ID: 949995563

View in Genome Browser
Species Human (GRCh38)
Location 3:9613882-9613904
Sequence CTAAGGAGGTACTGCCATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949995563_949995573 22 Left 949995563 3:9613882-9613904 CCTACATGGCAGTACCTCCTTAG No data
Right 949995573 3:9613927-9613949 CTCTTGGCTCCTGCTCTAGAGGG No data
949995563_949995566 -9 Left 949995563 3:9613882-9613904 CCTACATGGCAGTACCTCCTTAG No data
Right 949995566 3:9613896-9613918 CCTCCTTAGAACAAGGAGAGAGG No data
949995563_949995567 -8 Left 949995563 3:9613882-9613904 CCTACATGGCAGTACCTCCTTAG No data
Right 949995567 3:9613897-9613919 CTCCTTAGAACAAGGAGAGAGGG No data
949995563_949995569 6 Left 949995563 3:9613882-9613904 CCTACATGGCAGTACCTCCTTAG No data
Right 949995569 3:9613911-9613933 GAGAGAGGGACCCTTGCTCTTGG No data
949995563_949995572 21 Left 949995563 3:9613882-9613904 CCTACATGGCAGTACCTCCTTAG No data
Right 949995572 3:9613926-9613948 GCTCTTGGCTCCTGCTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949995563 Original CRISPR CTAAGGAGGTACTGCCATGT AGG (reversed) Intergenic
No off target data available for this crispr