ID: 949995573

View in Genome Browser
Species Human (GRCh38)
Location 3:9613927-9613949
Sequence CTCTTGGCTCCTGCTCTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949995568_949995573 5 Left 949995568 3:9613899-9613921 CCTTAGAACAAGGAGAGAGGGAC No data
Right 949995573 3:9613927-9613949 CTCTTGGCTCCTGCTCTAGAGGG No data
949995563_949995573 22 Left 949995563 3:9613882-9613904 CCTACATGGCAGTACCTCCTTAG No data
Right 949995573 3:9613927-9613949 CTCTTGGCTCCTGCTCTAGAGGG No data
949995565_949995573 8 Left 949995565 3:9613896-9613918 CCTCCTTAGAACAAGGAGAGAGG No data
Right 949995573 3:9613927-9613949 CTCTTGGCTCCTGCTCTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949995573 Original CRISPR CTCTTGGCTCCTGCTCTAGA GGG Intergenic