ID: 949995562

View in Genome Browser
Species Human (GRCh38)
Location 3:9613873-9613895
Sequence TACTGCCATGTAGGAGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949995562_949995569 15 Left 949995562 3:9613873-9613895 CCTGGTACTCCTACATGGCAGTA No data
Right 949995569 3:9613911-9613933 GAGAGAGGGACCCTTGCTCTTGG No data
949995562_949995572 30 Left 949995562 3:9613873-9613895 CCTGGTACTCCTACATGGCAGTA No data
Right 949995572 3:9613926-9613948 GCTCTTGGCTCCTGCTCTAGAGG No data
949995562_949995567 1 Left 949995562 3:9613873-9613895 CCTGGTACTCCTACATGGCAGTA No data
Right 949995567 3:9613897-9613919 CTCCTTAGAACAAGGAGAGAGGG No data
949995562_949995564 -7 Left 949995562 3:9613873-9613895 CCTGGTACTCCTACATGGCAGTA No data
Right 949995564 3:9613889-9613911 GGCAGTACCTCCTTAGAACAAGG No data
949995562_949995566 0 Left 949995562 3:9613873-9613895 CCTGGTACTCCTACATGGCAGTA No data
Right 949995566 3:9613896-9613918 CCTCCTTAGAACAAGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949995562 Original CRISPR TACTGCCATGTAGGAGTACC AGG (reversed) Intergenic