ID: 949995568 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:9613899-9613921 |
| Sequence | GTCCCTCTCTCCTTGTTCTA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 949995568_949995573 | 5 | Left | 949995568 | 3:9613899-9613921 | CCTTAGAACAAGGAGAGAGGGAC | No data | ||
| Right | 949995573 | 3:9613927-9613949 | CTCTTGGCTCCTGCTCTAGAGGG | No data | ||||
| 949995568_949995572 | 4 | Left | 949995568 | 3:9613899-9613921 | CCTTAGAACAAGGAGAGAGGGAC | No data | ||
| Right | 949995572 | 3:9613926-9613948 | GCTCTTGGCTCCTGCTCTAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 949995568 | Original CRISPR | GTCCCTCTCTCCTTGTTCTA AGG (reversed) | Intergenic | ||