ID: 949995572

View in Genome Browser
Species Human (GRCh38)
Location 3:9613926-9613948
Sequence GCTCTTGGCTCCTGCTCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949995563_949995572 21 Left 949995563 3:9613882-9613904 CCTACATGGCAGTACCTCCTTAG No data
Right 949995572 3:9613926-9613948 GCTCTTGGCTCCTGCTCTAGAGG No data
949995562_949995572 30 Left 949995562 3:9613873-9613895 CCTGGTACTCCTACATGGCAGTA No data
Right 949995572 3:9613926-9613948 GCTCTTGGCTCCTGCTCTAGAGG No data
949995565_949995572 7 Left 949995565 3:9613896-9613918 CCTCCTTAGAACAAGGAGAGAGG No data
Right 949995572 3:9613926-9613948 GCTCTTGGCTCCTGCTCTAGAGG No data
949995568_949995572 4 Left 949995568 3:9613899-9613921 CCTTAGAACAAGGAGAGAGGGAC No data
Right 949995572 3:9613926-9613948 GCTCTTGGCTCCTGCTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949995572 Original CRISPR GCTCTTGGCTCCTGCTCTAG AGG Intergenic