ID: 949995565

View in Genome Browser
Species Human (GRCh38)
Location 3:9613896-9613918
Sequence CCTCTCTCCTTGTTCTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949995565_949995573 8 Left 949995565 3:9613896-9613918 CCTCCTTAGAACAAGGAGAGAGG No data
Right 949995573 3:9613927-9613949 CTCTTGGCTCCTGCTCTAGAGGG No data
949995565_949995569 -8 Left 949995565 3:9613896-9613918 CCTCCTTAGAACAAGGAGAGAGG No data
Right 949995569 3:9613911-9613933 GAGAGAGGGACCCTTGCTCTTGG No data
949995565_949995572 7 Left 949995565 3:9613896-9613918 CCTCCTTAGAACAAGGAGAGAGG No data
Right 949995572 3:9613926-9613948 GCTCTTGGCTCCTGCTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949995565 Original CRISPR CCTCTCTCCTTGTTCTAAGG AGG (reversed) Intergenic