ID: 949987724

View in Genome Browser
Species Human (GRCh38)
Location 3:9553405-9553427
Sequence GGGGGCTGTCCTCAGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 270}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949987724 Original CRISPR GGGGGCTGTCCTCAGAAGCC AGG Intronic