ID: 949995566

View in Genome Browser
Species Human (GRCh38)
Location 3:9613896-9613918
Sequence CCTCCTTAGAACAAGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949995555_949995566 22 Left 949995555 3:9613851-9613873 CCTTCCTTCCTTCCAGCCTTTGC No data
Right 949995566 3:9613896-9613918 CCTCCTTAGAACAAGGAGAGAGG No data
949995560_949995566 6 Left 949995560 3:9613867-9613889 CCTTTGCCTGGTACTCCTACATG No data
Right 949995566 3:9613896-9613918 CCTCCTTAGAACAAGGAGAGAGG No data
949995556_949995566 18 Left 949995556 3:9613855-9613877 CCTTCCTTCCAGCCTTTGCCTGG No data
Right 949995566 3:9613896-9613918 CCTCCTTAGAACAAGGAGAGAGG No data
949995559_949995566 10 Left 949995559 3:9613863-9613885 CCAGCCTTTGCCTGGTACTCCTA No data
Right 949995566 3:9613896-9613918 CCTCCTTAGAACAAGGAGAGAGG No data
949995558_949995566 14 Left 949995558 3:9613859-9613881 CCTTCCAGCCTTTGCCTGGTACT No data
Right 949995566 3:9613896-9613918 CCTCCTTAGAACAAGGAGAGAGG No data
949995563_949995566 -9 Left 949995563 3:9613882-9613904 CCTACATGGCAGTACCTCCTTAG No data
Right 949995566 3:9613896-9613918 CCTCCTTAGAACAAGGAGAGAGG No data
949995562_949995566 0 Left 949995562 3:9613873-9613895 CCTGGTACTCCTACATGGCAGTA No data
Right 949995566 3:9613896-9613918 CCTCCTTAGAACAAGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949995566 Original CRISPR CCTCCTTAGAACAAGGAGAG AGG Intergenic