ID: 949995568

View in Genome Browser
Species Human (GRCh38)
Location 3:9613899-9613921
Sequence GTCCCTCTCTCCTTGTTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949995568_949995573 5 Left 949995568 3:9613899-9613921 CCTTAGAACAAGGAGAGAGGGAC No data
Right 949995573 3:9613927-9613949 CTCTTGGCTCCTGCTCTAGAGGG No data
949995568_949995572 4 Left 949995568 3:9613899-9613921 CCTTAGAACAAGGAGAGAGGGAC No data
Right 949995572 3:9613926-9613948 GCTCTTGGCTCCTGCTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949995568 Original CRISPR GTCCCTCTCTCCTTGTTCTA AGG (reversed) Intergenic