ID: 949985025

View in Genome Browser
Species Human (GRCh38)
Location 3:9533805-9533827
Sequence CCTTTGGAGGAGTGACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949985019_949985025 28 Left 949985019 3:9533754-9533776 CCTGGGCAACAGAGCAAGACTCT 0: 6551
1: 32159
2: 84434
3: 153956
4: 178272
Right 949985025 3:9533805-9533827 CCTTTGGAGGAGTGACTGGAAGG 0: 1
1: 0
2: 2
3: 12
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949985025 Original CRISPR CCTTTGGAGGAGTGACTGGA AGG Intronic
901062230 1:6477039-6477061 CCTATGGAGGAGTGGCTCGCAGG - Intronic
901249726 1:7768077-7768099 TCTTTGTTGGAGTGAGTGGATGG - Exonic
901402176 1:9022179-9022201 AGCTTGCAGGAGTGACTGGAAGG - Intronic
901508757 1:9703501-9703523 GGTTTGGGGGAGTGACTAGAAGG - Intronic
902550183 1:17214726-17214748 CCTTGGGAGGTGTGACAGGCAGG - Intronic
903005543 1:20295734-20295756 CCATTGAGGGAGTGGCTGGAGGG + Intronic
903133440 1:21293787-21293809 CCATTGGGGTAGTGAATGGAAGG - Intronic
903500534 1:23797920-23797942 CCTGTGGAGGAGTAACAGGGTGG - Intronic
904470351 1:30732115-30732137 CCATGGGAGGAGTTTCTGGATGG + Intergenic
907601585 1:55776460-55776482 TCTTAGGAGGAGTGATAGGAAGG + Intergenic
908959718 1:69681763-69681785 GGTTTGGAGGAGTGAGTGGGAGG - Intronic
909895020 1:81057998-81058020 CATCTGGAGGAGTGAATGGAAGG - Intergenic
911014596 1:93318731-93318753 TCTTGGCAGGAGTGACTGGAAGG + Intergenic
911395664 1:97305254-97305276 CATATGGAGGAGTGTCTGGTAGG - Exonic
916051007 1:161037161-161037183 CCTTTGGGTGAGGGAATGGATGG - Intronic
919442168 1:197649342-197649364 CTTTTGTAGAAATGACTGGAAGG + Intronic
920702303 1:208226831-208226853 CCTTTGGGGGAGGGTCAGGAAGG + Intronic
921088571 1:211820039-211820061 CCTTTGCAGCTGTGATTGGAGGG - Intronic
922817514 1:228460334-228460356 CCTTTGGAGAAATGACTTGGGGG - Exonic
923992961 1:239459649-239459671 CCTTTTTTGGAGTGACAGGATGG + Intronic
1063320342 10:5046236-5046258 CCATAGGAGGAGGGAATGGAGGG - Intronic
1063505628 10:6595767-6595789 CCTTTGAAGGAGACACTGTAAGG + Intergenic
1064347543 10:14546409-14546431 CCTCTGGATCAGTAACTGGATGG + Intronic
1065883405 10:30057635-30057657 CCTTTGCTGCAGAGACTGGAAGG - Intronic
1068098462 10:52521485-52521507 CCTTAGGAGCTGTGACGGGAAGG - Intergenic
1069949962 10:72011867-72011889 CCTTGGGAGTAGTTAGTGGAGGG + Exonic
1070633966 10:78109057-78109079 GTTTTGGAGGAGTTACAGGAGGG + Intergenic
1070810292 10:79294149-79294171 CTGTTGGGGAAGTGACTGGAAGG + Intronic
1070810301 10:79294205-79294227 CCGTTGGGGAAGTGACTGGAAGG + Intronic
1072242412 10:93509000-93509022 CATTTGAAAGAATGACTGGATGG + Intronic
1072268851 10:93756035-93756057 TCTGTGGAGGAGGGAATGGAGGG - Intergenic
1073185434 10:101612743-101612765 CCTGAGGAGGAGTGGCTGGGTGG - Intronic
1073576850 10:104633220-104633242 CTTTTGGAGATGTGACTAGAGGG + Intergenic
1074786151 10:116843077-116843099 CCTTTGAACAAATGACTGGAAGG + Intergenic
1075903017 10:126058142-126058164 CCTTGGGAGGAGGGAAAGGAGGG - Intronic
1077347618 11:2071273-2071295 CCTTGGGTGGAGTGCCTTGAGGG - Intergenic
1078353156 11:10612064-10612086 CCTCTGAAGGAGTGAATGGCAGG + Intronic
1081358517 11:42144036-42144058 CCTTTGGAGGACTGTTGGGAAGG - Intergenic
1084855473 11:71982435-71982457 CCTTTTGAGGAGTGCCAGAATGG - Intronic
1084967694 11:72752906-72752928 CCTTGGGAGGTGTGGCTGGGTGG - Intronic
1085135382 11:74082681-74082703 CCTTTGGGGGAGGGACAGGGGGG - Intronic
1085313264 11:75528561-75528583 CCTTTGGAAGAGTGGCCAGAGGG - Intergenic
1085508986 11:77075838-77075860 TCTTGGGGGTAGTGACTGGAAGG - Intronic
1085519764 11:77131028-77131050 CTTGGGGAGCAGTGACTGGAGGG + Intronic
1087250023 11:95888529-95888551 TCTTTGGATGAATGAATGGATGG - Intronic
1088296747 11:108306018-108306040 CCTTTGCTGAAGTGACTGGAAGG - Intronic
1088934504 11:114385527-114385549 CCTTTGGAGGAGGTACATGATGG - Intergenic
1090288272 11:125519164-125519186 GCTAGGGAGGAGTGACTGGCTGG - Intergenic
1090874971 11:130780743-130780765 CTTGTGGAGGAGTGACCTGATGG - Intergenic
1091189136 11:133675364-133675386 TCTTGGTAGGAGTGACAGGAAGG - Intergenic
1093868442 12:24257031-24257053 CCTTTGGAAGTGTGAATAGAAGG + Intergenic
1096880044 12:54659941-54659963 CCGTTGGAGAAGAGTCTGGAGGG + Intergenic
1098339375 12:69436160-69436182 CTTTGGGATGAGTGACTGGGAGG + Intergenic
1099853691 12:88137938-88137960 CATTTTGCGGAGTTACTGGAAGG - Intronic
1102042478 12:109809491-109809513 CAGATGGAGGAGTGAGTGGATGG - Intronic
1102595927 12:113992588-113992610 CTTTTGGAGGAGAGAATTGAGGG - Intergenic
1103997827 12:124841613-124841635 GGTTGGGAGAAGTGACTGGAGGG - Intronic
1104203960 12:126618210-126618232 CCTATGGGGGAGTGACTCAAAGG - Intergenic
1104728887 12:131094363-131094385 CCTTATGAAGAGTGAATGGAAGG - Intronic
1105320883 13:19320454-19320476 ATTTTGGAGGAGTGATGGGAGGG + Intergenic
1105529917 13:21209801-21209823 TCTTGGAAGCAGTGACTGGATGG + Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1111711629 13:91822323-91822345 TCTTTGGAAGAGTGGCAGGATGG + Intronic
1111971680 13:94923560-94923582 CCTTGGCAGGGGTGACTGGAAGG - Intergenic
1112117638 13:96374527-96374549 CCATTGGAGGGATGACTTGAAGG - Intronic
1112160292 13:96860018-96860040 CCCTAGGAGGAGTGGTTGGATGG - Intergenic
1114261497 14:21039997-21040019 CCTTTGGAGTGGAGGCTGGATGG - Intronic
1114815563 14:25954074-25954096 GCTTTGGAGGAGCGAGGGGAGGG - Intergenic
1114834459 14:26186994-26187016 CATTTCCAGGAGTAACTGGAGGG + Intergenic
1115068616 14:29295280-29295302 CCTTTGGGGGACTGATGGGAAGG + Intergenic
1115463747 14:33690522-33690544 CCTTGTCAGGAGCGACTGGATGG - Intronic
1116661278 14:47713449-47713471 GCTTTAGAGGAGTGGCTAGAGGG + Intergenic
1117438204 14:55737600-55737622 CCTTTGGAGAAGAGCCTGGGTGG - Intergenic
1117980077 14:61334170-61334192 CCTATGAATGACTGACTGGATGG - Intronic
1118724679 14:68620658-68620680 CCTAAGTAGGAGTGACTGAAAGG + Intronic
1121871364 14:97410937-97410959 CCTTTGCAGGAATGGGTGGATGG + Intergenic
1122299584 14:100724258-100724280 CTGTTGGAGGAATGGCTGGAAGG + Intergenic
1122915191 14:104855181-104855203 GGTTTGGAGGGGTGAATGGAGGG + Intergenic
1122915257 14:104855391-104855413 GGTTTGGAGGGGTGAATGGAGGG + Intergenic
1124132265 15:27001375-27001397 CAGTTGGAGGACTGGCTGGACGG - Intronic
1124132829 15:27004924-27004946 CAGTTGGAGGACTGGCTGGATGG + Intronic
1127305029 15:57697066-57697088 AGTTTGGGGGACTGACTGGAAGG + Intronic
1127759613 15:62125675-62125697 CCTTAAAAGAAGTGACTGGAAGG - Intergenic
1129109199 15:73327910-73327932 CCTTTGGTGGGGTGACTGACAGG - Intronic
1129755335 15:78094637-78094659 CCTTTGGAGGAATGCCTGGAAGG + Intronic
1129795406 15:78372707-78372729 CTTGTGGAGAAGGGACTGGATGG + Intergenic
1131176121 15:90210836-90210858 TCTGTGGAGGAGTGAGTGGAAGG + Intronic
1131645568 15:94338564-94338586 CTTTGGGCGGAGTGACTGGAGGG + Intronic
1132663181 16:1070554-1070576 CCTTTGGAGGAGCGGAGGGAGGG + Intergenic
1133006320 16:2883553-2883575 GCTTTGGACAAGGGACTGGAGGG - Intronic
1134490759 16:14693938-14693960 CCCTGGGAGGAGTGAGTGGGGGG + Intronic
1134496140 16:14733056-14733078 CCCTGGGAGGAGTGAGTGGGGGG + Intronic
1136154664 16:28374774-28374796 CCCTGGGAGGAGTGAGTGGGGGG - Intergenic
1136264516 16:29107160-29107182 CCCTGGGAGGAGTGAGTGGGGGG + Intergenic
1136404546 16:30036587-30036609 CCATTGGTGGAGTGGCTAGAAGG + Intronic
1137713488 16:50583410-50583432 CCTTGGTAGGGGTGGCTGGAAGG - Intronic
1138256876 16:55572710-55572732 CCTTTGGAGGATGAAGTGGAAGG + Intronic
1138908207 16:61363874-61363896 CCTGTGGAGGAGTTCCCGGATGG - Intergenic
1140232473 16:73129024-73129046 CCTTTGGAAGAGTGTGGGGAAGG - Intronic
1140520862 16:75580291-75580313 CATTTGGAGCAGGGACTGGTGGG + Intergenic
1141621514 16:85238831-85238853 CTGTTGGAGGAAGGACTGGAAGG - Intergenic
1141732053 16:85829471-85829493 CCTTTGGAGGACTCCCGGGAGGG + Intergenic
1142432678 16:90038710-90038732 CCTTTGCAGAAGTGACTGGGTGG + Intronic
1144774646 17:17779206-17779228 CCTCTGGAGCAGTGGCTGGCTGG + Intronic
1147167598 17:38601804-38601826 GCTTTCGAGGACTGTCTGGAAGG - Intronic
1148676714 17:49449859-49449881 CCTTTGAAGAAGTTTCTGGAAGG - Intronic
1150613754 17:66753371-66753393 CCAGTGGAGGAGTCAGTGGATGG + Intronic
1151803063 17:76388990-76389012 CCTGTGGAGGAGTGCCAGGCAGG + Intergenic
1153246011 18:3073321-3073343 CCTTTGAATGAATGACAGGAAGG - Intronic
1153558884 18:6349818-6349840 CTTTGGGAGCAGTCACTGGAAGG + Intronic
1155040382 18:22060396-22060418 CCTTTGTGGTAGTGAATGGATGG - Intergenic
1155746448 18:29361307-29361329 CCCTTAGAGGAGGGACTGGCGGG + Intergenic
1156366906 18:36438015-36438037 CCTCTGGAGGAGTGTGTGGGAGG - Intronic
1157077366 18:44480129-44480151 ACTTTGGAGGAGTGTTGGGAAGG + Intergenic
1157692030 18:49691581-49691603 CTTTTGGAGGGTTGGCTGGAGGG + Intergenic
1160993487 19:1871326-1871348 CCGTAGCAGGAGGGACTGGACGG + Intergenic
1161586255 19:5107416-5107438 GCTGTGCAGGAGTGACTGGAGGG - Intronic
1164048429 19:21563002-21563024 ACTTTGGAGTAGAGAGTGGAAGG + Intergenic
1164899852 19:31909208-31909230 TCCTCGGAGGAGTGACTAGAGGG - Intergenic
1165177273 19:33939417-33939439 CCTTTGGAGGACTGGTTTGAAGG - Intergenic
1167445537 19:49535028-49535050 CCTGTGGAGGACAGACTGGACGG - Intronic
925026408 2:610615-610637 ACTCTGGAGGAGTCACTGGCTGG - Intergenic
926046276 2:9711828-9711850 CCCATGCAGGAGTGACTGGGAGG + Intergenic
926358044 2:12059336-12059358 CTTACGGAGGAGAGACTGGATGG + Intergenic
926861404 2:17313608-17313630 CGTTTGGAGGAGGGGGTGGATGG + Intergenic
928424431 2:31166499-31166521 CATTTGGAGGAGCTACAGGAGGG + Intergenic
930149213 2:48041255-48041277 CTGTTGGAGGGGTGAGTGGAGGG - Intergenic
930775423 2:55165723-55165745 TCTGTGGATGAGTCACTGGATGG - Intergenic
932194132 2:69768364-69768386 CCTGTGGAGGAGTGAGCGCAGGG + Intronic
933596841 2:84290967-84290989 TCATTGGAGGTGTCACTGGATGG + Intergenic
937909257 2:127067593-127067615 ACTCTGGAGGAGTTACTGGGAGG - Intronic
937935386 2:127239711-127239733 ACTTTGGAGGACTGTTTGGAAGG + Intergenic
942135929 2:172925408-172925430 CCTTTGTAGGAATAAATGGATGG + Intronic
942761034 2:179398437-179398459 CCTTTGGAAGGGCGCCTGGAAGG + Intergenic
943706334 2:191038823-191038845 CCTTTGTAGAAGAGACTGCATGG + Intronic
944939199 2:204604957-204604979 CCTTGGTAGGGATGACTGGAAGG + Intronic
945096421 2:206223648-206223670 CCTTTGAATGAGTGAGTGGCAGG - Intergenic
946456520 2:219830973-219830995 AATTAGGAGGAGTGACAGGAAGG - Intergenic
946490778 2:220146916-220146938 CCTTTAGGGCAGTGACTGGGTGG - Intergenic
948037724 2:234872840-234872862 CCTGAGGAGGTGTGGCTGGAAGG + Intergenic
948526331 2:238573196-238573218 CCTGTGGAGGAGTGACAGAGGGG + Intergenic
1169267056 20:4173041-4173063 CCTTTGACGGATTGATTGGAGGG + Intronic
1173992485 20:47314092-47314114 CCTTGGGAGGGGTGCCTGCAGGG + Intronic
1174120244 20:48259636-48259658 CCTTTGGGGCAGAGACTGGGAGG - Intergenic
1174970195 20:55266709-55266731 CTTGTGGAGGACTGACTGGGGGG - Intergenic
1175291774 20:57880775-57880797 GCTTTGGAGGTTTGAATGGAGGG + Intergenic
1175442460 20:59001406-59001428 CCTGTGGAAGAGGGAGTGGAGGG + Intronic
1175743136 20:61434832-61434854 CCCAGGGAGGAATGACTGGACGG - Intronic
1178509003 21:33186580-33186602 CCTTTGGGGGACACACTGGAAGG - Intergenic
1179637354 21:42721759-42721781 TCTTTGGAGGAAGGGCTGGAAGG - Intronic
1180928329 22:19571441-19571463 CCCTTGGAGGAGGGACAGGGAGG + Intergenic
1181616492 22:24058494-24058516 CCTTGGGAGGAGTGCCTGCCAGG + Intronic
1181932699 22:26415554-26415576 CATTTGGAGGATTGGCTGAATGG - Intergenic
1183310649 22:37107766-37107788 CCTTTGGAGGAGGTAAAGGAGGG - Intronic
1183855590 22:40631820-40631842 CCTTTGGAGGAATGAAGGAATGG - Intronic
949722448 3:7006089-7006111 CATTTGGAGGAGAGCCAGGAGGG - Intronic
949740760 3:7230966-7230988 CCTGTGAAGAAGTGGCTGGATGG - Intronic
949985025 3:9533805-9533827 CCTTTGGAGGAGTGACTGGAAGG + Intronic
951804905 3:26633215-26633237 CCTTTGGATGAATGGGTGGATGG - Intronic
953040732 3:39252902-39252924 CCTGGGGAGGAGTGGCTGGGAGG + Intergenic
960720704 3:120622393-120622415 CCCCTGGAGGAGGGACTGGCAGG + Intergenic
962391711 3:134977900-134977922 CCTGTGAAGGAGAGAATGGAAGG + Intronic
962851698 3:139312957-139312979 CCTTTGGAGCTGGGTCTGGAAGG + Intronic
967125092 3:186416062-186416084 TCTATGGAGGATGGACTGGAAGG - Intergenic
967663536 3:192143920-192143942 CCTTGGGTGGATTTACTGGAAGG + Exonic
969022191 4:4146139-4146161 CCCTGGGAGGACTCACTGGAAGG - Intergenic
970202781 4:13626938-13626960 CCTTTGGAGAAATGACTAAATGG - Intronic
971755635 4:30704470-30704492 CCTTGGAAGGAATGACTGAAAGG + Intergenic
974960324 4:68691651-68691673 ACTTTGGAGGACTGTCTGTAAGG - Intergenic
975392810 4:73838910-73838932 GCTGTGAAGGAGTAACTGGAAGG - Intronic
976821605 4:89213260-89213282 CCTTTGGAGGAAAGCCTTGAGGG + Intergenic
978730760 4:112023997-112024019 GATTAGGAGGAATGACTGGAGGG + Intergenic
978789027 4:112641409-112641431 CCTTTGGAGGAGTTTGTGTAAGG + Intronic
979949207 4:126871382-126871404 TCATTGGAGGAGTGTCTGCATGG + Intergenic
980839591 4:138241695-138241717 GTTTTTGAGGAGTGAATGGATGG - Intronic
984933855 4:184872633-184872655 TCTTTGGAGGAGTCCATGGAGGG - Intergenic
985693553 5:1326969-1326991 CCTGTGGAGGAGGAGCTGGATGG - Intronic
986019489 5:3787872-3787894 CCTTTGGATTAGTGACTTCAAGG + Intergenic
986582950 5:9284217-9284239 CCTGTGGAGGAATGATTGGCAGG - Intronic
986583087 5:9285655-9285677 CCTGTGGAGGAATGATTGGCAGG - Intronic
987115209 5:14721025-14721047 CCTTTGGAGCAGTGGGTGGGGGG + Intronic
988026101 5:25692418-25692440 CCTCTGCAGGAATGACTAGAGGG - Intergenic
988319160 5:29670095-29670117 CTTTTGGAGCTGTGAGTGGAGGG + Intergenic
989549695 5:42719513-42719535 TTTTTGGGGGAGTGACAGGATGG + Exonic
991123066 5:63038634-63038656 CTTTTGGAGATGTAACTGGAGGG + Intergenic
991507237 5:67337997-67338019 CCTTGAGAGGACTGAGTGGAGGG + Intergenic
991949534 5:71933940-71933962 CCCTTGGAGGATGGACTGAAAGG + Intergenic
992112460 5:73508947-73508969 TCATTGGAGGTGTCACTGGATGG + Intergenic
996978444 5:129461296-129461318 CCTTTGGAGGAGCCCGTGGAGGG + Exonic
999503812 5:152174556-152174578 ACTTTGGAGGATGGACAGGAGGG - Intergenic
1000441205 5:161265622-161265644 TCTGTGGAGAAGTGACTGGCAGG + Intergenic
1001307965 5:170589632-170589654 CCCTTGGAGGAGGCACTGTAAGG + Intronic
1001634699 5:173201495-173201517 CCTTGGGTCTAGTGACTGGAAGG + Intergenic
1003402088 6:5799092-5799114 ACTTGGAAGCAGTGACTGGATGG - Intergenic
1003421592 6:5963336-5963358 CCTTTAGGGGAGTCTCTGGATGG - Intergenic
1003843986 6:10153708-10153730 CCTGTGTAGGAGTTACTTGATGG - Intronic
1006173573 6:32108992-32109014 CCTGTGAAGGAGTGTCTGGGAGG - Intronic
1007416977 6:41696924-41696946 CCCTTGGGGGAGTGTCTGGGAGG + Intronic
1007552206 6:42738700-42738722 CCTTTGGAGGCTGGAGTGGAAGG + Intergenic
1013719699 6:113009667-113009689 CCTTTTGGGGAGTATCTGGAAGG - Intergenic
1014107635 6:117584748-117584770 CCTGGTGAGAAGTGACTGGATGG + Intronic
1014248579 6:119093609-119093631 CAGTTAGAGGAGTCACTGGAGGG + Intronic
1015874351 6:137808021-137808043 GCTCTGGAGGAGCAACTGGATGG - Intergenic
1015888167 6:137942294-137942316 CCATTGGAGGAGGAACTGCAAGG - Intergenic
1016369454 6:143357124-143357146 CCCTTGGTGGAGAGACTGGGAGG - Intergenic
1017482642 6:154872787-154872809 CATTTGCAGGGGTTACTGGAAGG + Intronic
1018983669 6:168618872-168618894 TCTGTGGAGTAGTGACTGAAGGG - Intronic
1021150711 7:17147702-17147724 ACTTTGGAGGAGGTGCTGGAAGG - Intergenic
1022476381 7:30713317-30713339 TCATTGGAGGAGTCAATGGATGG + Intronic
1024293702 7:47826252-47826274 CCTTTGGAGGTGTGTGTGGTGGG + Intronic
1027578932 7:79968310-79968332 CATTTGAAGGATTGACTGGCAGG - Intergenic
1029173976 7:98650974-98650996 CCTATGGAGGAGTGAGAGGAAGG + Intergenic
1030469855 7:109950274-109950296 TCTTTGTAGGGGAGACTGGAGGG + Intergenic
1030549825 7:110944588-110944610 CCTTTAGAGAAGGAACTGGAGGG - Intronic
1031365434 7:120895405-120895427 CCTCTGGACCAGTGATTGGAGGG - Intergenic
1032052871 7:128659912-128659934 CCTTGGGTGGAATGACAGGAGGG + Intergenic
1032885036 7:136128375-136128397 CCTTTGAAGGAGTGAATGGAAGG + Intergenic
1033807294 7:144969393-144969415 CCTTTAAAGGAGCCACTGGAAGG - Intergenic
1034131990 7:148727650-148727672 CCTTTGAAAGTATGACTGGAAGG + Intronic
1038675370 8:29617929-29617951 CCTTTCTAGCAGTGACTAGAAGG + Intergenic
1039660070 8:39451785-39451807 CTGTTAGAGTAGTGACTGGATGG - Intergenic
1039888871 8:41671252-41671274 CCTTTGAAGGAGGGGCTGGTGGG - Intronic
1040018995 8:42723644-42723666 CCTCTGGAGTAGTGGCTGCATGG + Intronic
1040860953 8:51998926-51998948 CATGTGGAGGGGTGGCTGGAGGG + Intergenic
1042102883 8:65293229-65293251 TCTTTGTAGGATTGACTGTAAGG + Intergenic
1042679414 8:71365685-71365707 CCTTTGGAACCGTGTCTGGATGG + Intergenic
1043591038 8:81834422-81834444 TCTTTGGGGGACTGTCTGGAAGG - Intronic
1045322582 8:101093122-101093144 CCTTTGTAGCAAAGACTGGAAGG - Intergenic
1046769914 8:118108723-118108745 CCTCTATAGGAGTGATTGGAAGG - Intronic
1049023134 8:139971151-139971173 CCTTTTGGGAAGTGCCTGGAAGG - Intronic
1049303156 8:141882486-141882508 CCCAGGGAGGAGTCACTGGAAGG - Intergenic
1051831391 9:21282211-21282233 CCTTAGGAGAAGTGAGTGAAGGG - Intergenic
1055600575 9:77913744-77913766 ACTTGGGAGTATTGACTGGAAGG + Intronic
1058569412 9:106324605-106324627 ACTTAGGAGGAGGGAGTGGAGGG + Intergenic
1059276699 9:113103756-113103778 GCTTTGAGGGAGTGATTGGATGG - Intergenic
1061859674 9:133461423-133461445 ACTTTGTAGGAGAGACTGGTGGG + Intronic
1186262394 X:7793029-7793051 CCTGTGGGGAAATGACTGGAAGG + Intergenic
1187261678 X:17690471-17690493 CTTTTGGAGGTGAGACTGTAAGG + Intronic
1187681189 X:21769448-21769470 CCTTGGCAGGGGTGGCTGGAAGG + Intergenic
1188528828 X:31114957-31114979 ACTTTAGAGAAGTGACTGGAGGG + Intronic
1189285053 X:39846234-39846256 CTTCTTGGGGAGTGACTGGAGGG - Intergenic
1197970804 X:132112928-132112950 TCTTTGGTGAAGTAACTGGATGG + Intronic
1200057373 X:153468732-153468754 CCAGTGGAGGAGTGACAGGCAGG - Intronic
1200306787 X:155033532-155033554 TCATTGGAGGTGTCACTGGATGG + Exonic