549685 GGCAAAGCCACCTGTGGCCCCGG + Intronic
1107579852 13:41771691-41771713 GCCTAAGCACCCTGAGTAGCTGG + Intronic
1108506734 13:51119029-51119051 GCCTGAGCACACTGTAGACCTGG - Intergenic
1119711850 14:76828163-76828185 GGCTTGGCACCTTGAGGACCTGG + Intronic
1122122269 14:99560931-99560953 GGCAAGGCTCCCTGTGGGCCTGG - Intronic
1122400520 14:101464779-101464801 GGCTCAGCACCCTGGGGCTCTGG - Intergenic
1123215964 14:106809708-106809730 GGCTATGGCTCCTGTGGACCTGG - Intergenic
1126805094 15:52340160-52340182 GGTTAAGAAGCATGTGGACCCGG + Intronic
1127872360 15:63083895-63083917 CGCTAAGAACGCTGTGGTCCCGG - Intergenic
1134353066 16:13455997-13456019 GGCTAAGGACTCTCAGGACCTGG + Intergenic
1135903098 16:26484661-26484683 GGCTAAGCAAACTGTGGAATAGG + Intergenic
1137436241 16:48456085-48456107 GGTTAAGCCCCCTGTGGACCAGG + Intergenic
1137560688 16:49500240-49500262 GGCTAAGCCCCTTGGGGACAGGG + Intronic
1138226820 16:55302945-55302967 GGCAAAGCACCCAGTGCCCCTGG - Intergenic
1138458032 16:57132496-57132518 GGCTCAGTTCCCTGTGGCCCTGG - Intronic
1139558647 16:67728250-67728272 GGCTAAGGAGGCTGTGGACCAGG + Intronic
1143737948 17:8927055-8927077 GGCTAGGGACCCTGGGGACAAGG + Intronic
1145911986 17:28548303-28548325 GCCTCAGCATCCTGTGGCCCGGG - Intronic
1146126991 17:30237925-30237947 GAGTGGGCACCCTGTGGACCTGG + Intergenic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150625162 17:66836640-66836662 TGTTAGGCACCCTGGGGACCTGG - Intronic
1151732451 17:75919562-75919584 GGCTCAGCAGCCTTTGGACAGGG - Intronic
1155332382 18:24731341-24731363 GGCTGGGCACACTGTGGACAGGG + Intergenic
1155918216 18:31576983-31577005 GGCTAAGCTGACTGGGGACCAGG - Intergenic
1158362524 18:56690996-56691018 GGGTAACCTCCCTGTGGACAGGG - Intronic
1160143979 18:76349104-76349126 TGCCAAGCACCGTGTGGCCCCGG + Intergenic
1160231722 18:77054058-77054080 GGCCAAGCACCCTGCAGACCAGG - Intronic
1160392190 18:78542434-78542456 GACTTAGCACACTGTGAACCAGG + Intergenic
1160835360 19:1122319-1122341 GGCTCAGCAGGCTCTGGACCTGG + Intronic
1163655175 19:18541754-18541776 GGCTGAGCAGCCTGGGGCCCTGG - Exonic
1168252484 19:55148431-55148453 GGCTAGGCACCCTGTGGCCTAGG - Intronic
925582025 2:5420557-5420579 TGCTAAGAACCCTGAGAACCAGG - Intergenic
926496716 2:13598013-13598035 GGCTAACCACTCTCTGGGCCTGG - Intergenic
926728697 2:16018307-16018329 GCCTCAGCACCCTGAGGAGCTGG + Intergenic
927054399 2:19356067-19356089 GGCCAAGCACCCAGAGGAGCAGG - Intronic
929301194 2:40305251-40305273 GGCTATGAACCCTGGGGAGCAGG - Intronic
938808792 2:134832228-134832250 GGCTCAGAGCCCTGTGGGCCAGG + Intergenic
948167323 2:235873078-235873100 GCATAAGCACCCTGGGGACAGGG - Intronic
948241839 2:236444518-236444540 AGCCAGGCACCCTGGGGACCTGG + Intronic
948510293 2:238459409-238459431 GGCAAAGAGCCCTGCGGACCAGG + Intergenic
1172938895 20:38641142-38641164 GGCTGAGCACCCTGGGCGCCAGG - Intronic
1174066113 20:47867308-47867330 GGCTCAGGGCCCTGTCGACCGGG - Intergenic
1174157941 20:48528713-48528735 GGCTCAGGGCCCTGTTGACCAGG + Intergenic
1179717208 21:43295519-43295541 TGCTCAGGACTCTGTGGACCTGG + Intergenic
1180911493 22:19454005-19454027 GGCTGAGCATCCTGTAGACATGG - Intronic
1181937375 22:26448544-26448566 GGCCAAGCACCCTGAGGAAAGGG - Intronic
1184342658 22:43894459-43894481 GGCAAAGGACCGGGTGGACCAGG - Intergenic
1184893419 22:47393245-47393267 TGCTCATCACCCTGTGCACCAGG + Intergenic
949982011 3:9508015-9508037 GGCTAAGCACCCTGTGGACCTGG - Intronic
954761586 3:52878469-52878491 GTCTAGGAACCCTGTGGTCCCGG + Intronic
954913586 3:54130173-54130195 GGCTAAGCCTCCTGTGGGACAGG + Intronic
959947126 3:112137029-112137051 GGCTAAGCACCCTGTCCATGTGG - Intergenic
962310880 3:134326092-134326114 AGCTAAGCAGCCTGTGGCTCAGG - Intergenic
964219815 3:154330482-154330504 GGCTATGCATTCTGTGGCCCAGG - Intergenic
969196093 4:5565195-5565217 AGCTAAGCTGCCTGTGGGCCAGG - Intronic
973076166 4:45928940-45928962 GACTATAAACCCTGTGGACCTGG - Intergenic
986124224 5:4870216-4870238 GCCAAAGCTCCCTGTGGGCCAGG + Intergenic
988539763 5:32098360-32098382 GAGAAAACACCCTGTGGACCTGG - Exonic
988907185 5:35801816-35801838 CTCTAAGCACCCTGTGGACCAGG + Intronic
996310580 5:122099479-122099501 AGGTAAGCAGCCTTTGGACCAGG + Intergenic
996386157 5:122912863-122912885 GGCAGAGGACCCTGTGGCCCTGG + Intronic
996625738 5:125568317-125568339 GGCTCAGGACCCTCTGAACCAGG - Intergenic
1002618496 5:180469889-180469911 GGCTTTGCACACTGTAGACCAGG + Intergenic
1006027539 6:31157190-31157212 AGCTAAGCATCGGGTGGACCTGG - Intronic
1007695996 6:43734516-43734538 GGCTCAGCACTCTATGGCCCTGG - Intergenic
1011503137 6:88012757-88012779 GGATAAGTACCCTATGGGCCAGG + Intergenic
1013628154 6:111958022-111958044 GGCTGAGCTCCCTGTGGTGCTGG + Intergenic
1015137637 6:129891604-129891626 GGCGAAGGAGCCTGTGGTCCTGG - Intergenic
1015605001 6:134945314-134945336 GGCAGAGCAACCTGTGGTCCTGG - Intronic
1017017269 6:150111596-150111618 GGCTAAGCACCCTGAGCACTGGG + Intergenic
1017622156 6:156310094-156310116 AGCTAAGCCCCCCGTGGAGCAGG + Intergenic
1018034135 6:159867063-159867085 GTGTAAGCGCCCTGAGGACCAGG + Intergenic
1022828134 7:34037570-34037592 GGCCAGGCACCCTCTGGCCCAGG - Intronic
1029342136 7:99953883-99953905 ACCTAATCACCCTGTGGCCCTGG + Intergenic
1035015557 7:155762767-155762789 AGCTAAGCACCCTGTGGGGAGGG + Intronic
1035397338 7:158543871-158543893 GGCTAAGCTGCCTCTGCACCAGG + Intronic
1039823204 8:41151962-41151984 GGCTAAGCACACTGGGAACATGG + Intergenic
1045472228 8:102522707-102522729 TGCTCAGCACTCTGTGAACCCGG + Intergenic
1049410909 8:142473619-142473641 GGCTAAGCACGCTATGGAGGAGG + Intronic
1049603312 8:143518051-143518073 GGCTGGGGGCCCTGTGGACCAGG - Intronic
1055216677 9:73872130-73872152 GGCCAAGCCCCTTGGGGACCTGG + Intergenic
1057252991 9:93519036-93519058 TGCTAAGCACACTCTGGATCAGG - Intronic
1060530793 9:124346151-124346173 GGTTCAGCACCCTCGGGACCAGG - Intronic
1060757774 9:126225537-126225559 GGCTGGTCACCCTGTGGACAAGG - Intergenic
1061958780 9:133977496-133977518 GTCTAGGCACCTTGTGCACCGGG + Intronic
1061975041 9:134063778-134063800 TGCAAAGCACCCAGTGGACTCGG - Intronic
1062167078 9:135113252-135113274 GGCCAAGCCCCCTGTGGTCTCGG + Intronic
1062628251 9:137452642-137452664 GCCACAGCACCCTGGGGACCTGG + Intronic
1186892692 X:13975039-13975061 ATGTAAGCACCCTGTGGACCGGG + Intergenic
1187828427 X:23356339-23356361 GTGTAAACACCCTGGGGACCAGG + Intronic
1189709689 X:43796472-43796494 GGCTATGCACACAGTTGACCTGG + Intronic
1194179472 X:90694968-90694990 GGCTGAACACCCTGAGGACTAGG + Intergenic
1200526136 Y:4277141-4277163 GGCTGAACACCCTGAGGACTAGG + Intergenic
1202114479 Y:21457590-21457612 GACTAAGCCCCATTTGGACCAGG - Intergenic