ID: 949996549

View in Genome Browser
Species Human (GRCh38)
Location 3:9621818-9621840
Sequence ACCATGCTGGGCCTACAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949996537_949996549 20 Left 949996537 3:9621775-9621797 CCCACCTCGACCTCCCAAAGTGC No data
Right 949996549 3:9621818-9621840 ACCATGCTGGGCCTACAAGTAGG No data
949996542_949996549 10 Left 949996542 3:9621785-9621807 CCTCCCAAAGTGCTGGGATTACA No data
Right 949996549 3:9621818-9621840 ACCATGCTGGGCCTACAAGTAGG No data
949996540_949996549 16 Left 949996540 3:9621779-9621801 CCTCGACCTCCCAAAGTGCTGGG No data
Right 949996549 3:9621818-9621840 ACCATGCTGGGCCTACAAGTAGG No data
949996538_949996549 19 Left 949996538 3:9621776-9621798 CCACCTCGACCTCCCAAAGTGCT No data
Right 949996549 3:9621818-9621840 ACCATGCTGGGCCTACAAGTAGG No data
949996544_949996549 7 Left 949996544 3:9621788-9621810 CCCAAAGTGCTGGGATTACAGGT No data
Right 949996549 3:9621818-9621840 ACCATGCTGGGCCTACAAGTAGG No data
949996545_949996549 6 Left 949996545 3:9621789-9621811 CCAAAGTGCTGGGATTACAGGTG No data
Right 949996549 3:9621818-9621840 ACCATGCTGGGCCTACAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949996549 Original CRISPR ACCATGCTGGGCCTACAAGT AGG Intergenic