ID: 949988568

View in Genome Browser
Species Human (GRCh38)
Location 3:9559170-9559192
Sequence GTGCAGAAATGGAACTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949988568_949988572 23 Left 949988568 3:9559170-9559192 CCATCTGAGTTCCATTTCTGCAC No data
Right 949988572 3:9559216-9559238 AGTTTCCTCATCTTTAAAGTGGG No data
949988568_949988571 22 Left 949988568 3:9559170-9559192 CCATCTGAGTTCCATTTCTGCAC No data
Right 949988571 3:9559215-9559237 CAGTTTCCTCATCTTTAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949988568 Original CRISPR GTGCAGAAATGGAACTCAGA TGG (reversed) Intergenic
No off target data available for this crispr