ID: 949995569

View in Genome Browser
Species Human (GRCh38)
Location 3:9613911-9613933
Sequence GAGAGAGGGACCCTTGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949995559_949995569 25 Left 949995559 3:9613863-9613885 CCAGCCTTTGCCTGGTACTCCTA No data
Right 949995569 3:9613911-9613933 GAGAGAGGGACCCTTGCTCTTGG No data
949995563_949995569 6 Left 949995563 3:9613882-9613904 CCTACATGGCAGTACCTCCTTAG No data
Right 949995569 3:9613911-9613933 GAGAGAGGGACCCTTGCTCTTGG No data
949995565_949995569 -8 Left 949995565 3:9613896-9613918 CCTCCTTAGAACAAGGAGAGAGG No data
Right 949995569 3:9613911-9613933 GAGAGAGGGACCCTTGCTCTTGG No data
949995558_949995569 29 Left 949995558 3:9613859-9613881 CCTTCCAGCCTTTGCCTGGTACT No data
Right 949995569 3:9613911-9613933 GAGAGAGGGACCCTTGCTCTTGG No data
949995560_949995569 21 Left 949995560 3:9613867-9613889 CCTTTGCCTGGTACTCCTACATG No data
Right 949995569 3:9613911-9613933 GAGAGAGGGACCCTTGCTCTTGG No data
949995562_949995569 15 Left 949995562 3:9613873-9613895 CCTGGTACTCCTACATGGCAGTA No data
Right 949995569 3:9613911-9613933 GAGAGAGGGACCCTTGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949995569 Original CRISPR GAGAGAGGGACCCTTGCTCT TGG Intergenic